Origins - what cause explains best our existence, and why?

Origins - what cause explains best our existence, and why?

Origins - what cause explains best our existence, and why? - INDEX & CHAPTERS
https://reasonandscience.catsboard.com/t2820-origins-what-cause-explains-best-our-existence-and-why-index-chapters


Molecular biochemistry, biology, the origin of life and biodiversity, systematically analyzed from a universal perspective
https://reasonandscience.catsboard.com/t2590-origins-what-cause-explains-best-our-existence-and-why

Content

Abiogenesis, and the origin of life
Crack the Genetic Code and Cipher
Current scientific models and attempts to explain the Origin of Life
Current scientific transition proposals from a supposed "progenote" to the last universal common ancestor (LUCA)
LUCA—The Last Universal Common Ancestor
Essential elements and building blocks for the origin of life
From DNA to Proteins
The Cell
The three domains of life
Membrane Structure, Synthesis, and Transport
Energy, Enzymes, and Metabolism
Cellular respiration and fermentation
Photosynthesis
Cell Communication
Multicellularity
Gene expression at the molecular level
Gene Regulation
The Eukaryotic Cell Cycle, Mitosis, and Meiosis
Developmental Genetics
Amino Acids and peptide bonding
A common step determines the chirality of all amino acids
The amino acid sequences of polypeptides determine the structure and function of Proteins
Overview of the Nitrogenase enzyme complex
Breaking the N2 triple bond: insights into the nitrogenase mechanism
Peptide bonding of amino acids to form proteins and its origins
What Is the Metabolic Fate of Ammonium?
Glutamine synthetase (GS), a incredible molecular super-computer which defies naturalistic explanations
How Do Organisms Synthesize Amino Acids?
The folate biosynthesis pathway
Cheating of secular science papers, claiming of evolutionary mechanisms in place prior to life fully setup and self-replication.

Key terms:
Spontaneous generation
Primordial soup
Miller–Urey experiment
Amino acids
Polymerization
Lipids
Carbohydrates
Nucleic acids
Hydrophilic
Hydrophobic
Lipid bilayer membrane
Catalyst
Zeolites
Black smokers
Archaea
Ribozymes
RNA world
Prokaryotes
Eukaryotes
Organelles
Mitochondria
Chloroplasts
Flagellum
Endosymbiosis theory

This book aims to distinguish itself from other books on biochemistry based on the philosophical framework of methodological naturalism.  The author starts with the admission that both possible causal mechanisms of origins, intelligent and mental, and natural ( non-intelligent ) deserve to be scrutinized, tested, elucidated and analyzed, in order to find the best, case-adequate answers of origins. In this book, we will analyze how information-based molecular machines, metabolic networks, and organisms operate, currently accepted explanations of origins, their shortcomings, and propose eventually intelligent design/divine creation as a better, more compelling explanation of origins.

Historical sciences, and methodological naturalism
Methodological naturalism is necessary for science because science requires that as a precondition of investigating natural things. It is not necessary to elucidate historical facts, however. History does not investigate by empirically determining anything. Although history does seek to answer questions about the past, it requires only that the past is rational. Rational simply means that there is a reason. So if something did happen that was an act of God in the past, then as long as that act had a reason, history can investigate it.

The specific complex information of living systems as, well as fine-tuning agents of a life-permitting universe and immaterial truths have causal materialistic dead ends. However, intelligent design is a current observable mechanism to explain the design, thus are an adequate simple causal mechanism to explain these realities of our universe, its fine tuning improbabilities, information, immaterial abstracts, etc. Intelligence can and is a causal agent in the sciences such as forensics, archeology engineering, etc., thus there is no reason to rule out a priori the unobserved designer scientifically. We only rule him out by philosophical or anti-religious objection, which anybody has the free will right to do, but it isn't necessarily true or right to do so, and we can't use science to do so, if we are unbiased, correctly using the discipline. Additionally, to argue nonempirical causes are inadequate would rule out many would be mainstream secular materialistic hypothetical causes as well. It then becomes a matter of preference to the type of causes one is willing to accept and one's preferred worldview has a lot to do with that. 1

There are basically 3 possible  causing agents of origins and the universe as a whole:

1. Of the universe and the physical laws: an intelligent creator, or random unguided natural events
2. Of the fine-tuning of the universe  and the origin of life: an intelligent creator, random unguided natural events, and physical necessity
3. Of biodiversity: above three, and evolution

Physical necessity is the term that is given to the situation where something is forced to take a certain course of action. Events that are conditioned by some values, forces, laws, norms or goals.  In physics,  the concept of necessity was applied to cases of strict determination and restriction due to so-called causal laws. It's the hypothesis that the constants and quantities had to have the values they do so that the universe and the earth could not take any other course, than the one it did. 1,3
Intelligent design/creation stands for guided, reason based, directed, planned, projected, programmed, information based,  goal-constrained, willed causation by a conscient intelligent powerful eternal, non-caused agency. Chance and evolution could be a included mechanism in the intended goal, but that would in the end still be an intelligence-based process.
Evolution: Biodiversity by evolution through random mutations and natural selection, genetic drift, gene flow, or pre-programmed evolution 

There are only these options.  Either is there an intelligent creator, or there is not. Those are the only options.  If there is no God, then everything is a result of ..... what exactly?
Chance, as exposed above, isn't a thing. Physical necessity could only act once a physical universe exists. Beyond the universe, there were no physical laws.

Once it's granted that nothing has no causal powers, it's evident the universe could not have emerged from absolutely anything. Nobody times nothing equals everything is irrational to the extreme nonetheless, some very "smart" people think that proposition makes sense, and write extensive books about the subject ). Or, behind this complex universe is an incomprehensibly intelligent and powerful eternal being who made everything.

This result means that intelligent design cannot be removed entirely from consideration in the historical sciences. They are a division of history rather than science, and what applies to history, in general, applies to them. However, evidence must be found to support them.

We do not need direct observed empirical evidence to infer design. As anyone who has watched TV's Crime Scene Investigation knows, scientific investigation of a set of data (the data at the scene of a man's death) may lead to the conclusion that the event that produced the data (the death) was not the product of natural causes, not an accident, in other words, but was the product of an intelligence a perpetrator.
But of course, the data at the crime scene usually can't tell us very much about that intelligence. If the data includes fingerprints or DNA that produces a match when cross-checked against other data fingerprint or DNA banks it might lead to the identification of an individual. But even so, the tools of natural science are useless to determine the I.Q. of the intelligence, the efficiency vs. the emotionalism of the intelligence, or the motive of the intelligence. That data, analyzed by only the tools of natural science, often cannot permit the investigator to construct a theory of why the perpetrator acted. Sherlock Holmes can use chemistry to figure out that an intelligence a person did the act that killed the victim, even if he can't use chemistry to figure out that the person who did it was Professor Moriarty, or to figure out why Moriarty did the crime. 
Same when we observe the natural world. It gives us hints about how it could have been created. We do not need to present the act of creation to infer creationism / Intelligent design.

This illustrates why I am against methodological naturalism applied in historical sciences because it teaches us to be satisfied with not permitting the scientific evidence of historical events to lead us wherever it is. Philosophical Naturalism is just one of the possible explanations of  the origin of the universe, it's fine-tuning, has no answer about the origin of life, explains very little about biodiversity, and what it explains, it explains bad, has no explanation about essential questions, like the rise of photosynthesis, sex, conscience, speech, languages, morality. It short: it lacks considerable explaining power,  which attracts so many believers because they think, they do in their life whatever pleases them, no interference from above.

Sean Carroll, The Big Picture: On the Origins of Life, Meaning, and the Universe Itself.
Science should be interested in determining the truth, whatever that truth may be – natural, supernatural, or otherwise. The stance is known as methodological naturalism, while deployed with the best of intentions by supporters of science, amounts to assuming part of the answer ahead of time. If finding truth is our goal, that is just about the biggest mistake we can make. 15

Scientific evidence is what we observe in nature. The understanding of it like microbiological systems and processes is the exercise and exploration of science. What we infer through the observation, especially when it comes to the origin of given phenomena in nature, is philosophy, and based on individual induction and abductional reasoning. What looks like a compelling explanation to somebody, cannot be compelling to someone else, and eventually, I infer the exact contrary.

In short, the imposition of methodological naturalism is plainly question-begging, and it is thus an error of method.

How to recognize the signature of (past) intelligent actions

PROBABILITY AND SCIENCE
A typical misconception about science is that it can tell us what will definitely happen now or in the future given enough time, or what would certainly have happened in the past, given enough time. The truth is, science is limited in that it does not grant absolute truth, but only yields degrees of probability or likelihood. Science observes the Universe, records evidence, and strives to draw conclusions about what has happened in the past, is happening now, and what will potentially happen in the future, given the current state of scientific knowledge—which is often times woefully incomplete, and even inaccurate. The late, prominent evolutionist George Gaylord Simpson discussed the nature of science and probability several years ago in the classic textbook, Life: An Introduction to Biology, stating:

We speak in terms of “acceptance,” “confidence,” and “probability,” not “proof.” If by proof is meant the establishment of eternal and absolute truth, open to no possible exception or modification, then proof has no place in the natural sciences.

Luke A. Barnes:
Theory testing in the physical sciences has been revolutionized in recent decades by Bayesian approaches to probability theory.
Wiki: Bayesian inference is a method of statistical inference in which Bayes' theorem is used to update the probability of a hypothesis as more evidence or information becomes available. Bayesian inference is an important technique in statistics, and especially in mathematical statistics. Bayesian updating is particularly important in the dynamic analysis of a sequence of data. Bayesian inference has found application in a wide range of activities, including science, engineering, philosophy, medicine, sport, and law.  .......and......... historical sciences, including intelligent design theory which tries to explain how most probably past events occurred. That is similar to abductive reasoning :
Wiki: Abductive reasoning is a form of logical inference which goes from an observation to a theory which accounts for the observation, ideally seeking to find the simplest and most likely explanation. In abductive reasoning, unlike in deductive reasoning, the premises do not guarantee the conclusion. One can understand the abductive reasoning as "instant-deduction to the best explanation". 3

No one can know with absolute certainty that the design hypothesis is false.  It follows from the absence of absolute knowledge, that each person should be willing to accept at least the possibility that the design hypothesis is correct, however remote that possibility might seem to him.  Once a person makes that concession, as every honest person must, the game is up.  The question is no longer whether ID is science or non-science.  The question is whether the search for the truth of the matter about the natural world should be structurally biased against a possibly true hypothesis. 4

For, we did not – and cannot -- directly observe the remote past, so origins science theories are in the end attempted “historical” reconstructions of what we think the past may have been like. Such reconstructions are based on investigating which of the possible explanations seems "best" to us on balance in light of the evidence. However, to censor out a class of possible explanations ahead of time through imposing materialism plainly undermines the integrity of this abductive method.

Methodological naturalism is the label for the required assumption of philosophical naturalism when working with the scientific method. Methodological naturalists limit their scientific research to the study of natural causes, because any attempts to define causal relationships with the supernatural are never fruitful, and result in the creation of scientific "dead ends" and God of the gaps-type hypotheses. To avoid these traps scientists assume that all causes are empirical and naturalistic; which means they can be measured, quantified and studied methodically. 5

The first difference is that historical study is a matter of probability. Any and all historical theories are supported by evidence that is not deductive in nature. We might consider them to be inferences to the best explanation, or Bayesian probabilities but they cannot be deductions. historical theories are not based on experiments, – repeatable or otherwise – nor are historical theories subject to empirical verification. The evidence for a historical theory may be empirical, but the theory itself is not. These differences mean that one cannot simply treat science and history as similar disciplines. 6

Stephen Meyer: 
Studies in the philosophy of science show that successful explanations in historical sciences such as evolutionary biology need to provide “causally adequate” explanations—that is, explanations that cite a cause or mechanism
capable of producing the effect in question. In On the Origin of Species, Darwin repeatedly attempted to show that his theory satisfied this criterion, which was then called the vera causa (or “true cause”) criterion. In the third chapter of the Origin, for example, he sought to demonstrate the causal adequacy of natural selection by drawing analogies between it and the power of animal breeding and by extrapolating from observed instances of small-scale evolutionary change over short periods of time. 7

Is the mind natural, or supernatural? and what does it tell us about the theory of intelligent design? 



Descartes, the 17th-century philosopher was a dualist, proposing that our consciousness/mind has a separate reality from our body. Is there a God-created soul and spirit and consciousness which exists apart from the body? This is a scientific a philosophical and a religious question. If there are a non-physical soul and spirit, then it might not be detectable by any direct physical measurement, and therefore, it might be, by definition, supernatural. I agree on dualism, based on clinical experiments and testimonies, and philosophy of the mind 9. Since the mind cannot be detected physically, it is a non-physical entity, and does not belong to the realm of the physical world, and is supernatural. 

1. The mind is supernatural 
2  The effects of the mind are natural, physical, tangible, visible, and can be tested scientifically. 

Popper argued that the central property of science is falsifiability. That is, every genuinely scientific claim is capable of being proven false, at least in principle. 

So can the substance of the mind be subject to scientific scrutiny and inquiry? No. 
Can the effects of the mind subject to scientific scrutiny and testing? yes. 

According to Discovery, the theory of intelligent design holds that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection. 10 ID is a scientific theory that employs the methods commonly used by other historical sciences to conclude that certain features of the universe and of living things are best explained by an intelligent cause, not an undirected process such as natural selection.  ID theorists argue that design can be inferred by studying the informational properties of natural objects to determine if they bear the type of information that in our experience arise from an intelligent cause. The form of information which we observe is produced by intelligent action, and thus reliably indicates design, is generally called “specified complexity” or “complex and specified information” (CSI). An object or event is complex if it is unlikely, and specified if it matches some independent pattern. 

The U.S. National Academy of Sciences has however stated that "creationism, intelligent design, and other claims of supernatural intervention in the origin of life or of species are not science because they are not testable by the methods of science." 11

So they question the fact, that the action of a supernatural agent cannot be tested by the methods of science. There is, however, a shift of terminology, while Discovery points to the effects of intelligence, and how features in nature point to an intelligent agent, the academy of sciences requires that the intervention, the act per se of creation, should be possible of observation, and testing. And if it does not meet that criterion, it's not science. Is that true? 

The distinction is basically operational x historical sciences. While through operational sciences  following questions can be answered : 

1. What is X (  Elucidating the components and structure )
2. What does X ( the action, how it works, functions, and operates )
3. What is the performance of X ( what is the efficiency etc. )
4. What is the result of the performance of  X  ( the result of the action. )

historical sciences ask: 

5. What is the origin of X ( how did X arise ) 

The action of X can be observed and tested in operational sciences. The action of X, however, cannot be observed directly in historical sciences, since events in the past are in question. 

Proponents of ID are accused of making a false distinction, and there is no such thing as operational x historical science. But Jeff Dodick writes: 

Despite the still-regnant concept of science proceeding by a monolithic “Scientific Method”, philosophers and historians of science are increasingly recognizing that the scientific methodologies of the historical sciences (e.g., geology, palaeontology) differ fundamentally from those of the experimental sciences (e.g., physics, chemistry). This new understanding promises to aid education, where currently students are usually limited to the dominant paradigm of the experimental sciences, with little chance to experience the unique retrospective logic of the historical sciences. A clear understanding of these methodological differences and how they are expressed in the practice of the earth sciences is thus essential to developing effective educational curricula that cover the diversity of scientific methods. 10

And Ann Gauger uses the same line of reasoning when she writes:
Defenders of methodological naturalism often invoke definitionally or "demarcation criteria" that say that all science must be observable, testable, falsifiable, predictive, and repeatable. Most philosophers of science now dismiss these criteria because there are too many exceptions to the rules they establish in the actual practice of science. Not all science involves observable entities or repeatable phenomena, for example --you can't watch all causes at work or witness all events happen again and again, yet you can still make inferences about what caused unique or singular events based on the evidence available to you. Historical sciences such as archaeology, geology, forensics, and evolutionary biology all infer causal events in the past to explain the occurrence of other events or to explain the evidence we have left behind in the present. For such inference to work, the cause invoked must now be known to produce the effect in question. It's no good proposing flying squirrels as the cause of the Grand Canyon, or a silt deposit as the cause of the Pyramids. Squirrels don't dig giant canyons or even small ones, and silt doesn't move heavy stone blocks into an ordered three-dimensional array. However, we know from our experience that erosion by running water can and does produce gullies, then arroyos, and by extension, canyons. We know that intelligent agents have the necessary design capabilities to envision and build a pyramid. No natural force does. These are inferences based on our present knowledge of cause and effect or "causes now in operation." The theory of intelligent design also qualifies as historical science. We cannot directly observe the cause of the origin of life or repeat the events we study in the history of life, but we can infer what cause is most likely to be responsible, as Stephen Meyer likes to say, "from our repeated and uniform experience." In our experience the only thing capable of causing the origin of digital code or functional information or causal circularity is intelligence and we know that the origin of life and the origin of animal life, for example, required the production of just such things in living systems. Even though other demarcation criteria for distinguishing science from non-science are no longer considered normative for all branches of science, it is worth checking to see how well intelligent design fares using criteria that are relevant for a historical science. Briefly, although the designing agent posited by the theory of intelligent design is not directly observable (as most causal entities posited by historical scientists are not), the theory is testable and makes many discriminating predictions. Steve Meyer's book Signature in the Cell, Chapters 18 and 19 and Appendix A, discuss this thoroughly. 14

We can detect and make a distinction between the patterns and effects of a mind, and compare to the effects of natural causal agencies, physical and chemical reactions and interactions, and draw conclusions upon the results.  That's where ID kicks in, detecting design patterns, and test what is observed in the natural world, to see if they have signs of an intelligent causal agency, and compare the evidence with the efficiency of natural causes, to then, at the end, infer which explanation makes most sense, and fits best the evidence.   So intelligent design does not try to test or to detect or to identify the designer, nor try to detect and test the action of creation, and neither is that required to detect design and infer it as the best explanation of origins,  but examine the natural effects , and upon the results, draw inferences that can provide conclusions of the best explanation model for the most probable origin and cause of the physical parts. So the mere fact that a supernatural agent and its action cannot be scrutinized and observed directly and scientifically, does not disqualify ID as a scientific theory. 

Paley's watchmaker argument
William Paley (July 1743 – 25 May 1805) was an English clergyman, Christian apologist, philosopher, and utilitarian. He is best known for his natural theology exposition of the teleological argument for the existence of God in his work Natural Theology or Evidences of the Existence and Attributes of the Deity, which made use of the watchmaker analogy. 1



I love analogies, and Paley's watchmaker analogy is a classic: 

In WILLIAM PALEY's  book  :
Natural Theology or Evidence of the Existence and Attributes of the Deity, collected from the appearances of nature  2, page 46, he writes : 

In crossing a heath, suppose I pitched my foot against a stone and were asked how the stone came to be there, I might possibly answer, that, for anything I knew to the contrary, it had lain there for ever: nor would it perhaps be very easy to shew the absurdity of this answer. But suppose I had found a watch* upon the ground, and it should be inquired how the watch happened to be in that place, I should hardly think of the answer which I had before given, that, for anything I knew, the watch might have always been there. Yet why should not this answer serve for the watch, as well as for the stone? Why is it not as admissible in the second case, as in the first? For this reason, and for no other, viz. that, when we come to inspect the watch, we perceive (what we could not discover in the stone) that its several parts are framed and put together for a purpose, e.g. that they are so formed and adjusted as to produce motion, and that motion so regulated as to point out the hour of the day; that, if the several parts had been differently shaped from what they are, of a different size from what they are, or placed after any other manner, or in any other order, than that in which they are placed, either no motion at all would have been carried on in the machine, or none which would have answered the use, that is now served by it. 

My comment: Without knowing about biology as we do today, Paley made an observation, which is spot on, and has astounding significance and correctness, applied to the reality of the molecular world. Let's list the points he mentioned again:


- parts differently shaped
- different size
- placed after any other manner
- or in any other order


no motion would be the result. 


That applies precisely as well to biological systems, and cells. Each of these four points must evolve correctly, or no improved or new biological function is granted. How many mutations would be required to get from a unicellular organism to multicellular organism? Would evolution not have to go in a gradual slow, increasing manner from one eukaryotic cell to an organism with two cells,   3 cells, and so on,  to get in the end an organism with millions, and billions of cells?  Let's suppose there were unicellular organisms, and evolutionary pressure to go from one to two cells. What and how many mutations would be required in the genome? Mutations would have to provide the change of a considerable number of internal cell functions and created NEW information for AT LEAST all four requirements mentioned by Paley, but many more, as listed here :

He continues: To reckon up a few of the plainest of these parts, and of their offices, all tending to one result:––We see a cylindrical box containing a coiled elastic spring, which, by its endeavour to relax itself, turns round the box. We next observe a flexible chain (artificially wrought for the sake of flexure) communicating the action of the spring from the box to the fusee. We then find a series of wheels, the teeth of which catch in, and apply to, each other, conducting the motion from the fusee to the balance, and from the balance to the pointer; and at the same time, by the size and shape of those wheels, so regulating that motion, as to terminate in causing an index, by an equable and measured progression, to pass over a given space in a given time. We take notice that the wheels are made of brass, in order to keep them from rust; the springs of steel, no other metal being so elastic; that over the face of
the watch there is placed a glass, a material employed in no other part of the work, but, in the room of which, if there had been any other than a transparent substance, the hour could not be seen without opening the case.



My comment: The choice of materials is also an essential ingredient and factor to be considered. Bones are totally different in terms of consistency than collagen - both essential for advanced multicellular organisms, and its synthesis is highly complex, ordered, it depends on the right substrates, right intake of the cell, complex mechanisms to transform brute forms of molecules into useful form, complex molecular machines, and manufacturing processes, and the information to direct the material to the right place. A lot of things to inform and to get right, in order for natural selection to choose just the right random mutations, no?  

This mechanism* being observed (it requires indeed an examination of the instrument, and perhaps some previous knowledge of the subject, to perceive and understand it; but being once, as we have said, observed and understood), the inference, we think, is inevitable; that the watch must have had a maker; that there must have existed, at some time and at some place or other, an artificer or artificers who formed it for the purpose which we find it actually to answer; who comprehended its construction, and designed its use.

My comment: Now Paley goes to address the common objections: " We have never observed a being of any capacity creating biological systems and life."  

I. Nor would it, I apprehend, weaken the conclusion, that we had never seen a watch made; that we had never known an artist capable of making one; that we were altogether incapable of executing such a piece of workmanship ourselves, or of understanding in what manner it was performed: all this being no more than what is true of some exquisite remains of ancient art, of some lost arts, and, to the generality of mankind, of the more curious productions of modern manufacture. Does one man in a million know how oval frames are turned? Ignorance of this kind exalts our opinion of the unseen and unknown artist’s skill, if he be unseen and unknown, but raises no
doubt in our minds of the existence and agency of such an artist, at some former time, and in some place or other. Nor can I perceive that it varies at all the inference, whether the question arise concerning a human agent, or concerning an agent of a different species, or an agent possessing, in some respects, a different nature.

Objection: Does bad design mean no design? 
Response: II. Neither, secondly, would it invalidate our conclusion, that the watch sometimes went wrong, or that it seldom went exactly right. The purpose of the machinery, the design, and the designer might be evident, and in the case supposed would be evident, in whatever way we accounted for the irregularity of the movement, or whether we could account for it or not. It is not necessary that a machine is perfect, in order to shew with what design it was made: still less necessary, where the only question is, whether it were made with any design at all.


Objection: We don't know the use of a particular organ in a biological system:

III. Nor, thirdly, would it bring any uncertainty into the argument, if there were a few parts of the watch, concerning which we could not discover, or had not yet discovered, in what manner they conducted to the general effect; or even some parts, concerning which we could not ascertain, whether they conduced to that effect in any manner whatever. For, as to the first branch of the case; if, by the loss, or disorder, or decay of the parts in question, the movement of the watch were found in fact to be stopped, or disturbed, or retarded, no doubt would remain in our minds as to the utility or intention of these parts, although we should be unable to investigate the manner according to which, or the connection by which, the ultimate effect depended upon their action or assistance: and the more complex is the machine, the more likely is this obscurity to arise. Then, as to the second thing supposed, namely, that there were parts, which might be spared without prejudice to the movement of the watch, and that we had proved this by experiment,––these superfluous parts, even if we were completely assured that they were such, would not vacate the reasoning which we had instituted concerning other parts. The indication of contrivance remained, with respect to them, nearly as it was before.


Objection: Physical laws, rather than design, explain the origin of complex systems:

And not less surprised to be informed, that the watch in his hand was nothing more than the result of the laws of metallic nature. It is a perversion of language to assign any law, as the efficient, operative, cause of anything. A law presupposes an agent; for it is only the mode, according to which an agent proceeds: it implies a power; for it is the order, according to which that power acts. Without this agent, without this power, which is both distinct from itself, the law does nothing; is nothing. The expression, ‘the law of metallic nature,’ may sound strange and harsh to a philosophic ear, but it seems quite as justifiable as some others which are more familiar to him, such as ‘the law of vegetable nature’––‘the law of animal nature,’ or indeed as ‘the law of nature’ in general, when assigned as the cause of phænomena, in exclusion of agency and power; or when it is substituted into the place of these.


1. Credit to: Steven Guzzi
2. Jeff Miller, Ph.D.,  2011, God and the Laws of Science: The Laws of Probability 
http://www.apologeticspress.org/APContent.aspx?category=12&article=3726
3. Luke A. Barnes, April 7, 2017,  Testing the Multiverse: Bayes, Fine-Tuning and Typicality
https://arxiv.org/pdf/1704.01680.pdf
4. June 10, 2010, The Independent Origins Science Education course
http://iose-gen.blogspot.com.br/2010/06/introduction-and-summary.html#methnat
5. Methodological naturalism
http://rationalwiki.org/wiki/Methodological_naturalism
6. Methodological Naturalism, Science and History
http://simplyphilosophy.org/methodological-naturalism-science-and-history/
7. Stephen C. Meyer, Darwin's Doubt pg.162
8. https://reasonandscience.catsboard.com/t1284-near-death-experience-evidence-of-dualism
9. https://reasonandscience.catsboard.com/t1662-the-mind-is-not-the-brain
10. Center for Science and Culture  Frequently Asked Questions
http://www.discovery.org/id/faqs/
11. Intelligent design and science
https://en.wikipedia.org/wiki/Intelligent_design_and_science
12. John Oakes, May 5, 2013, Is human thought evidence of the supernatural or of the existence of God?
http://evidenceforchristianity.org/is-human-thought-evidence-of-the-supernatural-or-of-the-existence-of-god/
13. Jeff Dodick,  Rediscovering the Historical Methodology of the Earth Sciences by Analyzing Scientific Communication Styles
http://serc.carleton.edu/files/serc/dodickargamon-f.pdf
14. http://www.evolutionnews.org/2015/11/more_on_the_mec100891.html
15. https://evolutionnews.org/2017/09/intelligent-design-and-methodological-naturalism-no-necessary-contradiction/

Abiogenesis, and the origin of life

- Overall description
- function
- structure
- classes
- mechanism and reaction
- biosynthesis
- regulation
- repair
- origin and evolution

Paul Davies, the Origin of life, page 17:
The problem of how and where life began is one of the great outstanding mysteries of science. But it is more than that. The story of life's origin has ramifications for philosophy and even religion. Answers to such profound questions as whether we are the only sentient beings in the universe, whether life is the product of random accident or deeply rooted law, and whether there may be some sort of ultimate meaning to our existence, hinge on what science can reveal about the formation of life. In a subject supercharged with such significance, lack of agreement is unsurprising. Some scientists regard life as a bizarre chemical freak, unique in the universe, while others insist that it is the expected product of felicitous natural laws. If the magnificent edifice of life is the consequence of a random and purely incidental quirk of fate, as the French biologist Jacques Monod claimed, we must surely find common cause with his bleak atheism, so eloquently expressed in these words:  The ancient covenant is in pieces: man, at last, knows that he is alone in the unfeeling immensity of the universe, out of which he has emerged only by chance. Neither his destiny nor his duty have been written down. But if it transpires that life emerged more or less on cue as part of the deep lawfulness of the cosmos – if it is scripted into the great cosmic drama in a basic manner – it hints at a universe with a purpose. In short, the origin of life is the key to the meaning of life.

Peering into life's innermost workings serves only to deepen the mystery. The living cell is the most complex system of its size known to mankind. Its host of specialized molecules, many found nowhere else but within living material, are themselves already enormously complex. They execute a dance of exquisite fidelity, orchestrated with breathtaking precision. Vastly more elaborate than the most complicated ballet, the dance of life encompasses countless molecular performers in synergetic coordination. Yet this is a dance with no sign of a choreographer. No intelligent supervisor, no mystic force, no conscious controlling agency swings the molecules into place at the right time, chooses the appropriate players, closes the links, uncouples the partners, moves them on. The dance of life is spontaneous, self-sustaining and self-creating. How did something so immensely complicated, so finessed, so exquisitely clever, come into being? How can mindless molecules, capable only of pushing and pulling their immediate neighbours, cooperate to form and sustain something as ingenious as a living organism?

My comment: True. There is no sign of a choreographer intervening. Life is self-sustaining, which is evidence of an enormously intelligent creator which setup life, perpetuating autonomously, the way it is.

What is life?
The National Aeronautics and Space Agency (NASA) of the United States gives an operative definition of life: “Life is a self-sustained chemical system able to undergo Darwinian evolution.” The NASA definition is extensively used in the origins of life field. The NASA definition of life is fully compatible with the following one, structured in more detail: To comprehend the beginnings of life requires that we explain the origin of replication as well as of metabolism synergistically. While metabolism supplies the monomers from which the replicators (i.e., genes) are made, replicators alter the kinds of chemical reactions occurring in metabolism. Only then can natural selection, acting on replicators, power the evolution of metabolism 10

Living things are autopoietic systems: they make themselves. Self-making implies a multitude of activities directed towards the acquisition of matter and energy, production of the fabric, maintenance and repair, and ultimately reproduction. Not surprisingly, even the simplest cells are dauntingly complex systems made up of many thousands of molecules arranged into functional units. Over the past half-century we have become thoroughly familiar with the standard parts found (with variations) in all cells: enzymes and genes, transport systems and scaffolding, ribosomes and membranes, and organs of mobility. We know in general what they do and how they work, and how they contribute to the operations and architecture of the whole cell. By contrast, we know very little about how these devices, or the cell as a whole, came to be. 8 Life’s devices are organelles; they have functions that confer benefits upon the cell or organism as a whole. 

Paul Davies: 1

-Reproduction.
-Metabolism. 
-Nutrition.
-Complexity.
-Organization. 
-Growth and development.
-Information content. 
-Hardware/software entanglement. 
-Permanence and change. 


11

Autonomy is one important characteristic of life. But there are many others, including the following:

Reproduction. A living organism should be able to reproduce. However, some nonliving things, like crystals and bushfires, can reproduce, whereas viruses, which many people would regard as living, are unable to multiply on their own. Mules are certainly living, even though, being sterile, they cannot reproduce. A successful offspring is more than a mere facsimile of the original; it also includes a copy of the replication apparatus. To propagate their genes beyond the next generation, organisms must replicate the means of replication, as well as replicating the genes themselves.

Metabolism. To be considered as properly alive, an organism has to do something. Every organism processes chemicals through complicated sequences of reactions, and as a result garners energy to enable it to carry out tasks, such as movement and reproduction. This chemical processing and energy liberation is called metabolism. However, metabolism cannot be equated with life. Some micro-organisms can become completely dormant for long periods of time, with their vital functions shut down. We would be reluctant to pronounce them dead if it is possible for them to be revived.

Nutrition. This is closely related to metabolism. Seal up a living organism in a box for long enough and in due course it will cease to function and eventually die. Crucial to life is a continual throughput of matter and energy. For example, animals eat, plants photosynthesize. But a flow of matter and energy alone fails to capture the real business of life. The Great Red Spot of Jupiter is a fluid vortex sustained by a flow of matter and energy. Nobody suggests it is alive. In addition, it is not energy as such that life needs, but something like useful, or free, energy. More on this later.

Complexity. All known forms of life are amazingly complex. Even single-celled organisms such as bacteria are veritable beehives of activity involving millions of components. In part, it is this complexity that guarantees the unpredictability of organisms. On the other hand, a hurricane and a galaxy are also very complex. Hurricanes are notoriously unpredictable. Many non-living physical systems are what scientists call chaotic -- their behaviour is too complicated to predict, and may even be random.

Organization. Maybe it is not complexity per se that is significant but organized complexity. The components of an organism must cooperate with each other or the organism will cease to function as a coherent unity. For example, a set of arteries and veins are not much use without a heart to pump blood through them. A pair of legs will offer little locomotive advantage if each leg moves on its own, without reference to the other. Even within individual cells, the degree of cooperation is astonishing. Molecules don't simply career about haphazardly, but show all the hallmarks of a factory assembly line, with a high degree of specialization, a division of labour, and a command-and-control structure.

Growth and development. Individual organisms grow and ecosystems tend to spread (if conditions are right). But many nonliving things grow too (crystals, rust, clouds). A subtler yet altogether more significant property of living things, treated as a class, is development. The remarkable story of life on Earth is one of gradual evolutionary adaptation, as a result of variety and novelty. Variation is the key. It is replication combined with variation that leads to Darwinian evolution. We might consider turning the problem upside down and say: if it evolves in the way Darwin described, it lives.

Information content. In recent years scientists have stressed the analogy between living organisms and computers. Crucially, the information needed to replicate an organism is passed on in the genes from parent to offspring. So life is information technology writ small. But, again, information as such is not enough. Though there is information aplenty in the positions of the fallen leaves in a forest, it doesn't mean anything. To qualify for the description of living, information must be meaningful to the system that receives it: there must be a "context." In other words, the information must be specified. But where does this context itself come from, and how does a meaningful specification arise spontaneously in nature?

Hardware/software entanglement. As we shall see, all life of the sort found on Earth stems from a deal struck between two very different classes of molecules: nucleic acids and proteins. These groups complement each other in terms of their chemical properties, but the contract goes much deeper than that, to the very heart of what is meant by life. Nucleic acids store life's software; the proteins are the real workers and constitute the hardware. The two chemical realms can support each other only because there is a highly specific and refined communication channel between them mediated by a code, the so-called genetic code. This code, and the communication channel -- both advanced products of evolution -- have the effect of entangling the hardware and software aspects of life in a baffling and almost paradoxical manner.

Permanence and change. A further paradox of life concerns the strange conjunction of permanence and change. This ancient puzzle is sometimes referred to by philosophers as the problem of being versus becoming. The job of genes is to replicate, to conserve the genetic message. But without variation, adaptation is impossible and the genes will eventually get snuffed out: adapt or die is the Darwinian imperative. How do conservation and change coexist in one system? This contradiction lies at the heart of biology. Life flourishes on Earth because of the creative tension that exists between these conflicting demands; we still do not fully understand how the game is played out.

What can we know about how life began? 
Nobody knows for sure. When it comes to historical sciences, nobody was there in the past to see what happened. But upon abductive reasoning, and the growing evidence and knowledge of chemistry, biochemistry, molecular biology, cell biology, evolutionary biology, genetics, epigenetics, and developmental biology, amount of knowledge about how life works, how it have might began and diversified,  is growing. That permits us more than ever before to make informed inferences. My take on abiogenesis is that we can make safe inferences based on what we DO  know.  Douglas Futuyma admits as much:

“Organisms either appeared on the earth fully developed or they did not. If they did not, they must have developed from preexisting species by some process of modification. If they did appear in a fully developed state, they must indeed have been created by some omnipotent intelligence” (Futuyma, 1983, p. 197).

In fact, Futuyma’s words underline a very important truth. He writes that when we look at life on Earth, if we see that life emerges all of a sudden, in its complete and perfect forms, then we have to admit that life was created, and is not a result of chance. As soon as naturalistic explanations are proven to be invalid, then creation is the only explanation left.

chemist Wilhelm Huck, professor at Radboud University Nijmegen: 
A working cell is more than the sum of its parts. "A functioning cell must be entirely correct at once, in all its complexity

Lynn Margulis: 
To go from a bacterium to people is less of a step than to go from a mixture of amino acids to a bacterium. 


History of Origin of Life research 2



How life started on Earth is not known. Although the processes that led to it remain elusive, most explanations suggest that the first forms of life were the evolutionary outcome of a complex mixture of organic compounds of abiotic origin; i.e., the discussion of the origin of life is necessarily a discussion of organic chemistry. Not surprisingly, some of our modern ideas on the origin of life have developed in tandem with discoveries in organic and biochemistry.

In 1805 the German naturalist Lorenz Oken wrote a small booklet titled The Creation, in which stated that “all organic beings originate from and consist of vesicles of cells.” Several decades later the jellylike, water-insoluble substance that was found inside all cells was termed “protoplasm” by the physician Johann E. Purkinje and the botanist Hugo von Mohl, who like others argued that it was the basic physicochemical component of life. 9



In 1828 Friedrich Wöhler demonstrated that heating ammonium cyanate would lead to urea, a result that represented the first synthesis of an organic compound from inorganic starting materials. 

A new era in chemical research had begun: in 1850 Adolph Strecker synthesized alanine in the laboratory from acetaldehyde, ammonia and hydrogen cyanide. This was followed by Butlerov’s demonstration that the treatment of formaldehyde with alkaline catalysts leads to the synthesis of sugars. Since until the 1920’s it was generally assumed that the first living beings had been autotrophs, the abiotic formation of these organic compounds were not considered a necessary prerequisite for the origin of life. These syntheses were also not conceived of as prebiotic laboratory simulations, but rather as attempts to understand the autotrophic mechanisms of nitrogen assimilation and CO2 fixation in green plants. 

Charles Darwin and the Origin of Life 20
What did Darwin think about the origin of life? His opinion seems to have changed over time from his original remark in the 1861 3rd edition of The Origin of Species «…it is no valid objection that science as yet throws no light on the far higher problem of the essence or origin of life», which he reiterated in a letter he mailed to his close friend Joseph Dalton Hooker on March 29, 1863, in which he wrote that
«…it is mere rubbish thinking, at present, of origin of life; one might as well think of the origin of matter». But yet, in a now famous paragraph in the letter sent to the same addressee on February 1st, 1871, he stated that «it is often said that all the conditions for the first production of a living being are now present, which could ever have been present. But if (and oh what a big if) we could conceive in some warm little pond with all sort of ammonia and phosphoric salts,—light, heat, electricity present, that a protein compound was chemically formed, ready to undergo still more complex changes, at the present such matter would be instantly devoured, or absorbed, which would not have been the case before living creatures were formed [...]».
~Charles Darwin, in a letter to Joseph Hooker (1871)

Although Darwin refrained from any further public statements on how life may have appeared, his views established the framework that would lead to a number of attempts to explain the origin of life by introducing principles of historical explanation.

The Appearance of Life and the Origin of Species: Two Separate Issues
«The chief defect of the Darwinian theory is that it throws no light on the origin of the primitive organism—probably a simple cell—from which all the others have descended. When Darwin assumes a special creative act for this first species, he is not consistent, and, I think, not quite sincere...» wrote Haeckel in 1862 in a footnote in his monograph on the radiolaria (Haeckel 1862). His criticism was accurate but surprising, given the boundless admiration that he had for Darwin. Haeckel was not alone in raising the issue. When the German geologist Heinrich George Bronn, translated The Origin of Species, in 1860, he did not hesitate to add a chapter of his own in which he discussed spontaneous generation in the context of Darwin’s theory. That very same year Bronn published an essay in which he argued quite emphatically that Darwin’s theory was incomplete until it could account for the origin of life, adding that some observations by Priestley, Pouchet and others could provide an example of spontaneous generation.



How did life originate? This has long been one of the most fascinating and challenging problems in all of human thought. It was a question that intrigued the ancient Greek and Roman philosophers and scientists. Among the common misconceptions of these people was the notion of spontaneous generation. Even as late as the early 1800s, people still thought that life magically arose from non-life.  Lamarck and most scientists before the 1860s believed in spontaneous generation. After all, maggots mysteriously appeared on rotting meat, and broth became spoiled when no one had seen another creature touch it. Finally, in 1861 Louis Pasteur conducted a famous series of experiments. He boiled some broth to sterilize it, then put the broth in a sealed flask, and it did not spoil after many months. He put sterilized broth in another flask with a long curved tubular neck opening, and it took a long time before anything grew upon it. Without easy access to microbes from the outside air, the broth remained unspoiled, so microbes were the source of the life you see in spoiled broth. He sealed meat in airtight containers, and no maggots appeared. Under modern earth conditions, life only comes from other life. 

In a famous lecture delivered at La Sorbonne in 1864, Pasteur not only denied the possibility that inanimate matter could organize itself into living systems, but also stated that “what a victory for materialism if it could be affirmed that it rests on the established fact that matter organizes itself, takes on life itself; matter which has in it already all known forces. Ah! If we could add to it this other force which is called life … what could be more natural than to deify such matter? Of what good would it be then to have recourse to the idea of a primordial creation? To what good the would be the idea of a Creator God?

Regardless of their political ramifications, Pasteur’s results made it difficult to advocate spontaneous generation as an explanation for the ultimate origin of life. As a result, a number of philosophers and naturalists promptly dismissed the study of the origins of life as senseless speculation, whereas the willful distortion of Pasteur’s results by others raised vitalistic expectations once again. Several devoted materialists like Emil du Bois-Reymond, Karl von Nageli, and August Weismann continued to support the idea of spontaneous generation, but others, like Hermann von Helmholtz, felt that they could side-step the issue by assuming that viable microbes—“cosmozoa”—had been delivered to the primitive Earth by meteorites, thus maintaining the significance of evolution.


In his monograph on the radiolaria, Haeckel wrote “The chief defect of the Darwinian theory is that it throws no light on the origin of the primitive organism—probably a simple cell—from which all the others have descended. When Darwin assumes a special creative act for this first species, he is not consistent, and, I think, not quite sincere …” (Haeckel 1862).

In 1871, Ernst Haeckel published in Nature Magazine an article on the origin of life, describing Biological cells as essentially and nothing more than a bit of structureless, simple " Protoplasm "- and their other vital properties can therefore simply and entirely brought about by the entirely by the peculiar and complex manner in which carbon under certain conditions can combine with the other elements further down, the author writes: Abiogenesis is, in fact, a necessary and integral part of the universal evolution theory.  7





The situation changed with the proposal of a heterotrophic origin of life made in 1924 by A.I.Oparin, a young Russian biochemist. Oparin was convinced that it was impossible to reconcile his Darwinian beliefs in a gradual evolution of complexity with the commonly held suggestion that life had emerged already endowed with an autotrophic metabolism. He reasoned that since heterotrophic anaerobes were metabolically simpler than autotrophs, the former would necessarily have evolved first. Based on the simplicity of fermentative metabolism, Oparin suggested that the first organisms must have been heterotrophic bacteria that could not make their own food but consumed organic material present in the primitive milieu. 

Like many of his fellow students and colleagues, Oparin was well acquainted with Haeckel’s work, in which the transition of the nonliving to the first organisms was discussed but always under the assumption that the first forms of life had been autotrophic microbes. Analysis of Oparin’s writings shows that throughout his entire life he remained faithful to the Haeckelian division of life into plants, animals and protists. However, from the very beginning it was impossible for him to reconcile his biochemical understanding of the sophistication of photosynthesis and the Darwinian credence in a gradual, slow evolution from the simple to the complex, with the suggestion that life had emerged already endowed with an autotrophic metabolism that included enzymes, chlorophyll and the ability to synthesize organic compounds from CO2 and water.

His 1924 book can be read as the work of a young, bold, and talented researcher with abundant enthusiasm and free of intellectual prejudices, who was able to look beyond the boundaries separating different scientific fields. In retrospect, it can be also considered the harbinger of his major work, a 1936 volume in Russian also called Origin of Life, whose English translation became available 2 years later (Oparin 1938).

The new volume was far more mature and profound in its philosophical and evolutionary analysis, as argued forcefully by Graham (1972), reflecting the changes in a society that was attempting to develop science, art and culture within the framework of dialectical materialism. In his second book Oparin (1938) not only abandoned his naïve and crude materialism but also provided a thorough presentation and extensive analysis of the literature on the abiotic synthesis of organic material. His original proposal was revised, leading to the assumption of a highly reducing primitive milieu in which iron carbides of geological origin would react with steam to form hydrocarbons. Their oxidation would yield alcohols, ketones, aldehydes, etc., that would then react with ammonia to form amines, amides and ammonium salts. The resulting proteinlike compounds and other molecules would form a dilute solution, where they would aggregate to form colloidal systems from which the first heterotrophic microbes evolved (Oparin 1938).



Five years later J. B. S. Haldane independently published a similar hypothesis 14, which explains why such views are often credited to both scientists. Oparin’s ideas were further elaborated in a more extensive book published in 1936 in Russian and two years later translated into English. In this new book, which is a major classic in evolutionary analysis, Oparin revised his original proposal, leading to the assumption of a highly reducing milieu in which iron carbides of geological origin would react with steam to form hydrocarbons. Their oxidation would yield alcohols, ketones, aldehydes, etc., that would then react with ammonia to form amines, amides, and ammonium salts. The resulting protein-like compounds would form a hot dilute soup, which would aggregate to form colloids or coacervates, from which the first heterotrophic microbes evolved. Oparin did not address in his 1938 book the origin of nucleic acids because at the time their role in genetic processes was not yet suspected.

For Oparin, highly reducing atmospheres corresponded to mixtures of CH4, NH3, and H2O with or without added H2. The atmosphere of Jupiter contains these chemical species, with H2 in large excess over CH4. Oparin’s proposal of a primordial reducing atmosphere was a brilliant inference from the then-fledgling knowledge of solar atomic abundances and planetary atmospheres. The benchmark contributions of Oparin’s 1938 book include the hypothesis that heterotrophs and anaerobic fermentation were primordial, which led him to refine the idea of the proposal of a reducing atmosphere that could allow the prebiotic synthesis and accumulation of organic compounds. These ideas played a major role in shaping the views of Harold Clayton Urey, an avid experimentalist with a wide range of scientific interests that was interested in the composition of the early atmosphere based on then popular ideas of solar system
formation. 

Questions and ideas about the nature of life dominated the field to such an extent that it was only after the 1950s, with new experimental techniques and information from different disciplines, that the question of the origins of life shifted from an area of speculation to an active area of experimental investigations.

Abiogenesis research  from 1950 to 2000




In 1952 Urey published The Planets, their Origin and Development, which delineated his ideas of the formation of the solar system, a formative framework into which most origin of life theories are now firmly fixed, albeit in slightly modified fashion. However, not everybody accepted these ideas. In 1951 Rubey proposed an outgassing model based on an early core differentiation and assumed the early atmosphere would have been reminiscent of modern volcanic gases. In his model Rubey estimated that a CH4 atmosphere could not have persisted for much more than 105 to 108 years due to photolysis. The Urey/Oparin atmospheric (CH4, NH3, H2O) models are thus based on astrophysical and cosmochemical models, while Rubey's CO2, N2, H2O model is based on extrapolation of the geological record. Although this early theoretical work has had a great influence on subsequent research, modern thinking on the origin and evolution of the chemical elements, the solar system, the Earth, and its atmosphere and oceans has not been shaped largely with the origin of life as a driving force. On the contrary, current origin of life theories have been modified to fit contemporary models in geo- and cosmochemistry.

The Miller Urey experiment 3
In the Urey - Miller experiment, none of the following amino-acids were produced, all life essential:
Cysteine Histidine Lysine Asparagine Pyrrolysine Proline Glutamine Arginine Threonine Selenocysteine Tryptophan Tyrosine

From Primordial Soup to the Prebiotic Beach
An interview from 1998 with exobiology pioneer, Dr. Stanley L. Miller, University of California San Diego 3
We've shown that either you have a reducing atmosphere or you are not going to have the organic compounds required for life. If you don't make them on Earth, you have to bring them in on comets, meteorites or dust. Certainly, some material did come from these sources. In my opinion, the amount from these sources would have been too small to effectively contribute to the origin of life.

The amount of useful compounds you are going to get from meteorites is very small. The dust and comets may provide a little more. Comets contain a lot of hydrogen cyanide, a compound central to prebiotic synthesis of amino acids as well as purines. Some HCN came into the atmosphere from comets. Whether it survived impact, and how much, are open to discussion. I'm skeptical that you are going to get more than a few percent of organic compounds from comets and dust.

There is a consensus that life would have had a hard time making it here from another solar system, because of the destructive effects of cosmic rays over long periods of time.

Submarine vents don't make organic compounds, they decompose them.

The original study raised many questions. What about the even balance of L and D (left and right oriented) amino acids seen in your experiment, unlike the preponderance of L seen in nature? How have you dealt with that question?
All of these pre-biotic experiments yield a racemic mixture, that is, equal amounts of D and L forms of the compounds. Indeed, if you're results are not racemic, you immediately suspect contamination. The question is how did one form get selected. In my opinion, the selection comes close to or slightly after the origin of life. There is no way in my opinion that you are going to sort out the D and L amino acids in separate pools. My opinion or working hypothesis is that the first replicated molecule had effectively no asymmetric carbon

 “Running equations through a computer does not constitute an experiment,” Miller sniffed. Miller acknowledged that scientists may never know precisely where and when life emerged.

Miller has faith that biologists will know the answer to the riddle of life’s origin when they see it. But his belief rests on the premise that the answer will be plausible, if only retrospectively. Who said the origin of life on earth was plausible?

The evidence of Urey-Miller experiment
1a. Amino Acid Synthesis (1953). When Stanley Miller produced a few amino acids from chemicals, amid a continuous small sparking apparatus, newspaper headlines proclaimed: “Life has been created!” But naturalists hide the truth: The experiment had disproved the possibility that random emergence of the building blocks could occur.
1b. The amino acids were not biologically active, and the experiment only proved that a synthetic production of them would result in equal amounts of left- and right-handed amino acids. Since only left-handed ones exist in animals, accidental production could never produce a living creature.
2. Till nowadays life could not be created in any laboratory. Therefore, by eliminative induction, we can conclude life must have been created by God.
3. God most probably, exists.





Stanley L. Miller, who had arrived to Chicago in the spring of 1951 after graduating from the University of California, Berkeley, attended Urey’s lecture, who like Oparin suggested that it would be interesting to simulate the proposed reducing conditions of the primitive Earth to test the feasibility of organic compound synthesis. “Urey’s point immediately seemed valid to me,” wrote Miller many years afterwards. “After this seminar, someone pointed out to Urey that in his book Oparin had discussed the origin of life and the possibility of synthesis of organic compounds in a reducing atmosphere. Urey’s discussion of the reducing atmosphere was more thorough and convincing than Oparin’s, but it is still surprising that no one had by then performed an experiment based on Oparin’s ideas” (Miller 1974). 13

Almost a year and a half after Urey’s lecture, Miller approached Urey about the possibility of doing a prebiotic synthesis experiment using a reducing gas mixture. After overcoming Urey’s initial resistance, he designed three apparatuses meant to simulate the ocean-atmosphere system on the primitive Earth by investigating the action of electric discharges acting for a week on a mixture of CH4, NH3, H2, and H2O; racemic mixtures of several protein amino acids were produced, as well as hydroxy acids, urea, and other organic molecules (Miller 1953, 1955; Johnson et al. 2008).

Miller achieved his results by means of an apparatus in which he could simulate the interaction between an atmosphere and an ocean. To activate the reaction, Miller used an electrical spark, which was considered to be a significant energy source on the early Earth in the form of lightning and coronal discharges. The apparatus was filled with various mixtures of methane, ammonia, and hydrogen as well as water, the latter being heated to boiling during the experiment. A spark discharge between the tungsten electrodes was produced by a high-frequency Tesla coil with a voltage of 60,000 V. The reaction time was usually a week or so and the maximum pressure 1.5 bars. With this relatively simple experimental setup, Miller (1953) was able to transform almost 50% of the original carbon (in the form of methane) into organic compounds. Although most of the synthesized organic material was an insoluble tarlike solid, he was able to isolate amino acids and other simple organic compounds from the reaction mixture. Glycine, the simplest amino acid, was produced in 2% yield (based on the original amount of methane carbon), whereas alanine, the simplest amino acid with a chiral center, showed a yield of 1%. Miller was able to show that the alanine was a racemic mixture (equal amounts of d- and l-alanine). This provided convincing evidence that the amino acids were produced in the experiment and were not biological contaminants somehow introduced into the apparatus.

The first major result in the field of biogenesis was a 1953 experiment by Stanley Miller and Harold Urey. In this experiment, the researchers tested an earlier hypothesis that conditions on the early earth may have favored the synthesis of organic compounds from inorganic compounds. They placed water plus some gases in a sealed flask, then passed electric sparks through the mixture to simulate the effects of sunlight and lightning. Over the next week or so, the mixture in the flask slowly turned a reddish-brown color. Upon analyzing the resulting "goo," they discovered that it contained several amino acids, which are the building blocks of proteins. The Miller-Urey experiment firmly established that basic biochemical building blocks such as amino acids can spontaneously form given the right conditions. Nonetheless, researchers have more recently pointed out that in current models of early earth's atmosphere and oceans, carbon dioxide and nitrogen would have reacted to form nitrites, which quickly destroy amino acids. Thus the Miller-Urey experiment might not be truly representative of what really happened on the early earth. Going beyond the synthesis of basic amino acids, one leading hypotheses is that ribonucleic acid (RNA) played a key role. For example, researchers recently found that certain RNA molecules can greatly increase the rate of specific chemical reactions, including, remarkably, the replication of parts of other RNA molecules. Thus perhaps a molecule like RNA could "self-catalyze" itself in this manner, perhaps with the assistance of some related molecules, and then larger conglomerates of such compounds, packaged within simple membranes (such as simple hydrophobic compounds), could have formed very primitive cells. 6

Nonetheless, even the "RNA world" hypothesis, as the above scenario is popularly known, faces challenges. As biochemist Robert Shapiro notes, "Unfortunately, neither chemists nor laboratories were present on the early Earth to produce RNA.". These difficulties have led scientists to hypothesize even simpler building blocks, such as self-catalyzing networks of biomolecular agents. Shapiro sketches five basic required characteristics of such a system: (a) a boundary is needed to separate life from non-life; (b) an energy source is needed to drive the organization process; (c) a coupling mechanism must link the release of energy to the organization process that produces and sustains life; (d) a chemical network must be formed, to permit adaptation and evolution; and (e) the network must grow and reproduce. Such hypothesized systems are now termed "metabolism first" schemes. Much remains to be done to establish the validity of this scenario.

4


An important survey of the origin-of-life (OOL) field has been published in Scientific American.  Robert Shapiro, a senior prize-winning chemist, cancer researcher, emeritus professor and author of books in the field, debunks the Miller experiment, the RNA World and other popular experiments as unrealistic dead ends.  Describing the wishful thinking of some researchers, he said, “In a form of molecular vitalism, some scientists have presumed that nature has an innate tendency to produce life’s building blocks preferentially, rather than the hordes of other molecules that can also be derived from the rules of organic chemistry.” 3

Shapiro had been explaining that millions of organic molecules can form that are not RNA nucleotides.  These are not only useless to life, they get in the way and clog up the beneficial reactions.  He went on to describe how extrapolation from the Miller Experiment produced an unearned sense of euphoria among researchers: “By extrapolation of these results, some writers have presumed that all of life’s building could be formed with ease in Miller-type experiments and were present in meteorites and other extraterrestrial bodies.  This is not the case,” he warned in a section entitled, “The Soup Kettle Is Empty.”  He said that no experiment has produced amino acids with more than three carbons (life uses some with six), and no Miller-type experiment has ever produced nucleotides or nucleosides, essential for DNA and RNA.

Shapiro described in some detail the difficult steps that organic chemists employ to synthesize the building blocks of RNA, using conditions highly unrealistic on the primitive earth.  “The point was the demonstration that humans could produce, however inefficiently, substances found in nature,” he said.  “Unfortunately, neither chemists nor laboratories were present on the early Earth to produce RNA.”  Here, for instance, is how scientists had to work to create cytosine, one of the DNA bases:

I will cite one example of prebiotic synthesis, published in 1995 by Nature and featured in the New York Times.  The RNA base cytosine was prepared in high yield by heating two purified chemicals in a sealed glass tube at 100 degrees Celsius for about a day.  One of the reagents, a sealed glass tube at 100 degrees Celsius for about a day.  One of the reagents, cyanoacetaldehyde, is a reactive substance capable of combining with a number of common chemicals that may have been present on the early Earth.  These competitors were excluded.  An extremely high concentration was needed to coax the other participant, urea, to react at a sufficient rate for the reaction to succeed.  The product, cytosine, can self-destruct by simple reaction with water.  When the urea concentration was lowered, or the reaction allowed to continue too long, any cytosine that was produced was subsequently destroyed.  This destructive reaction had been discovered in my laboratory, as part of my continuing research on environmental damage to DNA.  Our own cells deal with it by maintaining a suite of enzymes that specialize in DNA repair.

There seems to be a stark difference between the Real World and the imaginary RNA World.  Despite this disconnect, Shapiro describes some of the hype the RNA World scenario generated when Gilbert first suggested it in 1986.  “The hypothesis that life began with RNA was presented as a likely reality, rather than a speculation, in journals, textbooks, and the media,” he said.  He also described the intellectual hoops researchers have envisioned to get the scenario to work: freezing oceans, drying lagoons, dry deserts and other unlikely environments in specific sequences to keep the molecules from destroying themselves.  This amounts to attributing wish-fulfilment and goal-directed behaviour to inanimate objects, as Shapiro makes clear with this colourful analogy:

The analogy that comes to mind is that of a golfer, who has played a golf ball through an 18-hole course, then assumed that the ball could also play itself around the course in his absence.  He had demonstrated the possibility of the event; it was only necessary to presume that some combination of natural forces (earthquakes, winds, tornadoes, and floods, for example) could produce the same result, given enough time.  No physical law need be broken for spontaneous RNA formation to happen, but the chances against it are so immense, that the suggestion implies that the non-living world had an innate desire to generate RNA.  The majority of origin-of-life scientists who still support the RNA-first theory either accept this concept (implicitly, if not explicitly) or feel that the immensely unfavourable odds were simply overcome by good luck.

Realistically, unfavourable molecules are just as likely to form.  These would act like terminators for any hopeful molecules, he says.  Shapiro uses another analogy.  He pictures a gorilla pounding on a huge keyboard containing not only the English alphabet but every letter of every language and all the symbol sets in a typical computer.  “The chances for the spontaneous assembly of a replicator in the pool I described above can be compared to those of the gorilla composing, in English, a coherent recipe for the preparation of chili con carne.”  That’s why Gerald Joyce, Mr. RNA-World himself, and Leslie Orgel, a veteran OOL researcher with Stanley Miller, concluded that the spontaneous appearance of chains of RNA on the early earth “would have been a near miracle.”

Boy and all this bad news is only halfway through the article.  Does he have any good news?  Not yet; we must first agree with a ground-rule stated by Nobel laureate Christian de Duve, who called for “a rejection of improbabilities so incommensurably high that they can only be called miracles, phenomena that fall outside the scope of scientific inquiry.”  That rules out starting with complex molecules like DNA, RNA, and proteins.

From that principle, Shapiro advocated a return to scenarios with environmental cycles involving simple molecules.  These thermodynamic or “metabolism first” scenarios are only popular among about a third of OOL researchers at this time.  Notable subscribers include Harold Morowitz, Gunter Wachtershauser, Christian de Duve, Freeman Dyson and Shapiro himself.  Their hypotheses, too, have certain requirements that must be met: an energy source, boundaries, ways to couple the energy to the organization, and a chemical network or cycle able to grow and reproduce.  (The problems of genetics and heredity are shuffled into the future in these theories.)  How are they doing?  “Over the years, many theoretical papers have advanced particular metabolism first schemes, but relatively little experimental work has been presented in support of them,” Shapiro admits.  “In those cases where experiments have been published, they have usually served to demonstrate the plausibility of individual steps in a proposed cycle.”  In addition, “An understanding of the initial steps leading to life would not reveal the specific events that led to the familiar DNA-RNA-protein-based organisms of today.”  Nor would plausible prebiotic cycles prove that’s what happened on the early earth.  Success in the metabolism-first experiments would only contribute to hope that prebiotic cycles are plausible in principle, not that they actually happened. Nevertheless, Shapiro himself needed to return to the miracles he earlier rejected.  “Some chance event or circumstance may have led to the connection of nucleotides to form RNA,” he speculates.  Where did the nucleotides come from?  Didn’t he say their formation was impossibly unlikely?  How did they escape rapid destruction by water?  Those concerns aside, maybe nucleotides initially served some other purpose and got co-opted, by chance, in the developing network of life.  Showing that such thoughts represent little more than a pipe dream, though, he admits: “Many further steps in evolution would be needed to ‘invent’ the elaborate mechanisms for replication and specific protein synthesis that we observe in life today.”





Time for Shapiro’s grand finale.  For an article predominantly discouraging and critical, his final paragraph is surprisingly upbeat.  Recounting that the highly-implausible big-molecule scenarios imply a lonely universe, he offers hope with the small-molecule alternative.  Quoting Stuart Kauffman, “If this is all true, life is vastly more probable than we have supposed.  Not only are we at home in the universe, but we are far more likely to share it with unknown companions.” Letters to the editor appeared in Science the next day, debating the two leading theories of OOL.  The signers included most of the big names: Stanley Miller, Jeffrey Bada, Robert Hazen and others debating Gunter Wachtershauser and Claudia Huber.  After sifting through the technical jargon, the reader is left with the strong impression that both camps have essentially falsified each other.  On the primordial soup side, the signers picked apart details in a paper by the metabolism-first side.  Concentrations of reagents and conditions specified were called “implausible” and “exceedingly improbable.”

Wachtershauser and Huber countered that the “prebiotic soup theory” requires a “protracted, mechanistically obscure self-organization in a cold, primitive ocean,” which they claim is more improbable than the volcanic environment of their own “pioneer organism” theory (metabolism-first).  It’s foolish to expect prebiotic soup products to survive in the ocean, of all places, “wherein after some thousand or million years, and under all manner of diverse influences, the magic of self-organization is believed to have somehow generated an unspecified first form of life.”  That’s some nasty jabbing between the two leading camps.

The Miller Experiment, the RNA World, and all the hype of countless papers, articles, popular press pieces and TV animations are impossible myths. You know you cannot stay with small molecules forever.  You have not begun to bridge the canyon between metabolic cycles with small molecules to implausible genetic networks with large molecules (RNA, DNA and proteins).  Any way you try to close the gap, you are going to run into the very same criticisms you raised against the RNA-World storytellers.  You cannot invoke natural selection without accurate replication.

Funny how these people presume that if they can just get molecules to pull themselves up by their bootstraps to the replicator stage, Charlie and Tinker Bell will take over from there.  Before you can say 4 Gya, biochemists emerge! Shapiro is very valuable for exposing the vast difference between the hype over origin of life and its implausibilities – nay, impossibilities – in the chemistry of the real world.  His alternative is weak and fraught with the very same difficulties.  If a golf ball is not going to finish holes 14-18 on its own without help, it is also not going to finish holes 1-5.  If a gorilla is not going to type a recipe in English for chili con carne from thousands of keys on a keyboard, it is not going to type a recipe for hot soup either, even using only 1% of the keys.  Furthermore, neither the gorilla nor the golf ball are going to want to proceed further with the evolutionist project.  We cannot attribute an “innate desire” to a gorilla, a golf ball, or a sterile planet of chemicals to produce coded languages and molecular machines. Sooner or later, all the machinery, the replicators, the genetic codes and complex entropy-lowering processes are going to have to show up in the accounting.  Once Shapiro realizes that his alternative is just as guilty as the ones he criticizes, we may have an ardent new advocate of intelligent design in the ranks.  Join the winning side, Dr. Shapiro, before sliding with the losers and liars into the dustbin of intellectual history. 

Formation of nucleobases in a Miller–Urey reducing atmosphere  5
The Miller–Urey experiments pioneered modern research on the molecular origins of life, but their actual relevance in this field was later questioned because the gas mixture used in their research is considered too reducing with respect to the most accepted hypotheses for the conditions on primordial Earth. In particular, the production of only amino acids has been taken as evidence of the limited relevance of the results. Here, we report an experimental work, combined with state-of-the-art computational methods, in which both electric discharge and laser-driven plasma impact simulations were carried out in a reducing atmosphere containing NH3 + CO. We show that RNA nucleobases are synthesized in these experiments, strongly supporting the possibility of the emergence of biologically relevant molecules in a reducing atmosphere. The reconstructed synthetic pathways indicate that small radicals and formamide play a crucial role, in agreement with a number of recent experimental and theoretical results.

Note that they have transformed the phrase "laser-driven plasma impact simulations" into "we show that RNA nucleobases are synthesized in these experiments ..." look at that - Virtual simulations through a computer program and databases.   Can they tell us the if the amino acids got homochiral and biologically active?

1.  PAUL DAVIES, 1999, The Fifth Miracle
http://www.nytimes.com/books/first/d/davies-miracle.html
2. From the paper: The Origin of Biomolecules, page 3
3.  OOL on the Rocks    02/15/2007
https://web.archive.org/web/20080518054852/http://www.accessexcellence.org/WN/NM/miller.php
4. LIFE The Science of Biology TENTH EDITION, page 70
5.  Martin Ferus, April 10, 2017, Formation of nucleobases in a Miller–Urey reducing atmosphere
http://www.pnas.org/content/early/2017/04/04/1700010114.abstract
6. David H. Bailey, 15 May 2018, Do scientists understand the origin of life?
http://www.sciencemeetsreligion.org/evolution/origin.php
7. Ernst Haeckel, 2 march 1871, The mechanical theory of life and spontaneous generation
https://www.nature.com/articles/003354b0.pdf
8. In Search of Cell History , The Evolution of Life’s Building Blocks,  page 86
9. Antonio Lazcano, 2010 Nov; 2, Historical Development of Origins Research    
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2964185/
10. Origins of Life: The Primal Self-Organization,    page 87
11. https://en.wikipedia.org/wiki/Life
12.  December 12, 2013, Scientists discover double meaning in genetic code
http://www.washington.edu/news/2013/12/12/scientists-discover-double-meaning-in-genetic-code/
13. Juli Peretó, 2009 Jul 25, Charles Darwin and the Origin of Life
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2745620/
14. Haldane, the origin of life
https://www.uv.es/~orilife/textos/Haldane.pdf?fbclid=IwAR2YpXSTg4pQh4GiEaEE5K8ZCj1W7rCCDf58Zb-SAg0Hvw5d9VxC_2I_XVU

Crack the Genetic Code and Cipher

British biologist Francis Crick and his American colleague James Watson laid the groundwork for modern molecular genetics when they determined the structure of DNA in 1953. While demonstrating how the strands of the double helix were put together, Watson and Crick also sought to learn how genetic information was coded into the DNA. Crick’s “central dogma” of molecular biology—“DNA makes RNA makes protein”—signified the importance of the processes of transcription (the creation of messenger RNA) and translation (the production of proteins). Once this became the canonical basis of the genetic transfer of information, the next item on the scientific agenda was the genetic code itself—the instructions that regulated the dogma’s implementation, the true “secret of life”.
The first scientist after Watson and Crick to find a measure of success with the coding problem was Russian émigré physicist George Gamow. He envisioned the relationship between DNA structure and protein synthesis as a numerical cryptanalytic problem. Gamow surmised that the goal for scientists was to learn how a long sequence of 4 nucleotides determines the assignment of long protein sequences composed of 20 amino acids. Gamow published a short piece in the October 1953 issue of Nature that proposed a solution called the “diamond code”, an overlapping triplet code based on a combinatorial scheme in which 4 nucleotides arranged 3-at-a-time would specify 20 amino acids. Somewhat like a language, this highly restrictive code was primarily hypothetical, based on then-current knowledge of the behavior of nucleic acids and proteins. 4

Gamow’s coding scheme generated a great deal of enthusiasm among other scientists. To foster communication and camaraderie, Gamow founded the RNA Tie Club, a group of 20 hand-picked scientists—corresponding to the 20 amino acids—who would circulate notes and manuscripts on the coding problem and (not inconsequentially) consume wine, beer, and whiskey at periodic meetings. Each member of the club was given the moniker of an amino acid, and all were presented with a diagrammed tie and tiepin made to Gamow’s specification. Although geographically dispersed, the Tie Club brought physical scientists and biologists together to work on one of the most challenging and important problems in modern science.

By mid-1954, Gamow had accepted that his diamond code was not accurate, yet he and others continued to deliberate over the various codes presented by disparate researchers. In truth, the notion of a “code” as the key to information transfer was not articulated publicly until late 1954, when Gamow, Martynas Ycas, and Alexander Rich published an article that defined the code idiom for the first time since Watson and Crick casually mentioned it in a 1953 article. Yet the concept of coding applied to genetic specificity was somewhat misleading, as translation between the 4 nucleic acid bases and the 20 amino acids would obey the rules of a cipher instead of a code. As Crick acknowledged years later, in linguistic analysis, ciphers generally operate on units of regular length (as in the triplet DNA scheme), whereas codes operate on units of variable length (e.g., words, phrases). But the code metaphor worked well, even though it was literally inaccurate, and in Crick’s words, “‘Genetic code’ sounds a lot more intriguing than ‘genetic cipher’.” Codes and the information transfer metaphor were extraordinarily powerful, and heredity was often described as a biological form of electronic communication.

By 1955, research suggested that a nonoverlapping code was more plausible than Gamow’s original notion of overlapping triplets. By 1961, Crick and his colleagues (including Sydney Brenner) concluded that the nucleotides of each triplet did not belong to any other triplet. They also postulated that sets of triplets are arranged in continuous linear sequence starting at a fixed point in a polynucleotide chain without breaks, an aspect of the code that was termed “commaless”. The notion of a “degenerate code” was also introduced, which meant that more than one triplet can code for a particular amino acid (a possibility inherent in the fact that there were 64 possible triplets out of 4 base pairs and only 20 amino acids to be coded for). These discoveries in the decade before 1961 brought scientists closer to a clear vision of what the genetic code might look like, but it was experimental biochemical investigation in the 1960s that finally led biologists to the solution of the code.
In 1957, a 30-year-old biochemist named Marshall Nirenberg began work at the National Institutes of Health (NIH) in Bethesda, MD. Nirenberg was one among a veritable litter of young talent at the NIH, where biochemistry occupied a privileged place. The young scientist was fascinated with the role of genetic control and notions of “information flow” in biochemical reactions and cellular functions. Yet in a scientific culture that encouraged team science, Nirenberg tended to work alone. Years later, in a New York Times profile, he was described as a “genius because he does one thing superlatively well, but he has trouble driving cars, and he has been known to trip over his feet . . . works 12 hours a day 7 days a week and has no outside hobbies.” Although Nirenberg contested this description, he did recognize that working alone stymied his attempts to engage the major problems of contemporary biology. Still, although he was aware of the competition among leading laboratories to solve problems like protein synthesis, he worked in relative isolation for a few years, studying the cell-free synthesis of the enzyme penicillinase in the Bacillus cereus bacteria.

In 1960, Gordon Tomkins offered Nirenberg a position as a research biochemist in NIH’s Section of Metabolic Enzymes. There, he ceased study of the B. cereus system and focused his research on a cell-free E. coli system. By the summer of 1960, Nirenberg concluded that cell-free protein synthesis was dependent on the DNA template that specified the RNA messenger. Other researchers, including Nobel laureate Severo Ochoa, had arrived at similar conclusions and were determined to solve protein synthesis and crack the genetic code, but Nirenberg had never been as focused as he was at that moment. Auspiciously, he was joined at NIH in the autumn of that year by German plant physiologist Heinrich Matthaei, a postdoctoral fellow who planned to work with Nirenberg on protein synthesizing systems. Matthaei’s arrival signaled, in Nirenberg’s words, a “new phase” in the research.

By December 1960, Nirenberg and Matthaei worked intently on the E. coli system, attempting to incorporate amino acids in the DNAase-supplemented system and to establish definitively that the system was dependent on an RNA template. The two scientists demonstrated that endogenous messenger RNA did stimulate protein synthesis, but they needed a better, less-contaminated RNA preparation. They ultimately decided that the RNA of the tobacco mosaic virus (TMV) would be a viable template. This conclusion converged with the efforts of Heinz Frankel-Conrat at the Berkeley Virus Laboratory, which was leading the race to decipher the code. In the spring of 1961, Nirenberg traveled to Berkeley, visiting Frankel-Conrat’s laboratory to gain facility with TMV. Meanwhile, Matthaei began the experiments on May 15, testing poly-A (polyadenylic acid), poly-U (poly-uridylic acid), poly-(2A)U, and poly-(4A)U for amino acid incorporation. Each synthetic polynucleotide was tested in the presence of 19 unlabeled (cold) and 1 labeled (hot) amino acids. On the morning of May 27, the results of experiment 27Q indicated that poly-U specified the assembly of hot polyphenyalanine. It was the first break in the genetic code.

Matthaei phoned the poly-U results to Nirenberg at Berkeley, but Nirenberg did not release the results publicly. Neither man was a member of biochemistry’s “inner circle”, and thus, Nirenberg wanted to continue experimenting before announcing the momentous discovery. Returning to NIH, he and Matthaei continued their polynucleotide work. It was not until October that they released the information in two papers, although Nirenberg presented his findings at the International Congress of Biochemistry in August. The announcement was a major defeat for Crick and other major players in the field, who had been trying to break the code for years. Some begrudged the obscure young scientists their success, and others claimed that it was a lucky strike. Gamow, in particular, resented not being cited for his work in their 1961 paper. (Nirenberg claimed to have never heard of it.) Nevertheless, Nirenberg and Matthaei accomplished one of the premier feats in the history of science, doing what Nobel laureates and other leading figures had been unable to do.

Biochemical research after this grand achievement was directed primarily toward the completion of the code and took approximately six years. In 1964, Nirenberg and Philip Leder discovered a technique for making coding assignments using trinucleotides, and in the following year, Har Gobind Khorana perfected a precise technique for synthesizing long RNA chains of completely defined sequences. After these achievements, the entire code was elucidated within a year. All 20 amino acids were accounted for, and Crick devised a standard form in which to present the genetic code, a table that has the same importance for biology that the periodic table has for chemistry.

Watson and Crick had won their Nobel Prize in 1962 for discovering the structure of DNA. Nirenberg (along with Gobind Khorana and Robert Holley) matched them in 1968, when he was also awarded the Nobel Prize in Physiology or Medicine. Thus, an incredible achievement for an “outsider” was acknowledged at the end of two decades of amazing research in the nascent field of molecular biology. The discovery of the genetic code, or more accurately the “genetic cipher”, would inaugurate an era of astonishing genetic research that continues today.

During the 1950s and 1960s, the functioning of an organism was increasingly modeled on the computer, and computers were applied not only to genetics but also to other branches of the life sciences, such as X-ray crystallography, physiology, neurology and evolutionary biology. What was novel in DNA sequencing was not the conceptualization of genetic information, but the way in which biologists – especially molecular biologists – began using this concept and applying computational technologies to it. In 1953, after the elucidation of the double helix, James Watson and Francis Crick published a sequel paper in which they considered it ‘likely that the precise sequence of bases [in DNA] is the code which carries the genetical information’. In 1957, Crick postulated the central dogma of molecular biology, according to which the nucleotide sequence of DNA determined the amino acid sequence of proteins through a one-directional transfer of information. Despite both papers defining DNA as a sequence, the further research agenda that Watson and Crick promoted for molecular biology was largely inspired by the notions of code and one-directional transfer of information. These notions constituted a conceptual framework which, during the late 1950s and 1960s, shaped investigations into the processes of cell division, gene regulation and protein synthesis. DNA was not considered information because of its sequential nature, but because its genetic code could determine other entities – direct the synthesis of proteins or its own replication in an identical DNA molecule. In this context, the transfer of genetic information mimicked the functioning of the most widely known computers of the time, central mainframe apparatuses which, having conducted a series of logical operations, were able to transform input data introduced by the user into a defined output. 5

The RNA World hypothesis
A possible solution to the problem posed by the lack of understanding of the relationship between nucleic acids and proteins was suggested by Carl Woese (1967), Leslie Orgel (1968), and Francis Crick (1968), who independently proposed the idea that the first living entities were based on RNA as both the genetic material and as catalyst. Surprisingly, these pioneering proposals of an RNA world received little attention. The relationship between evolutionary issues and molecular biology was slow to develop, and during several decades was embittered by frequent clashes during which evolutionary analysis was frequently dismissed as little more than useless speculation.


How the discovery of ribozymes cast RNA in the roles of both chicken and egg in origin-of-life theories 3

A 1971 paper by the Nobel-winning physical chemist Manfred Eigen begins with the following snapshot of the status of origins of-life research at the time:

The question about the origin of life often appears as a question about ‘‘cause and effect’’ [...] As a consequence of the exciting discoveries of ‘‘molecular biology’’ a common version of the above question is: Which came first, the protein or the nucleic acid?—a modern variant of the old ‘‘chicken-and-the-egg’’ problem. The term ‘‘first’’ is usually meant to define a causal rather than a temporal relationship, and the words ‘‘protein’’ and ‘‘nucleic acid’’ may be substituted by ‘‘function’’ and ‘‘information’’. The question in this form, when applied to the interplay of nucleic acids and proteins as presently encountered in the living cell, leads ad absurdum, because ‘‘function’’ cannot occur in an organized manner unless ‘‘information’’ is present and this ‘‘information’’ only acquires its meaning via the ‘‘function’’ for which it is coding.

On one side were those that emphasized the importance of the cell’s nucleus to life, and hence the functions of information and replication. On the opposite camp were those who gave primacy to the cytoplasm, and consequently, catalytic and metabolic activities.  This dichotomy made its first formal appearance in the scientific community at a session on the origins of life at the 1912 British Association for the Advancement of Science meeting at Dundee where E.A. Minchin, a zoologist from Oxford University, opened the discussion with an argument favoring the nucleocentric view:

By most biologists the cytoplasm has been considered to represent the true living substance. [.. .] There are, however, many reasons for believing that the chromatin-substance, invariably present in the nucleus, or occurring as grains, chromidia, scattered in the cytoplasm, represents the primary and essential living matter. [.. .] I regard the chromatin as the primitive living substance, and hold the view that the earliest forms of life were very minute particles of chromatin, round which in the course of evolution achromatinic substances were formed. Within the, cytoplasmic envelopes thus produced the chromatin-grains increased in number. Organisms of the degree of structural
complexity of a true cell arose finally by concentration of the chromatin-grains (chromidiae) into a compact organized mass, the nucleus proper (Minchin, 1912, pp.510–511).

Although his argument is articulated in terms of cellular components—chromatin (and hence nucleus) and cytoplasm—Minchin was clearly according to primacy to chromatin because of its perceived functions since virtually nothing was known about the material of chromatin at the time. His main reasons for adhering to a nucleocentric view of life included first, the observation that chromatin was an essential component of all known living beings, none of which had been known to survive without it, and second, the relationship between the material of chromatin and life-processes such as fertilization and heredity (Minchin, 1912, p. 510). Minchin‘s views were challenged by H. E. Armstrong, then president of the chemistry section (B) of the Royal Society, during the discussion session immediately following the address:

I can not think of a naked mass of protoplasm, call it chromatin (stainable substance) or what you will, playing the part of an organism; At most I imagine it would function as yeast zymase functions. If it is to grow and be reproduced, the nuclear material must be shut up along with the appropriate food materials and such constructive appliances as are required to bring about the association of the various elements entering into the structure of the organism. (Armstrong, 1913, pp. 539–540).

The impasse would remained firmly in place, until the unexpected discovery of the RNA catalysis.


Scientists discover double meaning in genetic code 
In 2013, Scientists  discovered a second code hiding within DNA. This second code contains information that changes how scientists read the instructions contained in DNA and interpret mutations to make sense of health and disease. 

“For over 40 years we have assumed that DNA changes affecting the genetic code solely impact how proteins are made,” said Stamatoyannopoulos. “Now we know that this basic assumption about reading the human genome missed half of the picture. These new findings highlight that DNA is an incredibly powerful information storage device, which nature has fully exploited in unexpected ways.” 2

The genetic code uses a 64-letter alphabet called codons. The UW team discovered that some codons, which they called duons, can have two meanings, one related to protein sequence, and one related to gene control. 

Clearly, making two sequences that satisfy two sets of functional constraints simultaneously is more difficult than constructing a single sequence that must satisfy only one set of such constraints. Thus, the probability of generating such a meaningful message within another meaningful message is vastly smaller than the odds of getting a single message to arise by chance on its own. For this reason, the discovery of dual and overlapping messages in genetic texts—messages essential to function—only complicates the information problem for scenarios that rely on chance and/or natural selection. Indeed, a trial-and-error process seems unlikely to produce nested coding of information, since the probability of error increases with each trial when two or more sets of functional constraints have to be satisfied. And many functional outcomes in the cell depend upon satisfying multiple sets of constraints. 

Further, since self-organizational affinities fail to explain the sequential arrangements of DNA base sequences generally, they do nothing to account for even more sophisticated forms of sequencing (i.e., those involving dual messaging) in the genome. Instead, this form of encryption seems to point decisively to design, because the use of such encryption techniques are, based upon our experience, the sole province of intelligent agents. We know of no other such cause of this effect. The evidence of sophisticated encryption techniques within the genome thus constitutes another distinctive diagnostic—or signature—of intelligence in the cell.

From Primordial Soup to the Prebiotic Beach
An interview with exobiology pioneer, Dr. Stanley L. Miller, University of California San Diego

1n 1953, a University of Chicago graduate student named Stanley Miller working in Harold Urey's lab flipped a switch sending electric current through a chamber containing a combination of methane, ammonia, hydrogen and water. The experiment yielded organic compounds including amino acids, the building blocks of life, and catapulted a field of study known as exobiology into the headlines. Since that time a new understanding of the workings of RNA and DNA, have increased the scope of the subject. Moreover, the discovery of prebiotic conditions on other planets and the announcement of a bacterial fossil originating on Mars has brought new attention to the study of life's origins. I spoke with Dr. Miller in his lab at UCSD about the field he has helped to make famous, exobiology.

Let start with the basics. Can you give a simple definition of exobiology?
The term exobiology was coined by Nobel Prize-winning scientist Joshua Lederberg. What it means is the study of life beyond the Earth. But since there's no known life beyond the Earth people say its a subject with no subject matter. It refers to the search for life elsewhere, Mars, the satellites of Jupiter and in other solar systems. It is also used to describe studies of the origin of life on Earth, that is, the study of pre-biotic Earth and what chemical reactions might have taken place as the setting for life's origin.

Some 4.6 billion years ago the planet was a lifeless rock, a billion years later it was teeming with early forms of life. Where is the dividing line between pre-biotic and biotic Earth and how is this determined?
We start with several factors. One, the Earth is fairly reliably dated to 4.55 billion years. The earliest evidence for life was 3.5 billion years based on findings at the Apex formation in Western Australia. A new discovery reported in the journal Nature indicates evidence for life some 300 million years before that. We presume there was life earlier, but there is no evidence beyond that point.
We really don't know what the Earth was like three or four billion years ago. So there are all sorts of theories and speculations. The major uncertainty concerns what the atmosphere was like. This is major area of dispute. In early 1950's, Harold Urey suggested that the Earth had a reducing atmosphere, since all of the outer planets in our solar system- Jupiter, Saturn, Uranus and Neptune- have this kind of atmosphere. A reducing atmosphere contains methane, ammonia, hydrogen and water. The Earth is clearly special in this respect, in that it contains an oxygen atmosphere which is clearly of biological origin.
Although there is a dispute over the composition of the primitive atmosphere, we've shown that either you have a reducing atmosphere or you are not going to have the organic compounds required for life. If you don't make them on Earth, you have to bring them in on comets, meteorites or dust. Certainly some material did come from these sources. In my opinion the amount from these sources would have been too small to effectively contribute to the origin of life.

So while these are potential sources of organic compounds they are not essential for the creation of life on Earth?
As long as you have those basic chemicals and a reducing atmosphere, you have everything you need. People often say maybe some of the special compounds came in from space, but they never say which ones. If you can make these chemicals in the conditions of cosmic dust or a meteorite, I presume you could also make them on the Earth. I think the idea that you need some special unnamed compound from space is hard to support.
You have to consider separately the contributions of meteors, dust and comets. The amount of useful compounds you are going to get from meteorites is very small. The dust and comets may provide a little more. Comets contain a lot of hydrogen cyanide, a compound central to prebiotic synthesis of amino acids as well as purines. Some HCN came into the atmosphere from comets. Whether it survived impact, and how much, are open to discussion. I'm skeptical that you are going to get more than a few percent of organic compounds from comets and dust. It ultimately doesn't make much difference where it comes from. I happen to think prebiotic synthesis happened on the Earth, but I admit I could be wrong.
There is another part of the story. In 1969 a carbonaceous meteorite fell in Murchison Australia. It turned out the meteorite had high concentrations of amino acids, about 100 ppm, and they were the same kind of amino acids you get in prebiotic experiments like mine. This discovery made it plausible that similar processes could have happened on primitive Earth, on an asteroid, or for that matter, anywhere else the proper conditions exist.


Doesn't the Panspermia theory looks at the question of ultimate origins of life in a slightly different way?
That's a different controversy. There are different versions of the theory. One idea is that there was no origin of life, that life, like the universe, has always existed and got to the Earth through space. That idea doesn't seem very reasonable since we know that the universe has not always existed, so life has to happen some time after the big bang 10 or 20 billion years ago.
It may be that life came to Earth from another planet. That may or may not be true, but still doesn't answer the question of where life started. You only transfer the problem to the other solar system. Proponents say conditions may have been more favorable on the other planet, but if so, they should tell us what those conditions were.
Along these lines, there is a consensus that life would have had a hard time making it here from another solar system, because of the destructive effects of cosmic rays over long periods of time.

What about submarine vents as a source of prebiotic compounds?
I have a very simple response to that . Submarine vents don't make organic compounds, they decompose them. Indeed, these vents are one of the limiting factors on what organic compounds you are going to have in the primitive oceans. At the present time, the entire ocean goes through those vents in 10 million years. So all of the organic compounds get zapped every ten million years. That places a constraint on how much organic material you can get. Furthermore, it gives you a time scale for the origin of life. If all the polymers and other goodies that you make get destroyed, it means life has to start early and rapidly. If you look at the process in detail, it seems that long periods of time are detrimental, rather than helpful.

Can you review with us some of the history and basic background of your original prebiotic experiments?
In the 1820's a German chemist named Woeller announced the synthesis of urea from ammonium cyanate, creating a compound that occurs in biology. That experiment is so famous because it is considered the first example where inorganic compounds reacted to make a biological compound. They used to make a distinction between organic, meaning of biological origin, and inorganic- CO₂, CO and graphite. We now know that there is no such distinction.
However, it remained a mystery how you could make organic compounds under geological conditions and have them organized into a living organism. There were all sorts of theories and speculation. It was once thought that if you took organic material, rags, rotting meat, etc, and let it sit, that maggots, rats etc. would arise spontaneously. It's not as crazy as it seems, considering DNA hadn't been discovered. It was then reasonable to hold those views if you consider living organisms as protoplasm, a life substance. This all changed in 1860 when Pasteur showed that you don't get living organisms except from other living organisms. This disproved the idea of spontaneous generation.
But spontaneous generation means two things. One is the idea that life can emerge from a pile of rags. The other is that life was generated once, hundreds of millions of years ago. Pasteur never proved it didn't happen once, he only showed that it doesn't happen all the time.
A number of people tried prebiotic experiments. But they used CO₂F, nitrogen and water. When you use those chemicals, nothing happens. It's only when you use a reducing atmosphere that things start to happen.

Who came up with the idea of the reducing atmosphere?
Oparin, a Russian scientist, began the modern idea of the origin of life when he published a pamphlet in 1924. His idea was called the heterotrophic hypothesis: that the first organisms were heterotrophic, meaning they got their organic material from the environment, rather than having to make it, like blue-green algae. This was an important idea. Oparin also suggested that the less biosynthesis there is, the easier it is to form a living organism. Then he proposed the idea of the reducing atmosphere where you might make organic compounds.
He also proposed that the first organisms were coacervates, a special type of colloid. Nobody takes that last part very seriously anymore, but in 1936, this was reasonable since DNA was not known to be the genetic material..
In 1951, unaware of Oparin's work, Harold Urey came to the same conclusion about the reducing atmosphere. He knew enough chemistry and biology to figure that you might get the building blocks of life under these conditions.

Tell us about the famous electrical discharge experiment.
The experiments were done in Urey's lab when I was a graduate student. Urey gave a lecture in October of 1951 when I first arrived in Chicago and suggested that someone do these experiments. So I went to him and said, "I'd like to do those experiments". The first thing he tried to do was talk me out of it. Then he realized I was determined. He said the problem was that it was really a very risky experiment and probably wouldn't work, and he was responsible that I get a degree in three years or so. So we agreed to give it six months or a year. If it worked out fine, if not, on to something else. As it turned out I got some results in a matter of weeks. 

In the early 1950s Stanley L. Miller, working in the laboratory of Harold C. Urey at the University of Chicago, did the first experiment designed to clarify the chemical reactions that occurred on the primitive earth. In the flask at the bottom, he created an "ocean" of water, which he heated, forcing water vapor to circulate through the apparatus. The flask at the top contained an "atmosphere" consisting of methane (CH₄), ammonia (NH₃), hydrogen (H₂) and the circulating water vapor.[/center]
Next he exposed the gases to a continuous electrical discharge ("lightning"), causing the gases to interact. Water-soluble products of those reactions then passed through a condenser and dissolved in the mock ocean. The experiment yielded many amino acids and enabled Miller to explain how they had formed. For instance, glycine appeared after reactions in the atmosphere produced simple compounds - formaldehyde and hydrogen cyanide. Years after this experiment, a meteorite that struck near Murchison, Australia, was shown to contain a number of the same amino acids that Miller identified and in roughly the same relative amounts. Such coincidences lent credence to the idea that Miller's protocol approximated the chemistry of the prebiotic earth. More recent findings have cast some doubt on that conclusion.

You must have been excited to get such dramatic results so quickly, and with what, at the time, must have seemed like an outlandish hypothesis?
Oh yes. Most people thought I was a least a little bit crazy. But if you look at methane/ammonia vs CO₂/nitrogen there was no doubt in my mind. It was very clear that if you want to make organic compounds it would be easier with methane. It's easy to say that but it is quite a bit more difficult to get organized and do the experiment.
The surprise of the experiment was the very large yield of amino acids. We would have been happy if we got traces of amino acids, but we got around 4 percent. Incidentally, this is probably the biggest yield of any similar prebiotic experiment conducted since then. The reason for that has to do with the fact that amino acids are made from even simpler organic compounds such as hydrogen cyanide and aldehydes.
That was the start. It all held together and the chemistry turned out to be not that outlandish after all.

What was the original reaction to your work in the science community?
There was certainly surprise. One of the reviewers simply didn't believe it and delayed the review process of the paper prior to publication. He later apologized to me. It was sufficiently unusual, that even with Urey's backing it was difficult to get it published. If I'd submitted it to "Science" on my own, it would still be on the bottom of the pile. But the work is so easy to reproduce that it wasn't long before the experiment was validated.
Another scientist was sure that there was some bacterial contamination of the discharge apparatus. When you see the organic compounds dripping off the electrodes, there is really little room for doubt. But we filled the tank with gas, sealed it, put it in an autoclave for 18 hours at 15 psi. Usually you would use 15 minutes. Of course the results were the same.
Nobody questioned the chemistry of the original experiment, although many have questioned what the conditions were on pre-biotic Earth. The chemistry was very solid.

How much of a role did serendipity play in the original setup?
Fortunately, Urey was so adamant at the time about methane that I didn't explore alternate gas mixtures. Now we know that any old reducing gases will do. CO₂/hydrogen and nitrogen will do the trick, although not as well.
There was some serendipity in how we handled the water. If we hadn't boiled it and run it for a week, we wouldn't have gotten such good yields of amino acids. We knew right away that something happened rather quickly because you could see a color change after a couple of days.
The fact that the experiment is so simple that a high school student can almost reproduce it is not a negative at all. That fact that it works and is so simple is what is so great about it. If you have to use very special conditions with a very complicated apparatus there is a question of whether it can be a geological process.

The original study raised many questions. What about the even balance of L and D (left and right oriented) amino acids seen in your experiment, unlike the preponderance of L seen in nature? How have you dealt with that question?
All of these pre-biotic experiments yield a racemic mixture, that is, equal amounts of D and L forms of the compounds. Indeed, if you're results are not racemic, you immediately suspect contamination. The question is how did one form get selected. In my opinion, the selection comes close to or slightly after the origin of life. There is no way in my opinion that you are going to sort out the D and L amino acids in separate pools. My opinion or working hypothesis is that the first replicated molecule had effectively no asymmetric carbon

You are talking about some kind of pre-RNA?
Exactly a kind of pre-RNA. RNA has four asymmetric carbons in it. This pre-RNA must have somehow developed into RNA. There is a considerable amount of research now to try and figure out what that pre-RNA compound was, that is, what was the precursor to the RNA ribose-phosphate.

Peter E. Nielsen of the University of Copenhagen has proposed a polymer called peptide nucleic acid (PNA) as a precursor of RNA. Is this is where PNA comes in?
Exactly, PNA looks prebiotic. Currently that is the best alternative to ribose phosphate. Whether it was the original material or not is another issue.

Can you clarify one thing? Have all of the amino acids been synthesized in pre-biotic experiments, along with all the necessary components for making life?
Just turning on the spark in a basic pre-biotic experiment will yield 11 out of 20 amino acids. If you count asparagine and glutamine you get thirteen basic amino acids. We don't know how many amino acids there were to start with. Asparagine and glutamine, for example, do not look prebiotic because they hydrolyze. The purines and pyrimidines can alos be made, as can all of the sugars, although they are unstable.

Your original work was published only a month apart from Watson and Crick's description of the DNA molecule. How has the field of molecular biology influenced the field of exobiology?
The thing that has probably changed the outlook the most is the discovery of ribozymes, the catalytic RNA. This means you can have an organism with RNA carrying out both the genetic functions and catalytic functions. That gets around the problem of protein synthesis, which is this incredibly complicated thing. There is a problem with RNA as a prebiotic molecule because the ribose is unstable. This leads us to the pre-RNA world.
The idea of the pre-RNA world is essentially the same as the RNA world, except you have a different molecule that replicates. Another thing worth remembering is that all these pre-biotic experiments produce amino acids. To have these amino acids around and not use them in the first living organism would be odd. So the role of amino acids in the origin of life is unknown but still likely.

Tell us about your recent work and the lagoon idea.
The primitive Earth had big oceans, but it also had lakes, lagoons and beaches. Our hypothesis is that the conditions may have been ideal on these beaches or drying lagoons for prebiotic reactions to occur, for the simple reason that the chemicals were more concentrated in these sites than in the middle of the ocean.

Is this because of the temperatures and also the presence of minerals as well?
Temperature is an important factor. Minerals have been thought by some to play a role in the origin of life, but they really haven't done much for us so far. People talk about how minerals might have helped catalyze reactions, but there are few examples where the mineral makes any difference.
Our most recent research tackled the problem of making pyrimidines- uracil and cytosine, in prebiotic conditions. For some reason it just doesn't work very well under dilute conditions. We showed that it works like a charm once you get things concentrated and dry it out a bit. This changed my outlook on where to start looking for prebiotic reactions.
Another example is our work with co-enzyme A. The business end of co-enzyme A is called pantetheine. We showed you could make this under these kind of pre-biotic "dry beach" conditions. We found that you didn't need it to be very hot, you can make it at 40 degrees C. This indicates the ease with which some of this chemistry can take place.

Temperature seems to be a talking point regarding prebiotic hypotheses.
We know we can't have a very high temperature, because the organic materials would simply decompose. For example, ribose degrades in 73 minutes at high temperatures, so it doesn't seem likely. Then people talk about temperature gradients in the submarine vent. I don't know what these gradients are supposed to do. My thinking is that a temperature between 0 and 10 degrees C would be feasible. The minute you get above 25 degrees C there are problems of stability.

How does the discovery of the Martian meteorite factor in to the discussion? Are you convinced these are the fossilized remains of extraterrestrial microorganisms?
I think the data is interesting and suggestive, but not yet conclusive. Let's accept that the meteorite does come from Mars. You have apparently got very small bacterial fossils also iron sulfide and magnetite sitting next to each other. Then there are these PAHs (polycyclic aromatic hydrocarbons). All of this is suggestive but not compelling.
There are just two possibilities. Either there was life on Mars or there was not. I have no problem with the idea of life on Mars, the question remains whether this evidence is adequate. If it is correct, it has an implication for one of the big questions of prebiotic research. That is, is it easy or difficult to produce life from prebiotic compounds in prebiotic conditions? It seems that it would be difficult on Mars. If it turns out to be the case on Mars, where the conditions do not look very favorable, then it should apply to anywhere in the universe, or any planet with a suitable atmosphere and temperature.

Can you tell us about the field of exobiology today in context of the world of scientific research?
It is a very small field. There is a society, the International Society for the Study of the Origin of Life. It has only 300 members, a rather small society. My own lab is part of program called NSCORT (NASA Specialized Center of Research and Training). This program is conducted in close cooperation with NASA and supports five researchers along with graduate students, post-docs and undergraduate students.
The more important research are the experiments these days, rather than the trading of ideas. Good ideas are those that when reduced to an experiment end up working. Our approach is to do experiments and demonstrate things, not just talk about possibilities.

What advice do you have for students interested in pursuing studies in exobiology?
Well we are talking about solving chemical problems. Therefore a background in basic chemistry is essential along with knowledge in the fields of organic chemistry, biochemistry and some background in geology and physics. Exobiology is a small field with a lot of interaction. It is one of few fields where an undergraduate would be able to work with top people in the field almost immediately.
This interview was conducted in October, 1996 6



Stanley L. Miller at the Botanical Garden of the University of Valencia, during the first Pelegrí Casanova Conference of Biodiversity and Evolutionary Biology (2003), in front of an exact copy of the glass apparatus he designed in 1953.

JOHN HORGAN  THE END SCIENCE, 1996, page 141

One of the most diligent and respected origin-of-life researchers is Stanley Miller. He was a 23-year-old graduate student in 1953 when he sought to recreate the origin of life in a laboratory. He filled a sealed glass apparatus with a few liters of methane, ammonia, and hydrogen (representing the atmosphere) and some water (the ocean). A spark-discharge device zapped the gases with simulated lightning, while a heating coil kept the waters bubbling. Within a few days, the water and gases were stained with a reddish goo. On analyzing the substance, Miller found to his delight that it was rich in amino acids. These organic compounds are the building blocks of proteins, the basic stuff of life. Miller’s results seemed to provide stunning evidence that life could arise from what the British chemist J. B. S. Haldane had called the “primordial soup.” 

Pundits speculated that scientists, like Mary Shelley’s Dr. Frankenstein, would shortly conjure up living organisms in their laboratories and thereby demonstrate in detail how genesis unfolded. It hasn’t worked out that way. In fact, almost 40 years after his original experiment, Miller told me that solving the riddle of the origin of life had turned out to be more diffcult than he or anyone else had envisioned. He recalled one prediction, made shortly after his experiment, that within 25 years scientists would “surely” know how life began. “Well, 25 years have come and gone,” Miller said drily. After his 1953 experiment, Miller dedicated himself to the search for the secret of life. He developed a reputation as both a rigorous experimentalist and a bit of a curmudgeon, someone who is quick to criticize what he feels is shoddy work. When I met Miller in his office at the University of California at San Diego, where he is a professor of biochemistry, he fretted that his field still had a reputation as a fringe discipline, not worthy of serious pursuit. “Some work is better than others. The stuff that is awful does tend to drag it down. I tend to get very upset about that. People do good work, and then you see this garbage attract attention.” Miller seemed unimpressed with any of the current proposals on the origin of life, referring to them as “nonsense” or “paper chemistry.” He was so contemptuous of some hypotheses that, when I asked his opinion of them, he merely shook his head, sighed deeply, and snickered— as if overcome by the folly of humanity. 

Stuart Kauffman’s theory of autocatalysis fell into this category. “Running equations through a computer does not constitute an experiment,” Miller sniffed. Miller acknowledged that scientists may never know precisely where and when life emerged. “We’re trying to discuss a historical event, which is very different from the usual kind of science, and so criteria and methods are very different,” he remarked. But when I suggested that Miller sounded pessimistic about the prospects for discovering life’s secret, he looked appalled. Pessimistic? Certainly not! He was optimistic! One day, he vowed, scientists would discover the self-replicating molecule that had triggered the great saga of evolution. Just as the discovery of the microwave afterglow of the big bang legitimized cosmology, so would the discovery of the first genetic material legitimize Miller’ field. “It would take off like a rocket,” Miller muttered through clenched teeth. Would such a discovery be immediately self-apparent? Miller nodded. “It will be in the nature of something that will make you say, ‘Jesus, there it is. How could you have overlooked this for so long?’ And everybody will be totally convinced.” 

When Miller performed his landmark experiment in 1953, most scientists still shared Darwin’s belief that proteins were the likeliest candidates for self-reproducing molecules, since proteins were thought to be capable of reproducing and organizing themselves. After the discovery that DNA is the basis for genetic transmission and for protein synthesis, many researchers began to favor nucleic acids over proteins as the ur-molecules. But there was a major hitch in this scenario. DNA can make neither proteins nor copies of itself without the help of catalytic proteins called enzymes. This fact turned the origin of life into a classic chicken-or-egg problem: which came rst, proteins or DNA? In The Coming of the Golden Age, Gunther Stent, prescient as always, suggested that this conundrum could be solved if researchers found a self-replicating molecule that could act as its own catalyst. In the early 1980s, researchers identfied just such a molecule: ribonucleic acid, or RNA, a single-strand molecule that serves as DNA’s helpmate in manufacturing proteins. Experiments revealed that certain types of RNA could act as their own enzymes, snipping themselves in two and splicing themselves back together again. If RNA could act as an enzyme then it might also be able to replicate itself without help from proteins.

RNA could serve as both gene and catalyst, egg and chicken. But the so-called RNA-world hypothesis suffers from several problems. RNA and its components are difficult to synthesize under the best of circumstances, in a laboratory, let alone under plausible prebiotic conditions. Once RNA is synthesized, it can make new copies of itself only with a great deal of chemical coaxing from the scientist. The origin of life “has to happen under easy conditions, not ones that are very special,” Miller said. He is convinced that some simpler—and possibly quite dissimilar—molecule must have paved the way for RNA.

Lynn Margulis, for one, doubts whether investigations of the origin of life will yield the kind of simple, self-validating answer of which Miller dreams. “I think that may be true of the cause of cancer but not of the origin of life,” Margulis said. Life, she pointed out, emerged under complex environmental conditions. “You have day and night, winter and summer, changes in temperature, changes in dryness. These things are historical accumulations. Biochemical systems are effectively historical accumulations. So I don’t think there is ever going to be a packaged recipe for life: add water and mix and get life. It’s not a single-step process. It’s a cumulative process that involves a lot of changes.” The smallest bacterium, she noted, “is so much more like people than Stanley Miller’s mixtures of chemicals, because it already has these system properties. 

So to go from a bacterium to people is less of a step than to go from a mixture of amino acids to that bacterium.”

Francis Crick wrote in his book Life Itself that “the origin of life appears to be almost a miracle, so many are the conditions which would have to be satised to get it going.” (Crick, it should be noted, is an agnostic leaning toward atheism.) Crick proposed that aliens visiting the earth in a spacecraft billions of years ago may have deliberately seeded it with microbes.

Perhaps Stanley Miller’s hope will be fulfilled: scientists will find some clever chemical or combination of chemicals that can reproduce, mutate, and evolve under plausible prebiotic conditions. The discovery would be sure to launch a new era of applied chemistry. (The vast majority of researchers focus on this goal, rather than on the elucidation of life’s origin.) But given our lack of knowledge about the conditions under which life began, any theory of life’s origin based on such a finding would always be subject to doubts. Miller has faith that biologists will know the answer to the riddle of life’s origin when they see it. But his belief rests on the premise that the answer will be plausible, if only retrospectively. Who said the origin of life on earth was plausible?

Life might have emerged from a freakish convergence of improbable and even unimaginable events. Moreover, the discovery of a plausible ur-molecule, when or if it happens, is unlikely to tell us what we really want to know: Was life on earth inevitable or a freak occurrence? Has it happened elsewhere or only in this lonely, lonely spot? These questions can only be resolved if we discover life beyond the earth. Society seems increasingly reluctant to underwrite such investigations. In 1993, Congress shut down NASA’s SETI (Search for Extraterrestrial Intelligence) program, which scanned the heavens for radio signals generated by other civilizations. The dream of a manned mission to Mars, the most likely site for extraterrestrial life in the solar system, has been indefinitely deferred.


The original apparatus of the Miller-Urey experiment, now on display in the Denver Museum of Nature and Science. The sealed set of tubes was evacuated so that no earth atmosphere remained, and a new atmosphere of nitrogen, water, carbon dioxide, methane, and ammonia (but no oxygen) was inserted. The flask in the lower left contained the “ocean,” which was continuously heated and boiled. As the steam rose, it passed through the large flask in the upper right, where sparks simulated the energy of lightning. Then the steam passed through the condenser below it, which condensed the steam and returned the liquid water to the starting point. After a week, the clear water of the flask turned brown, and a sample showed that four amino acids had been produced


1.  Leslie Orgel's Scientific American article "The Origin of Life on Earth" (Scientific American, October, 1994)
https://web.archive.org/web/20150419083839/http://www.accessexcellence.org/WN/NM/miller.php
2.Stephanie Seiler , December 12, 2013 Scientists discover double meaning in genetic code
 http://www.washington.edu/news/2013/12/12/scientists-discover-double-meaning-in-genetic-code/
3. Neeraja Sankaran, 10 June 2012, How the discovery of ribozymes cast RNA in the roles of both chicken and egg in origin-of-life theories
https://www.academia.edu/1845973/How_the_discovery_of_ribozymes_cast_RNA_in_the_roles_of_both_chicken_and_egg_in_origin-of-life_theories?auto=download[/b]
4. RICHARD A. PIZZI, Genetic ciphering
http://pubs.acs.org/subscribe/archive/mdd/v04/i03/html/03timeline.html
5. Biology,  Computing, and the History of Molecular Sequencing From Proteins to DNA, 1945–2000, page 21
6.  Dr. Stanley L. Miller: From Primordial Soup to the Prebiotic Beach An interview with exobiology pioneer, https://web.archive.org/web/20080518054852/https://www.accessexcellence.org/WN/NM/miller.php

Current scientific models and attempts to explain the Origin of Life

There are various models and scenarios that could explain the origin of life. Primordial soup, prebiotic chemistry, non-equilibrium dissipative systems chemistry, protobiology, molecular evolution, pre-RNA World, RNA World, Lipid World, Protein World, Metabolism First World, Clay World, Ribosome World, Virus World, Gaia hypothesis, Protocell thermodynamics, Wet-Dry cycles, Hydroghermal Vents, Asteroid impacts, synthetic biology  and so forth. The list goes on and on.  Each model represents a unique vision. Origin of life research has to provide explanations to abiotic synthesis of life’s building blocks (amino acids, peptides, ribose, nucleobases, fatty acids, nucleotides, and oligonucleotides), and their polymerizations to bio-macromolecules (peptides and oligonucleotides), and emergence of biological functions of replication and compartmentalization. where did life on Earth originate? To date, various environments have been proposed as plausible sites for life’s origin, including oceans, lakes, lagoons, tidal pools, submarine hydrothermal systems, etc. But no single setting can offer enough chemical and physical diversity of life to originate. 40 A coexisting atmosphere, water, and landmass with continuous material circulation between the three of them that is driven by the Sun. This setting is one of the minimum requirements for the emergence of life.

Life is generally characterized by the following three functions:
(1) compartmentalization: the ability to keep its components together and distinguish itself from the environment,
(2) replication: the ability to process and transmit heritable information to progeny, and
(3) metabolism: the ability to capture energy and material resources, staying away from thermodynamic equilibrium

All these functions are operated by biopolymers such as DNA, RNA, protein, and phospholipids. Phospholipids are made of two fatty acids esterified to a glycerol phosphate molecule. DNA and RNA are made of nucleosides (composed of (deoxy)ribose and nucleobases) bound by phosphodiester linkages, while proteins are made of amino acids linked together by peptide bonds. It is typically assumed that these vital components were synthesized abiotically, accumulated somewhere, condensed into polymers, interacted mutually, and eventually evolved into a self-sustaining system through natural phenomena on the primitive Earth.

The “Prebiotic soup” theory 40
Over time, philosophers and scientists have proposed many different theories for the origin of life. 
The best-known theory is the “Prebiotic soup” theory hypothesized by Oparin in 1924. In this theory, organic compounds were created in a reductive atmosphere from the action of sunlight and lightning. The compounds were then dissolved in the primitive ocean, concentrated, and underwent polymerization until they formed “coacervate” droplets. The droplets grew by fusion with other droplets, were split into daughter droplets by the action of tidal waves, and developed the ability to catalyze their own replication through natural selection, which eventually led to the emergence of life. Later on, the relevance of coacervates to the origin of life was questioned because coacervates have no permeability barrier, so they lack the capacity for nutrient uptake and waste release that are essential functions for encapsulated metabolism

Hydrothermal origin of life
The discovery of thermophilic organisms in association with deep-sea hydrothermal systems in the late 1970s led to a new idea that life might have originated in hydrothermal systems on the primitive Earth. The perceived benefits afforded to early life in this environment include protection from intense asteroid bombardment and UV radiation, and a source of thermal and chemical energy, along with potentially catalytic minerals. Evidence that supports this scenario has been provided by various research fields. For instance, geologists have detected evidence for microbial methanogenesis from fluid inclusions in hydrothermal precipitates. Using molecular biological approaches, biologists have demonstrated that the thermophilic microbial inhabitants of the active seafloor populate the deepest branches of the universal phylogenetic tree. Chemists have claimed that, on both theoretical and experimental bases, the physical and chemical conditions that are characteristic of the deep-sea hydrothermal systems are favorable for abiotic synthesis of biochemically significant organic molecules. More recently, a new type of vent system, the Lost City hydrothermal field, was discovered in 2000 more than 15 km from the spreading axis of the Mid-Atlantic Ridge. Unlike vent systems that are located directly on the spreading zone, the water circulating these off-axis vents makes no contact with magma, and emerges at a temperature of around 70e90
C. Its fluid composition is derived from exothermic reactions between seawater and uplifted mantle peridotite, rather than from interactions between seawater and cooling basalts. The peridotite-seawater reactions associated with the oxidation of iron produce alkaline fluids (pH 9e11) that are rich in H2 and CH4 and other low-molecular-mass hydrocarbons


Extraterrestrial origin of life
Another proposal of organic compounds on the primitive Earth is delivery by extraterrestrial objects (meteorites, comets, and interplanetary dust particles (IDPs)).  Carbonaceous chondrites contain a wide variety of organic compounds including amino acids, purines, pyrimidines, sugar-like compounds, and long-chain monocarboxylic acids with amphiphilic properties. These compounds could have been used as a component of primitive life.

Current origin of life proposals

Regularly science journals and papers come up with new OOL ( origin of life ) scenarios.

1. The Oparin-Haldane Hypothesis
In the early decades of the 20th century, Aleksandr Oparin (in 1924), and John Haldane (in 1929, before Oparin's first book was translated into English), independently suggested that if the primitive atmosphere was reducing (as opposed to oxygen-rich), and if there was an appropriate supply of energy, such as lightning or ultraviolet light, then a wide range of organic compounds might be synthesised.
Oparin suggested that the organic compounds could have undergone a series of reactions leading to more and more complex molecules. He proposed that the molecules formed colloid aggregates, or 'coacervates', in an aqueous environment. The coacervates were able to absorb and assimilate organic compounds from the environment in a way reminiscent of metabolism. They would have taken part in evolutionary processes, eventually leading to the first lifeforms.
Haldane's ideas about the origin of life were very similar to Oparin's. Haldane proposed that the primordial sea served as a vast chemical laboratory powered by solar energy. The atmosphere was oxygen free, and the combination of carbon dioxide, ammonia and ultraviolet radiation gave rise to a host of organic compounds. The sea became a 'hot dilute soup' containing large populations of organic monomers and polymers. Haldane envisaged that groups of monomers and polymers aquired lipid membranes, and that further developments eventually led to the first living cells.
Haldane coined the term 'prebiotic soup', and this became a powerful symbol of the Oparin-Haldane view of the origin of life.

2. Origin of Life: The Heterotroph Hypothesis
The anaerobic metabolic processes of the heterotrophs released carbon dioxide into the atmosphere, which allowed for the evolution of photosynthetic autotrophs, which could use light and CO2 to produce their own food. The autotrophs released oxygen into the atmosphere. For most of the original anaerobic heterotrophs, oxygen proved poisonous. The few heterotrophs that survived the change in environment generally evolved the capacity to carry out aerobic respiration. Over the subsequent billions of years, the aerobic autotrophs and heterotrophs became the dominant life-forms on the planet and evolved into all of the diversity of life now visible on Earth.

3. Origin of Life - The Sweet Crystal Hypothesis
When Cairns-Smith formulated his theory of crystalline ancestry - which accounts for the main mechanism by which life can form from inorganic precursors - he was percieved as not having provided a very detailed scenario for the introduction of organic material. Rather he showed how life can form, demonstrated that genetic takeovers were possible, illustrated that there would be selection pressure for carbon-based systems once they arose, and then suggested that the rest of the story was simply a matter for natural selection.
This state of affairs apparently left some of those who had not read Genetic Takeover unsatisfied. They felt as though the origin of their sort of life had not really been explained at all. They did not see where nucleic acid came from - and the origin of cell walls was still a mystery.
While some of the details have no-doubt been lost to history, it seems that some of the subsequent paths in the early evolution of organisms can be identified with a reasonable level of confidence. Even where this is not the case, it may prove helpful to identify in some detail at least one plausible scenario by which evolution can lead away from crystalline organisms, towards ones more easily recognisable as our ancestors.

4. Submarine hot springs and the origin of life
The discovery of hydrothermal vents at oceanic ridge crests and the appreciation of their importance in the element balance of the oceans is one of the main recent advances in marine geochemistry1. It is likely that vents were present in the oceans of the primitive Earth because the process of hydrothermal circulation probably began early in the Earth's history2.

5. Pyrite formation, the first energy source for life: a hypothesis
March 30, 1988
I here propose a new energy source for an autotrophic origin of life. It is the exergonic formation of pyrite from hydrogen sulfide and ferrous ions

6. Bubbles May Have Speeded Life's Origins on Earth
July 6, 1993
The role of bubbles in the creation of life on earth is one of the newest approaches to solving the scientific mystery that is probably second in importance only to the problem of how the universe itself began.
No one is suggesting that bubbles might explain everything. But in a new hypothesis receiving close attention, the multitudes of bubbles forming on the surface of the primordial seas must have collected chemicals and concentrated them for synthesis into complex molecules. Eventually, through multistage reactions constantly repeated by uncounted generations of bubbles, the molecules grew in size and ambition, ready for the transition to living, reproducing cells.

7. Thermoreduction, a hypothesis for the origin of prokaryotes
May 1995
All thermophiles discovered so far are prokaryotes (Bacteria or Archaea). Furthermore, reconstructions of rRNA phylogenies suggest that the progenitor of all prokaryotes was a thermophile. These data are usually interpreted as supporting the hypothesis that all present day organisms, including eukaryotes, originated from hyperthermophiles. However, this scenario is difficult to reconcile with the RNA world theory, considering the instability of RNA at very high temperatures, and it is also contradicted by the finding of sophisticated devices for thermophilic adaptation in present day hyperthermophiles.  

8. Organic Aerosols and the Origin of Life: An Hypothesis
February 2004
Recent experimental work has verified the prediction that marine aerosols could have an exterior film of amphiphiles; palmitic, stearic and oleic acids were predominant. Thermodynamic analysis has revealed that such aerosols are energetically capable of asymmetric division. In a prebiotic terrestrial environment, one of the products of such aerosol fission would have been bacterially sized (microns), the other would have been virally sized (tens of nanometers). Plausible avenues for chemical differentiation between the two particles are discussed, and the probabilities for the transition from geochemistry to biochemistry updated in light of recent palaeo fossil studies.

9. Hypothesis: the origin of life in a hydrogel environment
22 September 2004
A hypothesis is proposed that the first cell(s) on the Earth assembled in a hydrogel environment. Gel environments are capable of retaining water, oily hydrocarbons, solutes, and gas bubbles, and are capable of carrying out many functions, even in the absence of a membrane. Thus, the gel-like environment may have conferred distinct advantages for the assembly of the first cell(s).

10. The Origin Of Life Dual Origin Hypothesis
25 April 2005
According to the dual origin hypothesis, the cerebral cortex of higher mammals evolved from two primordial brain structures, the amygdala and hippocampal formation. This developmental process defines the orderly principles of cortical connectivity and gives rise to functionally distinct ventral and dorsal systems within the cerebrum. This paper reviews the basic features of the dual origin theory. This model is then applied to understanding symptom production in a number of psychiatric illnesses, with particular reference to recent structural and functional imaging studies. In this paper I propose that psychiatric symptoms can be conceptualized as arising from abnormal processing within dorsal (time-space-motility) or ventral (meaning-motivation) systems, or from a disturbance in the functional interaction/balance between them. Within this framework, one can identify symptom-specific correlations that cross-traditional diagnostic boundaries, as well as potential mechanisms that may explain biologically valid diagnostic entities. Integrating evolutionary, connectional and functional bases across multiple species, the dual origin hypothesis offers a powerful neural systems model to help organize our understanding of psychiatric illness, therein suggesting novel approaches to diagnosis, prevention and treatment.
https://www.ncbi.nlm.nih.gov/pubmed/16356547

11. The origins of life -- the 'protein interaction world' hypothesis: protein interactions were the first form of self-reproducing life and nucleic acids evolved later as memory molecules
26 December 2005
The 'protein interaction world' (PIW) hypothesis of the origins of life assumes that life emerged as a self-reproducing and expanding system of protein interactions. In mainstream molecular biology, 'replication' refers to the material copying of molecules such as nucleic acids. However, PIW is conceptualized as an abstract communication system constituted by the interactions between proteins, in which 'replication' happens at the level of self-reproduction of these interactions between proteins.

12. The Emergence of Cells During the Origin of Life
08 Dec 2006:
simple physicochemical properties of elementary protocells can give rise to essential cellular behaviors, including primitive forms of Darwinian competition and energy storage. Such preexisting, cooperative interactions between the membrane and encapsulated contents could greatly simplify the transition from replicating molecules to true cells. They also suggest intriguing possibilities for further investigation. For example, a corollary of vesicle competition is that a charged genetic polymer, such as nucleic acid, would be much more effective at driving membrane uptake than an electrically neutral polymer, because most of the osmotic pressure is due to counterions associated with the charged polymer. Could this influence the natural selection of the genetic material itself? Furthermore, competition for membrane molecules would favor stabilized membranes, suggesting a selective advantage for the evolution of cross-linked fatty acids (e.g., di- and triglycerides) and even the phospholipids of today. Greater membrane stability leads to decreased dynamics, however, and the evolutionary solutions to this problem (e.g., permeases, synthetic enzymes) could cause a “snowball” effect on the complexity of early life (16). Exploration of these minimal systems promises to lead to more exciting insights into the origins of biological complexity.

13.  Primordial Soup's On: Scientists Repeat Evolution's Most Famous Experiment
March 28, 2007
many scientists have had doubts that the environment assumed in the Miller-Urey experiment was truly representative of the early earth's environment, since nitrites, for instance, would likely have neutralized any resulting biochemical compounds. In 2007, biochemist Jeffrey Bada, noting that significant amounts of iron and carbonate minerals were likely present in the early atmosphere, conjectured that these compounds may have neutralized the deleterious effects of the nitrites. To test this hypothesis, Jeffrey Bada performed a new Miller-Urey-type experiment by adding iron and carbonate minerals. As in the original experiment, Bada found numerous amino acids in the resulting mixture. Thus the basic findings of the Miller-Urey experiment might still have validity in spite of the nitrite problem

14. Chemist Shows How RNA Can Be the Starting Point for Life
MAY 13, 2009
In May 2009, a team led by John Sutherland, a chemist at the University of Manchester in England, solved a problem that has perplexed researchers for at least 20 years (see above), namely how the basic nucleotides (building blocks) of RNA could spontaneously assemble. As recently as a few years ago, the appearance of these nucleotides on the primitive earth was thought to be a "near miracle." In the 2009 study, Sutherland and his team used the same starting chemicals that have been employed in numerous earlier experiments, but they tried many different orders and combinations. They finally discovered one order and combination that formed the RNA nucleotide ribocytidine phosphate. What's more, when the mixture was exposed to ultraviolet light, a second nucleotide of RNA was formed. Two other nucleotides remain, but the synthesis of the first two was thought to be more difficult

15. The Zinc world hypothesis
24 August 2009
The suggested "Zn world" scenario identifies the geological conditions under which photosynthesizing ZnS edifices of hydrothermal origin could emerge and persist on primordial Earth, includes a mechanism of the transient storage and utilization of solar light for the production of diverse organic compounds, and identifies the driving forces and selective factors that could have promoted the transition from the first simple, photostable polymers to more complex living organisms.

16. Origin of life: Adding UV light helps form 'Missing G' of RNA building blocks
June 15, 2010
A team of researchers at the Georgia Institute of Technology and the University of Roma La Sapienza succeeded in synthesizing guanine, one of the four bases of RNA. The other three, adenine, cytosine and uracil, have previously been synthesized. The researchers were able to form guanine by subjecting a solution of formamide (H2NCOH), a simple compound that often has been suggested as a starting material for biotic compounds, to ultraviolet radiation during heating. Thomas Orlando, one of the researchers, explained, "Our model prebiotic reaction is attractive because most aspects of the process were likely to occur on the early Earth and it reduces chemical constraints."

17. Thermodynamic origin of life
9 September 2010
Understanding the thermodynamic function of life may shed light on its origin. Life, as are all irreversible processes, is contingent on entropy production. Entropy production is a measure of the rate of the tendency of Nature to explore available microstates. The most important irreversible process generating entropy in the biosphere, and thus facilitating this exploration, is the absorption and transformation of sunlight into heat. Here we hypothesize that life began, and persists today, as a catalyst for the absorption and dissipation of sunlight at the surface of shallow seas. The resulting heat is then efficiently harvested by other irreversible processes such as the water cycle, hurricanes, and ocean and wind currents. RNA and DNA are the most efficient of all known molecules for absorbing the intense ultraviolet light that could have penetrated the dense early atmosphere, and are remarkably rapid in transforming this light into heat in the presence of liquid water. From this perspective, the origin and evolution of life, inseparable from water and the water cycle, can be understood as resulting from the natural thermodynamic imperative of increasing the entropy production of the Earth in its interaction with its solar environment. A mechanism is proposed for the reproduction of RNA and DNA without the need for enzymes, promoted instead through UV light dissipation and the ambient conditions of prebiotic Earth.

18. Asteroids make life’s raw materials
4 May 2011
researchers in Italy found that if they mixed formamide, a simple chemical present in space, with material from a meteorite, and then heated the mixture, that they produced nucleic acids (building blocks of DNA and RNA), the amino acid glycine, and a precursor to sugar. The team also found that the meteorite mineral stabilized RNA, which is otherwise broken down with water

19. Thermodynamic dissipation theory for the origin of life
11 March 2011
Understanding the thermodynamic function of life may shed light on its origin. Life, as are all irreversible processes, is contingent on entropy production. Entropy production is a measure of the rate of the tendency of Nature
to explore available microstates. The most important irreversible process generating entropy in the biosphere and, thus, facilitating this exploration, is the absorption and transformation of sunlight into heat. Here we hypothesize that life began, and persists today, as a catalyst for the absorption and dissipation of sunlight on the surface of Archean seas. The resulting heat could then be efficiently harvested by other irreversible processes such as the water cycle, hurricanes, and ocean and wind currents. RNA and DNA are the most efficient of all known molecules for absorbing the intense ultraviolet light that penetrated the dense early atmosphere and are remarkably rapid in transforming this light into heat in the presence of liquid water. From this perspective, the origin and evolution of life, inseparable from water and the water cycle, can be understood as resulting from the natural thermodynamic imperative of increasing the entropy production of the Earth in its interaction with its solar environment. A mechanism is proposed for the reproduction of RNA and DNA without the need for enzymes, promoted instead through UV light dissipation and diurnal temperature cycling of the Archean sea-surface.

20.  First glimpse at the viral birth of DNA
18 April 2012
Researchers found viruses in a hot, acidic lake in Lassen Volcanic National Park in California containing both a RNA-derived gene and a gene for DNA replication, typical of a DNA virus. This lends support to the hypothesis that viruses performed the transfer of genetic information from RNA to DNA during the earliest epoch of life on earth

21. Self-Assembling Molecules Offer New Clues on Life's Possible Origin
Feb. 11, 2013
One aspect of the "RNA world" hypothesis that heretofore has stymied researchers is the difficulty in demonstrating that RNA molecules or components could form long, information-rich chains, in water solutions. In February 2013, a team of researchers at the Georgia Institute of Technology and the Institute for Research in Biomedicine in Barcelona, Spain announced that by giving a component of RNA known as TAP a "tail," these units become "rosettes" that spontaneously form chains in water, like a large stack of plates, up to 18,000 units long. "The nice thing [about this study] is this is a demonstration of self-assembly in water," noted Ramanarayanan Krishnamurthy, a chemist at the Scripps Research Institute in California. The next step will be to see whether such assemblies can encode information, as one possible chemical route to the origin of life

22. Molecules assemble in water, hint at origins of life
February 20, 2013
Researchers are exploring an alternate theory for the origin of RNA: they think the RNA bases may have evolved from a pair of molecules distinct from the bases we have today. This theory looks increasingly attractive, as researchers were able to achieve efficient, highly ordered self-assembly in water with small molecules that are similar to the bases of RNA.

23. Did Life on Earth Come From Mars?
SEPTEMBER 5, 2013
In August 2013, two separate developments caught the interest of many who have speculated that perhaps life on earth really started on Mars. Steven Brenner, an origin-of-life researcher at the Westheimer Institute in Florida, announced his finding that boron and molybdenum stabilize the formation of RNA in the presence of water, and thus may well have been key to the original formation of RNA. The early earth did not have much of either element, but both appear to have been more abundant on Mars billions of years ago. In a separate finding, a few days later, a team led by Christopher Adcock of the University of Nevada, Las Vegas, announced their finding that phosphates (which are an essential component of life) were also more abundant on Mars -- in particular, the Martian phosphate compounds are far more soluble in water than were the phosphates on the early earth. For details on both studies, see

24. Spark of life: Metabolism appears in lab without cells
25 April 2014
Researchers at the University of Cambridge announced that they had found that the formation of metabolic processes, key to all life and a major gap in understanding the origin of life, could have occurred spontaneously in the earth's early oceans, catalyzed by metal ions rather than enzymes, as they are in cells today. This suggests that life may have arisen metabolically first, then generated RNA later

25. Formation of life’s building blocks recreated in lab
8 Dec 2014
Researchers at the Academy of Sciences in Prague fired a high-powered laser (simulating a meteorite impact) at samples of formamide, a liquid that would have been plentiful on the early earth. They found that all four RNA bases (adenine, guanine, cytosine and uracil), three of which are also in DNA, had been formed in the reaction

26. The [GADV]‐protein world hypothesis
2015 Jan 16
Based on the fact that RNA has not only a genetic function but also a catalytic function, the RNA world theory on the origin of life was first proposed about 20 years ago. The theory assumes that RNA was amplified by self-replication to increase RNA diversity on the primitive earth. Since then, the theory has been widely accepted as the most likely explanation for the emergence of life. In contrast, we reached another hypothesis, the [GADV]-protein world hypothesis, which is based on pseudo-replication o [GADV]-proteins. We reached this hypothesis during studies on the origins of genes and the genetic code, where [G], [A], [D], and [V] refer to Gly, Ala, Asp, and Val, respectively. In this review, possible steps to the emergence of life are discussed from the standpoint of the [GADV]-protein world hypothesis, comparing it in parallel with the RNA world theory. It is also shown that [GADV]-peptides, which were produced by repeated dry-heating cycles and by solid phase peptide synthesis, have catalytic activities, hydrolyzing peptide bonds in a natural protein, bovine serum albumin. These experimental results support the [GADV]-protein world hypothesis for the origin of life.

27. Meteorite Chemicals May Have Started Life on Earth—and Space
April 16, 2015
The molecules that kick-started life on primordial Earth could have been made in space and delivered by meteorites, according to researchers in Italy. The group synthesised sugars, amino acids and nucleobases with nothing more than formamide, meteorite material and the power of a simulated solar wind, replicating a process they believe cooked up a prebiotic soup long before life existed on Earth.

28. Primordial soup hypothesis
March 24, 2016
Life on Earth began more than 3 billion years ago, evolving from the most basic of microbes into a dazzling array of complexity over time. But how did the first organisms on the only known home to life in the universe develop from the primordial soup? One theory involved a "shocking" start. Another idea is utterly chilling. And one theory is out of this world! Inside you'll learn just how mysterious this all is, as we reveal the different scientific theories on the origins of life on Earth.

29. ‘RNA world’ inches closer to explaining origins of life
May. 12, 2016
Sutherland's group has been successful in synthesizing two of the four nucleotides of RNA. In May 2016, a team led by Thomas Carell, a chemist at Ludwig Maximilian University of Munich in Germany, succeeded in synthesizing purine, one of the remaining nucleotides. What's more, the process they discovered was remarkably simple, involving chemicals known to exist on the early earth. One problem was that Carell needed to find a way to stop all but one critical amine from reacting on a aminopyrimidines molecule. But they found that the presence of a mild acid did the job, and the one amine that remained was exactly the one that forms purine

30. Hydrothermal vent models transform the origins of life from unlikely to near-inevitable
JUNE 23, 2016
Evolution only seems to move toward greater order; in the larger scheme, it’s downhill all the way. Vent models posit that given the initial conditions, the emergence of life was not a near-miracle. It was inevitable. 

31. Electric Spark hypothesis 
March 24, 2016
Life on Earth began more than 3 billion years ago, evolving from the most basic of microbes into a dazzling array of complexity over time. But how did the first organisms on the only known home to life in the universe develop from the primordial soup? One theory involved a "shocking" start. Another idea is utterly chilling. And one theory is out of this world! Inside you'll learn just how mysterious this all is, as we reveal the different scientific theories on the origins of life on Earth.
Lightning may have provided the spark needed for life to begin.
Electric sparks can generate amino acids and sugars from an atmosphere loaded with water, methane, ammonia and hydrogen, as was shown in the famous Miller-Urey experiment reported in 1953, suggesting that lightning might have helped create the key building blocks of life on Earth in its early days. Over millions of years, larger and more complex molecules could form. Although research since then has revealed the early atmosphere of Earth was actually hydrogen-poor, scientists have suggested that volcanic clouds in the early atmosphere might have held methane, ammonia and hydrogen and been filled with lightning as well.
Or could simple clay have fueled life’s beginning? Read on to find out.
Electric Spark Lightning may have provided the spark needed for life to begin. Electric sparks can generate amino acids and sugars from an atmosphere loaded with water, methane, ammonia and hydrogen, as was shown in the famous Miller-Urey experiment reported in 1953, suggesting that lightning might have helped create the key building blocks of life on Earth in its early days. Over millions of years, larger and more complex molecules could form. Although research since then has revealed the early atmosphere of Earth was actually hydrogen-poor, scientists have suggested that volcanic clouds in the early atmosphere might have held methane, ammonia and hydrogen and been filled with lightning as well. Or could simple clay have fueled life’s beginning? Read on to find out.

32. The minimotif synthesis hypothesis for the origin of life
2016 Jul 19
Several theories for the origin of life have gained widespread acceptance, led by primordial soup, chemical evolution, metabolism first, and the RNA world. However, while new and existing theories often address a key step, there is less focus on a comprehensive abiogenic continuum leading to the last universal common ancestor. Herein, I present the “minimotif synthesis” hypothesis unifying select origin of life theories with new and revised steps. The hypothesis is based on first principles, on the concept of selection over long time scales, and on a stepwise progression toward complexity. The major steps are the thermodynamically-driven origination of extant molecular specificity emerging from primordial soup leading to the rise of peptide catalysts, and a cyclic feed-forward catalytic diversification of compounds and peptides in the primordial soup. This is followed by degenerate, semi-partially conservative peptide replication to pass on catalytic knowledge to progeny protocells. At some point during this progression, the emergence of RNA and selection could drive the separation of catalytic and genetic functions, allowing peptides and proteins to permeate the catalytic space, and RNA to encode higher fidelity information transfer. Translation may have emerged from RNA template driven organization and successive ligation of activated amino acids as a predecessor to translation.

33. Our last common ancestor inhaled hydrogen from underwater volcanoes
Jul. 25, 2016
Researchers at Heinrich Heine University in Dusseldorf, Germany searched DNA databases for gene families shared by at least two species of bacteria and two archaea (even more primitive biological organisms). After analyzing millions of genes and gene families, they found that only 355 gene families are truly shared across all modern organisms, and thus are the most probable genes shared by the "last universal common ancestor" (LUCA) of life. Further, these researchers found that the probable LUCA organism was an anerobe, namely it grew in an evironment devoid of oxygen. These results suggest that LUCA originated near undersea volcanoes

34. Scientists take big step toward recreating primordial 'RNA world' of 4 billion years ago
August 15, 2016
Researchers at the Scripps Research Institute created a ribozyme (a special RNA enzyme) that can both amplify genetic information and generate functional molecules. In particular, it can efficiently replicate short segments of RNA and can transcribe longer RNA segments to make functional RNA molecules with complex strictures. These features are close to what scientists envision was an RNA replicator that could have supported life on the very early earth, before the emergence of current biology, where protein enzymes handle gene replication and transcription

35. The Emergence of Life as a First-Order Phase Transition
March 1, 2017
Here we present a model for the emergence of life in which replicators are explicitly coupled to their environment through the recycling of a finite supply of resources. The model exhibits a dynamic, first-order phase transition from nonlife to life, where the life phase is distinguished by selection on replicators. We show that environmental coupling plays an important role in the dynamics of the transition. The transition corresponds to a redistribution of matter in replicators and their environment, driven by selection on replicators, exhibiting an explosive growth in diversity as replicators are selected.

36. Life on Earth may have begun as dividing droplets
MARCH 21, 2017
In a primordial soup on ancient Earth, droplets of chemicals may have paved the way for the first cells. Shape-shifting droplets split, grow and split again in new computer simulations. The result indicates that simple chemical blobs can exhibit replication, one of the most basic properties of life, physicist Rabea Seyboldt of the Max Planck Institute for the Physics of Complex Systems in Dresden, Germany, reported March 16 at a meeting of the American Physical Society.
Within a liquid, small droplets of particular chemicals can separate out, like beads of oil in water. Such globules typically remain spherical, growing as they merge with other drops. But in simulations, Seyboldt and colleagues found that droplets might behave in a counterintuitive way under certain conditions, elongating and eventually dividing into two.

37. NASA Has Found The Ingredients For Life On Saturn’s Moon Enceladus
April 13, 2017
(Reuters) – Ice plumes shooting into space from Saturn’s ocean-bearing moon Enceladus contain hydrogen from hydrothermal vents, an environment that some scientists believe led to the rise of life on Earth, research published on Thursday showed.The discovery makes Enceladus the only place beyond Earth where scientists have found direct evidence of a possible energy source for life, according to the findings in the journal Science.Similar conditions, in which hot rocks meet ocean water, may have been the cradle for the appearance of microbial life on Earth more than 4 billion years ago.


38. Chemists may be zeroing in on chemical reactions that sparked the first life
May. 19, 2017 
DNA is better known, but many researchers today believe that life on Earth got started with its cousin RNA, because that nucleic acid can act as both a repository of genetic information and a catalyst to speed up biochemical reactions. But those favoring this “RNA world” hypothesis have struggled for decades to explain how the molecule’s four building blocks could have arisen from the simpler compounds present during our planet’s early days. Now, chemists have identified simple reactions that, using the raw materials on early Earth, can synthesize close cousins of all four building blocks. The resemblance isn’t perfect, but it suggests scientists may be closing in on a plausible scenario for how life on Earth began.
RNA’s four building blocks are called nucleotides. Each is composed of ribose, a ring-shaped sugar molecule, connected to one of four different ring-shaped “bases,” adenine (A), guanine (G), cytosine (C), and uracil (U). C and U are structurally similar to each other and collectively known as pyrimidines, whereas A and G resemble each other and are known as purines. In 2009, researchers led by Matthew Powner and John Sutherland at the Medical Research Council in Cambridge, U.K., came up with the first plausible chemical reactions that could have synthesized pyrimidines on early Earth. But very different reactions, in different conditions, seemed necessary to make purines. That begged the question of how all four nucleotides could have wound up in the same place to give rise to the first “living” RNA molecules.

39. Foldamer hypothesis for the growth and sequence differentiation of prebiotic polymers
July 10, 2017
It is not known how life originated. It is thought that prebiotic processes were able to synthesize short random polymers. However, then, how do short-chain molecules spontaneously grow longer? Also, how would random chains grow more informational and become autocatalytic (i.e., increasing their own concentrations)? We study the folding and binding of random sequences of hydrophobic (HH) and polar (PP) monomers in a computational model. We find that even short hydrophobic polar (HP) chains can collapse into relatively compact structures, exposing hydrophobic surfaces. In this way, they act as primitive versions of today’s protein catalysts, elongating other such HP polymers as ribosomes would now do. Such foldamer catalysts are shown to form an autocatalytic set, through which short chains grow into longer chains that have particular sequences. An attractive feature of this model is that it does not overconverge to a single solution; it gives ensembles that could further evolve under selection. This mechanism describes how specific sequences and conformations could contribute to the chemistry-to-biology (CTB) transition.

41.A Self-Assembled Aggregate Composed of a Fatty Acid Membrane and the Building Blocks of Biological Polymers Provides a First Step in the Emergence of Protocells
11 August 2016
Any explanation for the origin of cells requires solving two problems: (1) how were the building blocks selected and concentrated as required for the formation of the three structures; and (2) how did the membranes, RNA, and protein become associated with each other?We have proposed that interactions among the building blocks of the three structures, prior to the formation of RNA or proteins, can answer both of these questions [2]. The heart of our proposal is that the building blocks self-assembled into an aggregate with RNA and protein components bound to a fatty acid membrane, and that this aggregate stabilized the membrane and facilitated the formation of the two polymers. 41

42. Still clueless about origin of life
23 December 2008 K. S. Jayaraman
Ashwini Kumar Lal, Deputy Adviser to the Indian ministry of Statistics and Programme Implementation, examined over 60 relevant research papers in the fields of genetics, astrobiology, and space science before concluding that science has no clue about how life began.



Proposed scheme for origin of protocells. Conventional (open arrows) and proposed (filled arrows) paths to a protocell.
a. Fatty acids self-assembled in water to form a membrane.
b. Components of RNA and protein were selected and concentrated via binding to self-assembled fatty acid membranes.
c. These bound building blocks stabilized fatty acid membranes against salt-induced flocculation and increased the rate of vesicle formation.
d. Membranes that were more stable bound more building blocks, leading to an auto-amplifying system.
e. The resulting aggregate facilitated the formation of nucleosides, oligonucleotides and peptides, both because of the selection and concentration of building blocks and because of the conformational constraints and altered chemical environment due to binding.
f. The oligomers, initially composed of random sequences, stabilized membranes and induced membrane growth more effectively than their unjoined components did, leading to the accumulation of oligonucleotides and peptides prior to the evolution of their complex functions in metabolism and information transfer.

43. Cenancestor, the Last Universal Common Ancestor


Early evolution of life on Earth. 
Life originated from prebiotic chemistry. First stages of cellular evolution may have included replicative polymers other than DNA and RNA; the RNA world refers to a time when the RNA molecule acted as the hereditary as well as catalytic molecule of cells; eventually, RNA chemistry originated proteins (a relic from these days is the RNA-mediated synthesis of proteins in extant ribosomes); it is thought that cells capable of synthesizing proteins were selected for having superior catalytic molecules; finally, protein chemistry-originated DNA and cells with DNA genomes were selected for having a more stable hereditary molecule; the last universal common ancestor or cenancestor was very likely similar to extant cells in their metabolic and hereditary capacities

44. Origins of building blocks of life: A review
Norio Kitadai*, Shigenori Maruyama 29 July 2017

It is typically assumed that these vital components were synthesized abiotically, accumulated somewhere, condensed into polymers, interacted mutually, and eventually evolved into a self-sustaining system through natural phenomena on the primitive Earth.  A considerable number of laboratory simulations have been made to explore the most plausible conditions for these processes, especially for the synthesis, accumulation, and polymerization steps of organic monomers. Many uncertainties remain about how proto-metabolic systems emerged and evolved into modern counterparts.



Structures, components, and abiotic synthetic pathways of bio-macromolecules operating three fundamental functions of life (replication, compartmentalization, and metabolism).

45. Uncovering the Genomic Origins of Life
1 July 2018

The phylogenetic relationships between the Rings of Life, LUCA, and the Origin of Life Domain.
The Rings of Life, representing the evolution of extant life on Earth, are shown in shades of blue at the top of the figure. These rings are connected to LUCA which is represented by the magenta circle at the center of the figure, and the rings at the bottom of the figure represent the evolution of Adenine, Thymine, Uracil, Cytosine, and Guanine within the Origin of Life Domain.

46. The minimotif synthesis hypothesis for the origin of life
The hypothesis is based on first principles, on the concept of selection over long time scales, and on a stepwise progression toward complexity. The major steps are the thermodynamically-driven origination of extant molecular specificity emerging from primordial soup leading to the rise of peptide catalysts, and a cyclic feed-forward catalytic diversification of compounds and peptides in the primordial soup. This is followed by degenerate, semi-partially conservative peptide replication to pass on catalytic knowledge to progeny protocells. At some point during this progression, the emergence of RNA and selection could drive the separation of catalytic and genetic functions, allowing peptides and proteins to permeate the catalytic space, and RNA to encode higher fidelity information transfer. Translation may have emerged from RNA template driven organization and successive ligation of activated amino acids as a predecessor to translation.


47. The 'protein interaction world' (PIW) hypothesis]The 'protein interaction world' (PIW) hypothesis
The 'protein interaction world' (PIW) hypothesis of the origins of life assumes that life emerged as a self-reproducing and expanding system of protein interactions. In mainstream molecular biology, 'replication' refers to the material copying of molecules such as nucleic acids. However, PIW is conceptualized as an abstract communication system constituted by the interactions between proteins, in which 'replication' happens at the level of self-reproduction of these interactions between proteins.

48. A Modular Hierarchy-Based Theory of the Chemical Origins of Life Based on Molecular Complementarity]A Modular Hierarchy-Based Theory of the Chemical Origins of Life Based on Molecular Complementarity
In sum, I propose that molecular complementarity is ubiquitous in living systems because it provides the physicochemical basis for modular, hierarchical ordering and replication necessary for the evolution of the chemical systems upon which life is based. I conjecture that complementarity more generally is an essential agent that mediates evolution at every level of organization.

49. A Peptide–Nucleic Acid Replicator Origin for Life
The first ancestor to all life was a self-replicating entity capable of evolving but must have been much simpler than a cell; that is, a molecular replicator.
Recent work on RNA polymerase ribozymes supports the view that the molecular replicator was made of RNA, and no other molecule was required (the RNA World).
The RNA World is challenged by the fact that a self-replicating RNA polymerase ribozyme has yet to be demonstrated and that little evidence for its existence is seen in life today as well as problems in how the transition from RNA-only to RNA–protein world could have occurred.
A molecular replicator with two components –RNA and peptide – overcomes these problems and may be a better fit.
Evolution requires self-replication. But, what was the very first self-replicator directly ancestral to all life? The currently favoured RNA World theory assigns this role to RNA alone but suffers from a number of seemingly intractable problems. Instead, we suggest that the self-replicator consisted of both peptides and nucleic acid strands. Such a nucleopeptide replicator is more feasible both in the light of the replication machinery currently found in cells and the complexity of the evolutionary path required to reach them. Recent theoretical and mathematical work supports this idea and provide a blueprint for future investigations.

1. http://www.simsoup.info/Origin_Landmarks_Oparin_Haldane.html
2. http://www.sparknotes.com/testprep/books/sat2/biology/chapter8section1.rhtml
3. http://originoflife.net/sweet_crystal/
4. https://arxiv.org/pdf/0907.0042.pdf
5. http://sci-hub.ren/http://www.sciencedirect.com/science/article/pii/S0723202088800018
6. http://www.nytimes.com/1993/07/06/science/bubbles-may-have-speeded-life-s-origins-on-earth.html?pagewanted=all
7. https://www.researchgate.net/profile/Patrick_Forterre2/publication/15551510_Thermoreduction_a_hypothesis_for_the_origin_of_prokaryotes/links/0f317536bc0eb3e30e000000.pdf
8. https://www.livescience.com/13363-7-theories-origin-life.html
9. https://www.livescience.com/13363-7-theories-origin-life.html
10. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5223774/
11. http://origin-life.gr.jp/3401/peter/3401040.pdf
12. http://science.sciencemag.org/content/314/5805/1558.full
13. https://www.scientificamerican.com/article/primordial-soup-urey-miller-evolution-experiment-repeated/
14. http://www.nytimes.com/2009/05/14/science/14rna.html
15. http://www.earth-syst-dynam.net/2/37/2011/esd-2-37-2011.pdf
16. https://www.sciencedaily.com/releases/2010/06/100614101957.htm
17. https://www.nature.com/articles/334609a0
18. https://www.newscientist.com/article/mg21028114.000-asteroids-make-lifes-raw-materials/
19. https://biologydirect.biomedcentral.com/articles/10.1186/1745-6150-4-26
20. https://www.newscientist.com/article/mg21428613.500-first-glimpse-at-the-viral-birth-of-dna/
21. http://www.sciencemag.org/news/2013/02/self-assembling-molecules-offer-new-clues-lifes-possible-origin
22. https://www.sciencedaily.com/releases/2013/02/130220123332.htm
23. https://news.nationalgeographic.com/news/2013/09/130905-mars-origin-of-life-earth-panspermia-astrobiology/
24. https://www.newscientist.com/article/dn25471-spark-of-life-metabolism-appears-in-lab-without-cells/
25. https://www.newscientist.com/article/dn26672-formation-of-lifes-building-blocks-recreated-in-lab/
26. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4428654/
27. https://www.scientificamerican.com/article/meteorite-chemicals-may-have-started-life-on-earth-and-space/
28. http://link.springer.com.ololo.sci-hub.cc/article/10.1023%2FB%3AORIG.0000009828.40846.b3?LI=true
29. http://www.sciencemag.org/news/2016/05/rna-world-inches-closer-explaining-origins-life
30. https://www.sciencenews.org/article/life-earth-may-have-begun-dividing-droplets?tgt=nr
31. http://www.sciencedirect.com.sci-hub.cc/science/article/pii/S0079610704000999
32. https://sci-hub.ren/http://www.sciencedirect.com/science/article/pii/S0149763405001454
33. http://www.sciencemag.org/news/2016/07/our-last-common-ancestor-inhaled-hydrogen-underwater-volcanoes
34. https://www.sciencedaily.com/releases/2016/08/160815185822.htm
35. http://online.liebertpub.com/doi/abs/10.1089/ast.2016.1481?journalCode=ast&#utm_source=ETOC&utm_medium=email&utm_campaign=as
36. http://www.sciencedirect.com.sci-hub.cc/science/article/pii/S0723202088800018
37. https://www.washingtonpost.com/news/speaking-of-science/wp/2017/04/13/nasa-finds-ingredients-for-life-spewing-out-of-saturns-moon/?utm_term=.2f3dd26bda31
38. http://www.sciencemag.org/news/2017/05/chemists-may-be-zeroing-chemical-reactions-sparked-first-life
39. http://www.pnas.org/content/114/36/E7460.full
40. http://sci-hub.ren/https://www.sciencedirect.com/science/article/pii/S1674987117301305
41. http://www.mdpi.com/2075-1729/6/3/33/htm#B1-life-06-00033
42. http://www.natureasia.com/en/nindia/article/10.1038/nindia.2008.340
43. http://sci-hub.ren/https://link.springer.com/article/10.1007/s12052-012-0444-8?fbclid=IwAR2apuHawulxe7u_cS-N45u9f5ZhJOivYMSYGQ8pLboRC-V43ioiiVcxdzc
44. http://sci-hub.ren/https://www.sciencedirect.com/science/article/pii/S1674987117301305
45. https://academic.oup.com/gbe/article/10/7/1705/5045876
46. https://oatext.com/The-minimotif-synthesis-hypothesis-for-the-origin-of-life.php#gsc.tab=0
47. https://pubmed.ncbi.nlm.nih.gov/15694682/#:~:text=Abstract,expanding%20system%20of%20protein%20interactions.&text=Densely%20concentrated%20peptide%20interaction%20systems,by%20lipid%20bi-layer%20membranes
48. https://pubs.acs.org/doi/abs/10.1021/ar200209k
49. https://www.cell.com/trends/ecology-evolution/fulltext/S0169-5347(20)30003-3

Here are the references formatted as requested in BBCode size 13 with appropriate links:

1. Oparin, A. I., & Haldane, J. B. S. (1920s). The Oparin-Haldane Hypothesis. Link. (This hypothesis posits that life originated from organic compounds synthesized in a reducing atmosphere, with energy from lightning or ultraviolet light.)

2. SparkNotes Editors. (2021). Heterotroph Hypothesis. *SparkNotes: SAT II Biology*. Link. (This hypothesis proposes that early life forms were heterotrophic organisms that consumed organic molecules, which led to the development of autotrophy.)

3. Cairns-Smith, A. G. (1960). The Sweet Crystal Hypothesis. Link. (This theory proposes that life originated from inorganic crystalline structures and later transitioned into organic-based life forms.)

4. Wächtershäuser, G. (1988). Iron-Sulfur World Hypothesis. *Origins of Life and Evolution of the Biosphere*. Link. (Proposes that life began on mineral surfaces, where energy from iron-sulfur reactions facilitated the creation of organic molecules.)

5. Wächtershäuser, G. (1988). Pyrite Formation, the First Energy Source for Life. *Origins of Life and Evolution of Biospheres*. Link. (This hypothesis suggests that the formation of pyrite provided the energy necessary for early life on Earth.)

6. Deamer, D. W. & Oro, J. (1993). Bubbles May Have Speeded Life's Origins on Earth. *New York Times*, July 6, 1993. Link. (Suggests that bubbles on the surface of the primordial seas could have concentrated and catalyzed organic molecules, leading to the first living cells.)

7. Forterre, P. (1995). Thermoreduction, a Hypothesis for the Origin of Prokaryotes. *ResearchGate*. Link. (This hypothesis suggests that thermophiles were the first organisms on Earth, originating near hydrothermal vents.)

8. Anonymous. (2010). Seven Theories on the Origin of Life. *Live Science*. Link. (An overview of seven different theories on the origin of life, from the primordial soup to the RNA world hypothesis.)

9. Anonymous. (2010). Seven Theories on the Origin of Life (Updated). *Live Science*. Link. (A detailed exploration of competing hypotheses on how life began on Earth.)

10. Schiller, M. R. (2016). The Minimotif Synthesis Hypothesis for the Origin of Life. *Journal of Translational Science*. Link. (Proposes that minimotifs—short peptide sequences—played a critical role in the development of early life forms.)

11. Peter, R. F. (2003). Protein Interaction World Hypothesis. *Origin of Life Journal*. Link. (Suggests that life emerged as a system of self-reproducing protein interactions before the evolution of nucleic acids.)

12. Miller, S. L., & Urey, H. C. (1953). Primordial Soup's On: Scientists Repeat Evolution's Most Famous Experiment. *Scientific American*. Link. (This famous experiment demonstrated the production of amino acids under simulated early Earth conditions.)

13. Sutherland, J. D. (2009). Chemist Shows How RNA Can Be the Starting Point for Life. *New York Times*. Link. (A team led by Sutherland solved a key problem in the spontaneous formation of RNA nucleotides, a building block for life.)

14. Anonymous. (2011). Thermodynamic Origin of Life. *Earth System Dynamics*. Link. (A hypothesis suggesting that life began as a process to dissipate heat, driven by entropy production.)

15. Anonymous. (2010). Organic Aerosols and the Origin of Life. *ScienceDaily*. Link. (Suggests that organic aerosols may have played a role in the prebiotic chemistry that led to life.)

16. Wächtershäuser, G. (1988). Hydrothermal Vent Models and the Near-Inevitable Emergence of Life. *Nature*. Link. (Proposes that life originated at hydrothermal vents, where energy and chemical conditions were favorable for life.)

17. Bada, J. L., & Lazcano, A. (2016). Asteroids Make Life's Raw Materials. *New Scientist*. Link. (Suggests that organic molecules critical for life could have been delivered by asteroids and meteorites.)

18. Forterre, P. (2005). Viral Birth of DNA and Its Role in Evolutionary Transitions. *Biology Direct*. Link. (This paper proposes that viruses played a key role in the transition from RNA to DNA during early life.)

Current scientific transition proposals from a supposed "progenote" to the last universal common ancestor (LUCA)

We refer to the system of polymerization as “prelife” and the system of replicators as “life” for a descriptive shorthand.
https://sci-hub.ee/10.1021/ar2002683

Life is the most intricate and complex phenomenon known to science. 12 The origins of life stands among the great open scientific questions of our time. 13

It is commonly held that the last universal common ancestor (LUCA) was not the first life, but that there was a transition between a so-called " progenote ", which represents the first life, and LUCA. There is no consensus about the constitution of the progenote, and various descriptions have been brought forward:  

Be introduced to the First Universal Common Ancestor(FUCA): the great-grand mother of LUCA (Last UniversalCommon Ancestor)
We propose the existence of this non-cellular entity named FUCA, as the First Universal Common Ancestor. FUCA was born in the very instant on which RNA-world replicators started to be capable to catalyze the bonding of amino acids into oligopeptides. FUCA has been considered mature when the translation system apparatus has been assembled together with the establishment of a primeval, possibly error-prone genetic code. This is FUCA, the greatgrandmother of LUCA. 14
https://www.preprints.org/manuscript/201806.0035/v1

My comment: That would not be enough to have a first living, self-replicating cell. Following  irreducible processes and parts  are required to keep cells alive, and illustrate mount improbable to get life a first go:
 
Reproduction. Reproduction is essential for the survival of all living things.
Metabolism. Enzymatic activity allows a cell to respond to changing environmental demands and regulate its metabolic pathways, both of which are essential to cell survival. 
Nutrition. This is closely related to metabolism. Seal up a living organism in a box for long enough and in due course it will cease to function and eventually die. Nutrients are essential for life. 
Complexity. All known forms of life are amazingly complex. Even single-celled organisms such as bacteria are veritable beehives of activity involving millions of components. 
Organization. Maybe it is not complexity per se that is significant, but organized complexity. 
Growth and development. Individual organisms grow and ecosystems tend to spread (if conditions are right). 
Information content. In recent years scientists have stressed the analogy between living organisms and computers. Crucially, the information needed to replicate an organism is passed on in the genes from parent to offspring. 
Hardware/software entanglement. All life of the sort found on Earth stems from a deal struck between two very different classes of molecules: nucleic acids and proteins. 
Permanence and change. A further paradox of life concerns the strange conjunction of permanence and change.
Sensitivity. All organisms respond to stimuli— though not always to the same stimuli in the same ways.
Regulation. All organisms have regulatory mechanisms that coordinate internal processes.


Somewhere on the ocean-covered early Earth and in a narrow window of time of only about 200 million years, the first cells came into existence. 15

The current literature uses the term progenote in two different ways:
1) it signifies an organizational level in evolution when prokaryotic organization preceded cells; or
2) it is used to denote the last common ancestor of all extant life. In some scenarios that describe early cellular evolution, it was assumed that the last common ancestor was at a pre prokaryotic level of organization; however, subsequent analyses of the molecular evolution of different cellular components suggest that the last common ancestor was a prokaryote. Based on this realization, the term progenote should be more properly used to denote a hypothetical preprokaryotic stage in cellular evolution, distinct from the last common ancestor. 6

The progenote is a hypothetical candidate for the last universal cellular ancestor. 7 There are two major conjectures associated with this entity:

(1) the progenote's genome is based on RNA rather than DNA and
(2) the replication, transcription and translation of this RNA organism had a much higher error rate than the ensuing DNA‐based cells.

The universal ancestor 11
Carl Woese,  June 9, 1998
Entities in which translation had not yet developed to the point that proteins of the modern type could arise have been termed “progenotes,” and the era during which these were the most advanced forms of life, the “progenote era”
For Carl Woese, a motivating belief was that major structural and functional differences between the translational machineries of Bacteria, Archaea and eukaryotes reflect different solutions to problems of translational accuracy and efficiency as yet only partially solved in their common ancestor. That ancestor was thus more primitive than any contemporary pro- or eukaryote  Woese & Fox called it ‘the progenote’. 4 When one looks at the eukaryotic cell in molecular detail, at its nuclear organization—control mechanisms, introns and so on— it feels in a way less, not more, advanced than its prokaryotic counterparts—less streamlined, less straightforwardly controlled. In fact, one might profitably consider that the urcaryote [the earliest eukaryote] in ways resembles the progenote more than do prokaryotes. I would like to suggest that the eukaryotic cell evolved from the progenote at a somewhat later time than did its prokaryotic counterparts and that this is, in fact, responsible for the origin of the nucleus.  If modern large proteins could not be produced by progenotes, then a modern type of genome replication/repair mechanism did not exist. As with translation, a rudimentary mechanism implies a less accurate one, and the resulting high mutation rates necessitated small genomes. The structure of these genomes must reflect the primitive evolutionary dynamic in general. Therefore, I see the progenote genome as organized rather like the macronucleus of some ciliates today: it comprised many small linear chromosomes (mini-chromosomes), each present in multiple copies. Each chromosome was “operonally” organized, that is, functionally or structurally related genes were grouped together. The individual chromosomes were “semi-autonomous” in the sense that they more resembled mobile genetic elements than typical modern chromosomes. Cell division occurred in the simplest way possible, by a physical pinching of the cell into two approximately equal halves. 

Progenotes Become Genotes. At these early stages of life, everything turned upon the evolution of translation. Each slight improvement in that process, each increase in its accuracy, would have permitted a new generation of proteins to emerge. These new proteins, in turn, refined and developed the metabolic pathways and generally improved the cell, which then set the stage for a further round of improvement in translation. In this way, wave after wave of innovation occurred, each triggered by a refinement in translation and spread throughout the community by lateral gene transfer. This iterative, bootstrapping evolution continued until the accuracy of translation reached a level where it no longer prevented the evolution of the types of proteins we see today. The evolutionary dynamic then ceased to be constrained by imprecise translation, and progenotes, by definition, became genotes. This transition did not mean that translation had stopped evolving, nor did it mean that the initial genotes were modern types of cells. That latter development required many more innovations and refinements.

I cannot see anything besides baseless speculations here, without a shred of evidence to back up the ideas and scenarios.

Opinion: Studies on the origin of life — the end of the beginning 3
John D. Sutherland 18 January 2017
Understanding how life on Earth might have originated is the major goal of origins of life chemistry. To proceed from simple feedstock molecules and energy sources to a living system requires extensive synthesis and coordinated assembly to occur over numerous steps, which are governed only by environmental factors and inherent chemical reactivity. 3 for what turned out to be purely chemical reasons, albeit elegantly subtle ones — then it could be a recapitulation of the way that natural life originated. We are not yet close to achieving this.  Broadly speaking, the origin of life can be approached by thinking from biology down or from chemistry up1. From biology down, phylogenetic analysis of gene sequences can be used to plumb the depths and deduce the general nature of the last universal common ancestor (LUCA) of cellular life from its catalog of genes, but just how relevant is this to the actual origin of life? The latest list of genes thought to be present in LUCA is a long one. The presence of membranes, proteins, RNA and DNA, the ability to perform replication, transcription and translation, as well as harbouring an extensive metabolism driven by energy harvested from ion gradients using ATP synthase, reveal that there must have been a vast amount of evolutionary innovation between the origin of life and the appearance of LUCA.

Many of the inferred proteins in LUCA use FeS clusters and other transition-metal-ion-based co-factors; thus, Biology almost always relies on chemistry that does not proceed efficiently in the absence of catalysis, because this allows chemistry to be regulated by dialing various catalysts up or down. However, most prebiotic chemistry must proceed of its own accord, and this surely suggests that it must generally be different from the underlying chemistry used in biology (although this is not invariably the case; for example, the dismutation of 6,7-Dimethyl-8-ribityllumazine  can proceed efficiently in the absence of enzymatic catalysis. Nevertheless, despite the inevitable widespread differences between their individual reactions, prebiotic reaction networks ultimately have to transition into biochemical networks; hence, there must be some similarities between the two, if only at the level that practitioners of synthesis would view as strategic. 

There is indeed a HUGE UNBRIDGEABLE GAP between the two.


Despite the inevitable widespread differences between their individual reactions, prebiotic reaction networks ultimately have to transition into biochemical networks; hence, there must be some similarities between the two, if only at the level that practitioners of synthesis would view as strategic.

By approaching the origin of life from chemistry up, there have to be constraints as to what are plausible starting materials and reaction conditions, but defining these constraints can be difficult because of our uncertainties concerning early Earth geochemistry. Synthesis inevitably has to play a major part, but it has to somehow be controlled and coordinated if mixtures of just the right complexity to progress towards life are to be produced. High energy, non-selective chemistry might appear appealing at first, because many (proto-)biomolecules can be produced in one step — especially if one is prepared to analyze down to the parts per million level — but myriad by-products make their subsequent separation or selective utilization seem impossibly difficult. More plausibly, certain inherently favored reactions or sequences of reactions might selectively produce key molecules destined for biology. If this were the case, then it should be discoverable through experimental investigation. Accordingly, several years ago, we set out to use experimental chemistry to address two questions. First, are completely different chemistries needed to make the various subsystems? Second, would these chemistries be compatible with each other? Our goal was to investigate the synthesis of nucleotides, amino acids, lipids and other cellular components from simple feedstocks under prebiotically an environment that could furnish these inorganic components is circumstantially implicated. 

It seems unlikely that the earliest evolutionary wonders of biology were all discovered simultaneously. 

The author commits two fallacies in one sentence. First, there was no evolution prior DNA replication. The only alternative mechanism to intelligent implantation is unguided, random chemical reactions. Secondly, " discovering " implies teleology, which is tabu. 

A stepwise process seems much more plausible, but for each innovation to be retained against the otherwise inexorable drift towards equilibrium, energy would have to be expended endlessly. 

That's a self-defeating sentence. If thermodynamics argue against such processes, why are stepwise processes more plausible? Isn't it rather, that once design is discarded, there can ONLY be stepwise processes, since assembly all at once is not how natural mechanisms operate? Isn't it that the naturalistic framework and a priori thinking is producing its bitter fruits here? 

Combining these ideas with the concept that aliveness need not be all or nothing leads to a diagrammatic depiction that we have found useful to collect and direct our thoughts: 

Tempo, Mode, the Progenote, and the Universal Root 10
1995
Woese felt that the differences between archaebacteria and either eubacteria or eukaryotes were of a sufficiently fundamental nature to indicate that all three primary kingdoms must have begun to diverge during the period of progressive evolution from a progenote. But there was no way to decide the order of branching—whether the first divergence in the universal tree separated (i) eubacteria from a line that was to produce archaebacteria and eukaryotes, or (ii) a proto-eukaryotic lineage from a fully prokaryotic (eubacterial and archaebacterial) clade, or (iii) the (the third and least popular possibility) archaebacteria from eukaryotes and eubacteria. 

There is in fact in principle no way to decide this or to root such a universal tree based only on a collection of homologous sequences. A solution to this problem was proposed and implemented by Iwabe and colleagues (Iwabe et al., 1989), in 1989. Although there can be no organism that is an outgroup for a tree relating all organisms, we can root an all-organism tree based on the sequences of outgroup genes produced by gene duplication prior to the time of the cenancestor.

In 1990, Woese, Kandler and Wheelis incorporated the Iwabe rooting in a new and broader exegesis on the significance of the tripartite division of the living world . This treatment elevated the rank of the three primary kingdoms to "domains" (since kingdom status was already well accepted for animals, plants, and fungi within the eukaryotes) and renamed them Bacteria, Archaea, and Eucarya.

The root of the universal tree is still "up in the air," and we don't know as much about the cenancestor as we had hoped. Why is this? One possibility is that we are pushing molecular phylogenetic methods to their limits: although we have reasonable ways of assessing how well any given tree is supported by the data on which it is based, methods for determining the likelihood that this is the "true tree" are poorly developed. The issue is whether the last common ancestor of all life, the cenancestor , was a primitive entity, a progenote, with a more rudimentary genetic information-transfer system. Thinking on this issue is still unsettled. Much depends on the placement of the root of the universal tree and on whether or not lateral transfer renders such rooting meaningless.

Since the reclassification of all life forms in three Domains (Archaea, Bacteria, Eukarya), the identity of their alleged forerunner (Last Universal Common Ancestor or LUCA) has been the subject of extensive controversies: progenote or already complex organism, prokaryote or protoeukaryote, thermophile or mesophile, product of a protracted progression from simple replicators to complex cells or born in the cradle of "catalytically closed" entities? LUCA may be understood as a diverse community of already metabolically and genetically sophisticated organisms. Its predecessor the progenote, more primitive and modular, was also a heterogeneous and diverse community of cells engaged in the emergence of a genetic code 1

The emergence of self-replicating entities of increasing complexity requires both the formation of compartments (without which no distinction can be made between genotype and phenotype, and parasitic molecules cannot be removed) and an ambient metabolism from which to draw renewable building blocks; such a metabolism, therefore, should be self-sustaining to a certain extent; de Duve and Wachtershauser  have presented different versions of dynamic, evolving and self-sustaining metabolic networks.

The term progenote is often used in the sense of progenitor to denote the last common ancestor of archea, bacteria, and eukaryotes, not in the intended sense as a contrast to genote or Eugene, that is, organisms that have a “precise, accurate link between genotype and phenotype”

Koonin, the logic of chance, page 213:



The difficulty of the problem cannot be overestimated. Indeed, all known cells are complex and elaborately organized. The simplest known cellular life forms, the bacterial (and the only known archaeal) parasites and symbionts, clearly evolved by degradation of more complex organisms; 

That puts the complexity of the progenote further back. And then, that complexity has to be explained. 

However, even these possess several hundred genes that encode the components of a fully fledged membrane; the replication, transcription, and translation machineries; a complex cell-division apparatus; and at least some central metabolic pathways. the simplest free-living cells are considerably more complex than this, with at least 1,300 genes. The only known autonomously replicating agents that are substantially simpler are viruses, but these are obligate intracellular parasites and do not present anything resembling an intermediate stage between a cell and a virus (whatever the direction of evolution might have been). So considering Omnis cellula e cellula and Omnis virus e virus, something has to give: The uniformitarian principle cannot apply to the origin of cells that must have evolved through a series of events that were fundamentally different from the familiar evolutionary processes. So here we discuss first the reconstruction of the gene repertoire of LUCA and then the implications of the results for the origin of cells.

The logic of change,
Koonin, page 213:
All known cells are complex and elaborately organized. The simplest known cellular life forms, the bacterial (and the only known archaeal) parasites and symbionts, clearly evolved by degradation of more complex organisms; however, even these possess several hundred genes that encode the components of a fully fledged membrane; the replication, transcription, and translation machineries; a complex cell-division apparatus; and at least some central metabolic pathways. The only known autonomously replicating agents that are substantially simpler are viruses, but these are obligate intracellular parasites and do not present anything resembling an intermediate stage between a cell and a virus (whatever the direction of evolution might have been). The uniformitarian principle cannot apply to the origin of cells that must have evolved through a series of events that were fundamentally different from the familiar evolutionary processes.







Barrier to bear life. 
Six barriers are shown in relation to the size of molecule. The largest barrier is No. 5 which is a transition from RNA world to DNA world. The last barrier is the birth of ecosystem. 8


 An arbitrary scale of complexity towards the emergence of life. 9





Bill Faint: life in any form is a very serious enigma and conundrum. It does something, whatever the biochemical pathway, machinery, enzymes etc. are involved, that should not and honestly could not ever "get off the ground". It SPONTANEOUSLY recruits Gibbs free energy from its environment so as to reduce its own entropy. That is tantamount to a rock continuously recruiting the wand to roll it up the hill, or a rusty nail "figuring out" how to spontaneously unrust and add layers of galvanizing zinc on itself to fight corrosion. Unintelligent simple chemicals can't self-organize into instructions for building solar farms (photosystems 1 and 2), hydroelectric dams (ATP synthase), propulsion (motor proteins) , self repair (p53 tumor suppressor proteins) or self-destruct (caspases) in the event that these instructions become too damaged by the way the universe USUALLY operates. Abiogenesis is not an issue that scientists simply need more time to figure out but a fundamental problem with materialism

Systems chemistry synthesis of building blocks. 
The evidence that certain chemistry was crucial to the emergence of life would be expected to be especially strong for C–C bond forming reactions and synthetic homologations or other elaborations based thereon. This is because early Earth carbon feedstocks were most likely one-carbon compounds, and yet most biomolecules have multiple contiguous carbon atoms. Joining two molecules of the same one-carbon compound together through C–C bond formation is difficult: electrophilic formaldehyde 1 does not easily dimerize, neither does the weaker electrophile carbon dioxide or the marginally nucleophilic carbon monoxide. By contrast, hydrogen cyanide 2 will dimerize through the attack of its nucleophilic conjugate base upon its weakly electrophilic self, but this reaction is sluggish, and the resultant dimer is more reactive than the monomer thus polymerization ensues.

Issues of directionality in the history of life are usually framed in terms of  major evolutionary steps, or megatrajectories (cf. Maynard Smith and Szathmary 1995): being the first steps

(1) evolution from the origin of life to the last common ancestor of extant organisms,
(2) the metabolic diversification of bacteria and archaea,
(3) evolution of eukaryotic cells







1. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2478661/
2. Koonin, The logic of chance, page 331
3. https://sci-hub.bz/https://www.nature.com/articles/s41570-016-0012?WT.feed_name=subjects_biosynthesis
4. Woese CR, Fox GE. 1977 The concept of cellular evolution. J. Mol. Evol. 10, 1 – 6. (doi:10.1007/ BF01796132) http://sci-hub.bz/https://link.springer.com/article/10.1007/BF01796132
5. http://www.pnas.org/content/95/12/6854.full
6. http://what-when-how.com/molecular-biology/progenote-molecular-biology/
7. http://www.els.net/WileyCDA/ElsArticle/refId-a0000463.html
8. http://www.sciencedirect.com/science/article/pii/S1674987112001272
9. https://libgen.pw/view.php?id=208133
10. https://www.ncbi.nlm.nih.gov/books/NBK232215/
11. http://www.pnas.org/content/95/12/6854.long
12. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3322530/
13. https://arxiv.org/pdf/1705.08073.pdf
14. https://webcache.googleusercontent.com/search?q=cache:GYeNlzVVcQoJ:https://www.preprints.org/manuscript/201806.0035/v1/download+&cd=15&hl=pt-BR&ct=clnk&gl=br
15. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6095482/

LUCA—The Last Universal Common Ancestor 1

The last universal common ancestor represents the primordial cellular organism from which diversified life was derived. It has been considered as the branching point on which Bacteria, Archaea and Eukaryotes have diverged. 6

LUCA is a theoretical construct—it might or might not have been something we today would call an organism. It helps to bridge the conceptual gap between rocks and water on the early Earth and ideas about the nature of the first cells. 7

Since Woese et al. (1990) described the three domains of life, classical evolutionary theory considers this last universal common ancestor (LUCA) as the branching point on which Bacteria, Archaea and Eukarya separated on the tree about 3.5 billion years ago. Currently termed the Last Universal Common Ancestor or LUCA, its form, constitution, timeline and other characteristics have been the subject of intense discussions within the scientific community. Since the 1950s, after the discovery of the DNA structure and throughout the seventies until the maturation of molecular biology, a new chapter on the identity of LUCA emerged, with the possibility of understanding the molecular constitution of all living beings.

Another important milestone in the modern definition of the very first ancestor of all living forms was the work of Carl Woese. Working with the sequencing of ribosomal RNA molecules, Woese discovered that the prokaryotic world was not uniform and could be divided in two main clades named Eubacteria and Archaebacteria (Woese et al. 1990).

Among the processes that were already present in the classic interpretation of LUCA, it is frequently suggested that LUCA would harbor 

(i) a reasonably complex ancestor genome with information stored in a chromosome-like DNA molecule,
(ii) an established genetic code and 
(iii) genes encoding not only molecules from the information storage machinery but also 
(iv) a complex basal metabolism, with sophisticated enzymes used for the energetic metabolism through glycolysis and the citric acid cycle (Penny & Poole, 1999).

The recent development of modern techniques for genome sequencing is allowing a deeper comprehension of the most conserved genes existing in all living entities. These data have enabled global comparative analysis of gene and genome compositions and aided the identification of conserved metabolic routes acting in all living organisms. Statistical models using hundreds of genes are allowing the development of the most likely ancestor genome that might have existed in the classical version of LUCA. Much of the reasoning used in this comparative analysis of genomes in the search of LUCA’s gene content is based on the idea that if a gene or process is present in all known organisms, it must have been a homology, i.e. it must have been present in the LUCA.

Essential pathways related to the processing of RNAs were shown to be conserved in the organisms studied, indicating that they were most likely present in the genome of life’s ancestor. Most enzymes involved in DNA replication are not conserved in every organism, suggesting that this process might have emerged several times after diversification of LUCA. 

If they are not conserved, that means, there is no common branching point, which is evidence that LUCA is not a compelling explanation of the origin of life. The alternative is that life emerged several times individually, which is, given the complexity, an extremely unlikely scenario, if no creative force or agency is supposed. 

The theoretical idea of an organism such as the LUCA has proven to be extremely attractive and even necessary under Darwinian considerations, though the biological complexity of the methods used to unfold these questions present challenges to the concept. Researchers have no certainties about the relevance of lateral gene transfer events at the beginning of the biological systems and how these events may have contributed to the genome of LUCA. We also know very little about gene evolution among gene families and how a gene actually forms another gene putatively by divergence after duplication.

Another important conundrum here would be in understanding how an initial genome of an organism such as LUCA has been formed departing from either a replicator molecule or a chemistry-based proto-metabolism.

Thus, the emergence of this very first biological entity should have begun in an organism already containing DNA, RNA and metabolism based in proteins, together with sophisticated transcription and translation machineries
working with repair and recombination systems, along with regulation of gene expression and control of cell division (Penny & Poole, 1999).

In this scenario, the viruses are considered as derivatives of cellular organisms; this way, its origin was after the emergence of LUCA. However, with deeper understanding on the genetic constitution of viruses, new questions about LUCA emerged, such as how to explain the existence of genes present only in these organisms?

A minimal estimate for the gene content of the last universal common ancestor
19 December 2005
A fairly complex genome similar to those of free-living prokaryotes, with a variety of functional capabilities including metabolic transformation, information processing, membrane/transport proteins and complex regulation, shared between the three domains of life, emerges as the most likely progenitor of life on Earth, with profound repercussions for planetary exploration and exobiology. The estimate of LUCA's gene content appears to be substantially higher than that proposed previously, with a typical number of over 1000 gene families, of which more than 90% are also functionally characterized.a fairly complex genome similar to those of free-living prokaryotes, with a variety of functional capabilities including metabolic transformation, information processing, membrane/transport proteins and complex regulation, shared between the three domains of life, emerges as the most likely progenitor of life on Earth
http://sci-hub.ren/https://www.sciencedirect.com/science/article/pii/S0923250805002676

The Last Universal Common Ancestor: emergence, constitution and genetic legacy of an elusive forerunner
2008 Jul 9
LUCA does not appear to have been a simple, primitive, hyperthermophilic prokaryote but rather a complex community of protoeukaryotes with a RNA genome, adapted to a broad range of moderate temperatures, genetically redundant, morphologically and metabolically diverse.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2478661/

The proteomic complexity and rise of the primordial ancestor of diversified life
2011 May 25
Life was born complex and the LUCA displayed that heritage. Recent comparative genomic studies support the latter model and propose that the urancestor was similar to modern organisms in terms of gene content
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3123224/

Last Universal Common Ancestor had a complex cellular structure
OCT 5, 2011
New evidence suggests that LUCA was a sophisticated organism after all, with a complex structure recognizable as a cell, researchers report. Their study appears in the journal Biology Direct. The study lends support to a hypothesis that LUCA may have been more complex even than the simplest organisms alive today, said James Whitfield, a professor of entomology at Illinois and a co-author on the study.
http://news.illinois.edu/news/11/1005LUCA_ManfredoSeufferheld_JamesWhitfield_Caetano_Anolles.html

Cenancestor, the Last Universal Common Ancestor
02 September 2012
Theoretical estimates of the gene content of the Last Common Ansestor’s genome suggest that it was not a progenote or a protocell, but an entity similar to extant prokaryotes.
https://link.springer.com/article/10.1007/s12052-012-0444-8

Some Assembly Required: The Ingredients of Life
July 1, 2017
From analyses of bacterial microfossils, (some of which may be up to 3.48 billion years old) we know that the most primitive life was nearly as complex as today’s bacteria. Unfortunately, the (micro)fossil record can’t really tell us how we got from the simple chemicals to living, working, bacterial cells.
http://origins.case.edu/2017/07/01/some-assembly-required-the-ingredients-of-life/

Koonin, the logic of chance, page 213:
Comparative-genomic reconstruction of the gene repertoire of LUCA
Why do we believe that there was a LUCA? More than one argument supports the LUCA conjecture, but the strongest one seems to be the universal evolutionary conservation of the gene expression system. Indeed, all known cellular life forms use essentially the same genetic code (the same mapping of 64 codons to the set of 20 universal amino acids and the stop signal), with only a few minor deviations in highly degraded genomes of bacterial parasites and organelles. The universal conservation of the code and the expression machinery, and the most coherent evolutionary history of its components leave no reasonable doubt that this system is the heritage of some kind of LUCA.

The inference makes sense based on methodological naturalism. Once design is considered, one can infer common design of all life forms of the aforementioned machinery.

Arguments for a LUCA that would be indistinguishable from a modern prokaryotic cell have been presented, along with scenarios depicting LUCA as a much more primitive entity (Glansdorff, et al., 2008).
The difficulty of the problem cannot be overestimated. Indeed, all known cells are complex and elaborately organized. The simplest known cellular life forms, the bacterial (and the only known archaeal) parasites and symbionts, clearly evolved by degradation of more complex organisms; however, even these possess several hundred genes that encode the components of a fully fledged membrane; the replication, transcription, and translation machineries; a complex cell-division apparatus; and at least some central metabolic pathways. As we have already discussed, the simplest free-living cells are considerably more complex than this, with at least 1,300 genes. 

All the difficulties and uncertainties of evolutionary reconstructions notwithstanding, parsimony analysis combined with less formal efforts on the reconstruction of the deep past of particular functional systems leaves no serious doubts that LUCA already possessed at least several hundred genes. In addition to the aforementioned “golden 100” genes involved in expression, this diverse gene complement consists of numerous metabolic enzymes, including pathways of the central energy metabolism and the biosynthesis of amino acids, nucleotides, and some coenzymes, as well as some crucial membrane proteins, such as the subunits of the signal recognition particle (SRP) and the H+-ATPase.

However, the reconstructed gene repertoire of LUCA also has gaping holes. The two most shocking ones are

(i) the absence of the key components of the DNA replication machinery, namely the polymerases that are responsible for the initiation (primases) and elongation of DNA replication and for gap-filling after primer removal, and the principal DNA helicases, and
(ii) the absence of most enzymes of lipid biosynthesis. These essential proteins fail to make it into the reconstructed gene repertoire of LUCA because the respective processes in bacteria, on one hand, and archaea, on the other hand, are catalyzed by different, unrelated enzymes and, in the case of membrane phospholipids, yield chemically distinct membranes.

Thus, the reconstructed gene set of LUCA seems to be remarkably nonuniform, in that some functional systems appear to have reached complexity that is almost indistinguishable from that in modern organisms, whereas others come across as rudimentary or missing. This strange picture resembles the general concept of asynchronous “crystallization” of different cellular systems at the early stages of evolution that Carl Woese proposed and prompts one to step back and take a more general view of the LUCA problem.

These problems are solved, once someone takes another approach, and understands that a creator made each of the organisms distinctively and separately, each of its kind.

More specifically, with regard to membrane biogenesis, it has been proposed that LUCA had a mixed, heterochiral membrane, so that the two versions with opposite chiralities emerged as a result of subsequent specialization in archaea and bacteria, respectively. With regard to DNA replication, a hypothesis has been developed under which one of the modern replication systems is ancestral, whereas the other system evolved in viruses and subsequently displaced the original system in either the archaeal or the bacterial lineage. The other major area of nonhomology between archaea and bacteria, lipid biosynthesis (along with lipid chemistry), prompted the even more radical hypothesis of a noncellular although compartmentalized LUCA. Specifically, it has been proposed that LUCA(S) might have been a diverse population of expressed genetic elements that dwelled in networks of inorganic compartments.

This is a nice example of how there have to be far-fetched, invented, incredible, fictional made-up scenarios in order to keep the standard paradigm of philosophical naturalism.

The possibility that LUCA was dramatically different from any known cells has been brought up, originally in the concept of “progenote,” a hypothetical, primitive entity in which the link between the genotype and the phenotype was not yet firmly established. In its original form, the progenote idea involves primitive, imprecise translation, a notion that is not viable, given the extensive pre-LUCA diversification of proteins that the analysis of diverse protein superfamilies has demonstrated beyond doubt.

Even the most conservative models of the composition of LUCA paint it as a quite complex system, a true organism. A system like this would be very difficult to imagine arising directly from purely prebiotic chemical reactions.
ASTROBIOLOGY An Evolutionary Approach page 131

Life essential elements :

Carbon
Oxygen
Chlorine
Hydrogen
Nitrogen
Potassium
Calcium
Molybdenum
Sulfur
Iron
Magnesium
Phosphate
Sodium
Zinc
Chromium
Selenium
Lithium
Cobalt
Iodine
Boron  
Silicon

1) http://www.actionbioscience.org/evolution/poolepaper.html
2) http://www.ncbi.nlm.nih.gov/pubmed/16431085
3) http://www.macromol.uni-osnabrueck.de/paperMulk/Mulkid_Nat_Rev_Micro_2007.pdf
4) http://isites.harvard.edu/fs/docs/icb.topic635406.files/Becerra%20et%20al%202007.pdf
5) Koonin, the logic of chance, page 213
6. http://sci-hub.tw/https://www.cambridge.org/core/journals/international-journal-of-astrobiology/article/buds-of-the-tree-the-highway-to-the-last-universal-common-ancestor/ED26AA7787BA5A152090913CC7C20067
7. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6095482/

https://reasonandscience.catsboard.com/t2176-lucathe-last-universal-common-ancestor#3995

Essential elements and building blocks for the origin of life


Cells assemble complex carbohydrates, lipids, proteins, and nucleic acids from small organic molecules. These small organic molecules—simple sugars, fatty acids, amino acids, and nucleotides—are called monomers when they are used as subunits of larger molecules. A molecule that consists of multiple monomers is called a polymer. Cells build polymers from monomers and break down polymers to release monomers. These and other processes of molecular change are called reactions. Cells constantly run reactions as they acquire and use energy to stay alive, grow, and reproduce—activities that are collectively called metabolism 25

Life's simplest molecular building blocks, including amino acids, sugars, lipids, and bases, emerged supposedly through chemical reactions in numerous prebiotic environments. Prebiotic processes might have also produced a bewildering diversity of seemingly useless molecules; most of the molecular jumble played no obvious role. The emergence of concentrated suites of just the right mix thus remains a central puzzle in origin-of-life research. Life requires the assembly of just the right combination of small molecules into much larger collections - "macromolecules" with specific functions. Making macromolecules is complicated by the fact that for every potentially useful small molecule in the prebiotic soup, dozens of other molecular species had no obvious role in biology. Life is remarkably selective in its building blocks, whereas the vast majority of carbon-based molecules synthesized in prebiotic processes have no obvious biological use. Consequently, a significant challenge in understanding life's chemical emergence lies in finding mechanisms by which the right combination of small molecules was selected, concentrated and organized into the larger macromolecular structures vital to life.

Then, the author makes a remarkable assertion:

The oceans formed a weak solution in which it would have been difficult for advantageous combinations of molecules to react in the chemical path to life. Two processes, self-selection and surface organization, are likely to have led to molecular selection.

That is quite interesting. First, he confesses that "  The emergence of concentrated suites of just the right mix thus remains a central puzzle in origin-of-life research ", and then, makes a 180 degree change of direction, and claims that : " Two processes, self-selection and surface organization, are likely to have led to molecular selection. "

What is it now?

Most water-soluble molecules don't self-organize and must be selected by another means. Yet accumulations of organic molecules, no matter how highly selected and intricately organized, are not alive unless they also possess
the ability to reproduce. Metabolism requires a sequence of chemical reactions that work in concert.

Making macromolecules is complicated by the fact that for every potentially useful small molecule in a supposed prebiotic soup, dozens of other molecular species had no obvious role in biology. Life requires selected building blocks, whereas the vast majority of carbon-based molecules synthesized in prebiotic processes have no obvious biological use. Consequently, a significant hurdle of unguided chemical emergence lies in getting the right combination of small molecules, concentrated and organized to be used in the larger macromolecular structures vital to life.

Understanding the role of the Earth dynamics cannot be absent to construct the new plausible theory for origin of life. 6 The life is essentially composed of carbon, oxygen, hydrogen, and nitrogen. Most living organisms postulate other inorganic elements to construct their bodies, to activate enzyme and for their metabolism. The series of inorganic elements demanded by living organisms are often called bio-essential elements. These include P, B, Mo, Mn, Cu and Zn among others.

At the core of life lies a network for the synthesis of the small organic molecules from which all biomass is derived. Remarkably, this core network of molecules and pathways is small (containing about 125 basic molecular building blocks) and very highly conserved. 2 If viewed at the ecosystem level – meaning that, for each compound, one asks what pathways must have been traversed in the course of its synthesis, disregarding which species may have performed the reaction or what trophic exchanges may have befallen pathway intermediates along the way – the core network is also essentially universal.

The primitive prebiotic environment contained a broad array of organic compounds, only a few of which would have been useful to the origin of nucleic acids. What sort of processes leading to nucleic acids can be imagined in such an environment? If a useful step in chemical evolution were achieved, how would it become stabilized so that it would be an integral part of the developing system? There are no sure answers to such questions. 3

The overall metabolism is based on seven non-metal elements, H, C, N, 0, P, S, and Se. With these elements, all the major polymers of all cells are made. Hence the major metabolic pathways involve them. Their uptake and loss are the major flows of material. Most of this metabolism in the cytoplasm is unchanged in all cells to this day 4



Our present atmosphere consists of 78% nitrogen (N2), 21% molecular oxygen (O2), and 1% of other gases, such as carbon dioxide CO2), argon (Ar), and water vapor H2O). An atmosphere containing free oxygen would be fatal to all origin of life schemes. While oxygen is necessary for life, free oxygen would oxidize and thus destroy all organic molecules required for the origin of life. Thus, in spite of much evidence that the earth has always had a significant quantity of free oxygen in the atmosphere, 3 proponents of evolution persist in declaring that there was no oxygen in the earth's early atmosphere. However, this would also be fatal to an evolutionary origin of life. If there were no oxygen there would be no protective layer of ozone surrounding the earth. Ozone is produced by radiation from the sun on the oxygen in the atmosphere, converting the diatomic oxygen(O2) we breathe to triatomic oxygen O3), which is ozone. Thus if there were no oxygen there would be no ozone. The deadly destructive ultraviolet light from the sun would pour down on the surface of the earth unimpeded, destroying those organic molecules required for life, reducing them to simple gases, such as nitrogen, carbon dioxide, and water. Thus, proponents of evolution face an irresolvable dilemma: in the presence of oxygen, life could not evolve; without oxygen, thus no ozone, life could not evolve or exist. 1

Carbon
Carbon is unique in its ability to combine with other atoms, forming a vast and unparalleled number of compounds in combination with hydrogen, oxygen and nitrogen. This universe of organic chemistry— with its huge diversity of chemical and physical properties—is precisely what is needed for the assembling of complex chemical systems. Furthermore, the general ‘metastability’ of carbon bonds and the consequent relative ease with which they can be assembled and rearranged by living systems contributes greatly to the fitness of carbon chemistry for biochemical life. No other atom is nearly as fit as carbon for the formation of complex biochemistry. Today, one century later, no one doubts these claims. Indeed the peerless fitness of the carbon atom to build chemical complexity and to partake in biochemistry has been affirmed by a host of researchers.

One widely publicized coincidence is the ‘lucky’ fact that the nuclear resonances of the isotopes 12C and 16O are exactly what they need to be if carbon is to be synthesized and accumulate in any quantity in the interior of stars. The energy levels of these resonances ensure that 12C is first synthesized in stellar interiors from collisions between 8Be (beryllium) and He (helium) nuclei and that the carbon synthesized is not depleted later. Hoyle made this discovery in 1953 while working at Caltech with William Fowler. An intriguing aspect of the discovery is that Hoyle made it based on a prediction from the anthropic principle. Hoyle himself
famously commented:

If you wanted to produce carbon and oxygen in roughly equal quantities by stellar nucleosynthesis, these are the two levels you would have to fix, and your fixing would have to be just about where these levels are found to be ... A common sense interpretation of the facts suggests that a superintellect has monkeyed with physics, as well as chemistry and biology and that there are no blind forces worth speaking about in nature.

This discovery was acclaimed not only as a major scientific discovery but also as further evidence of the biocentricity of nature. Hoyle may have been one of the first to notice that the conditions necessary to permit carbon-based life require a very narrow range of basic physical constants, but the idea is now widely accepted. If those constants had been very slightly different, the universe would not have been conducive to the development of matter, astronomical structures, or elemental diversity, and thus the emergence of complex chemical systems.


Oxygen
All oxygen in the Universe is formed along the so-called ‘main line’ sequence from the high-temperature fusion of four 4He atoms in hot stars. 16
Our present atmosphere consists of 78% nitrogen (N2), 21% molecular oxygen (O2), and 1% of other gases, such as carbon dioxide CO2), argon (Ar), and water vapor H2O). An atmosphere containing free oxygen would be fatal to all origin of life schemes. While oxygen is necessary for life, free oxygen would oxidize and thus destroy all organic molecules required for the origin of life. Thus, in spite of much evidence that the earth has always had a significant quantity of free oxygen in the atmosphere, many science papers persist in declaring that there was no oxygen in the earth's early atmosphere. However, this would also be fatal to a naturalistic origin of life. If there were no oxygen there would be no protective layer of ozone surrounding the earth. Ozone is produced by radiation from the sun on the oxygen in the atmosphere, converting the diatomic oxygen(O2) we breathe to triatomic oxygen O3), which is ozone. Thus if there were no oxygen there would be no ozone. The deadly destructive ultraviolet light from the sun would pour down on the surface of the earth unimpeded, destroying those organic molecules required for life, reducing them to simple gases, such as nitrogen, carbon dioxide, and water.  Thus, following is an irresolvable dilemma: in the presence of oxygen, life could not evolve; without oxygen, thus no ozone, life could not evolve or exist. 17

Chlorine
This is a fascinating element that is found in all living tissue.  Chlorine is essential for the function of cleansing the body of debris.  It is also exchanged in the stomach to produce hydrochloric acid, a very necessary acid for protein digestion. Chlorine is a member of a group of elements called the halogens.  Others in this group are fluoride, iodine, and bromine.  The body maintains a delicate balance between all these elements. Today too much chlorine, bromine and fluoride are overwhelming the iodine and causing deficiencies in our bodies. Deficiency of this element is non-existent, unlike all the other electrolytes.  The reason is that chlorine is part of salt (NaCl).  Most people eat too much, rather than too little table salt, as it is found in almost all prepared and processed food items today.  Thus we do not focus on this element in terms of deficiencies. In contrast, excessive exposure to chlorine is a severe problem.  Too much table salt and chlorinated water are the main sources.  Some bleached flour products are also sources.  Environmental contamination of the food, water, and air are constant sources of this element, which is highly toxic in these forms. 3

Hydrogen
The most abundant element in the universe, hydrogen is also a promising source of "clean" fuel on Earth. Named after the Greek words hydro for "water" and genes for "forming," hydrogen makes up more than 90 percent of all of the atoms, which equals three-quarters of the mass of the universe, according to the Los Alamos National Laboratory. Hydrogen is essential for life, and it is present in nearly all the molecules in living things, according to the Royal Society of Chemistry. The element also occurs in the stars and powers the universe through the proton-proton reaction and carbon-nitrogen cycle. 4

Nitrogen
As nitrogen is a biochemically essential element, sources of biochemically accessible nitrogen, especially reduced nitrogen, are critical to prebiotic chemistry and the origin of life. 5
Nitrogen is the fourth most abundant element in cellular biomass, and it comprises the majority of Earth’s atmosphere. 15  The interchange between inert dinitrogen gas (N2 ) in the extant atmosphere and ‘reactive nitrogen’ (those nitrogen compounds that support, or are products of, cellular metabolism and growth) is entirely controlled by microbial activities. 

This was not the case, however, in the primordial atmosphere, when abiotic reactions were the only possible players in the inter-transformation of nitrogen oxides. The extant nitrogen cycle is driven by reductive fixation of dinitrogen and an enzyme inventory that facilitates dinitrogen-producing reactions.

Nitrogen is an essential nutrient for all life on Earth and it acts as a major control on biological productivity in the modern ocean. 14  It forms versatile covalent bonds with carbon that are integral to the functioning of organic biomolecules. A better understanding of the origin of life on Earth, therefore, demands a reconstruction of the biogeochemical nitrogen cycle.  The partial pressure of nitrogen gas (N2) in the atmosphere controls the degree of pressure-broadening of greenhouse gas adsorption and thus surface temperature.  Some nitrogenous gaseous species are powerful greenhouse gases themselves, such as nitrous oxide (N2O) and nitrogen dioxide (NO2)  These gases can also affect climate indirectly by their role in the formation of ozone (O3), which is a powerful greenhouse agent in the troposphere. 

Oxygen of Earth‟s atmosphere and oceans plays a major role in the global biogeochemical nitrogen cycle. 

Loss of atmospheric nitrogen can result in loss of the ability to sustain liquid water on a planetary surface, which would impact planetary habitability and hydrological processes that shape the surface. 12   Nitrogen is a critical ingredient of complex biological molecules 11 The stellar energy fluxes had to be high enough to ignite reactive chemistry that produces complex molecules crucial for life. As a byproduct, this chemistry forms greenhouse gases that can efficiently keep the atmosphere warm enough for liquid water to exist. Molecular nitrogen, however, which was outgassed into the Earth’s early atmosphere, is relatively chemically inert and nitrogen fixation into more chemically reactive compounds requires high temperatures. Possible mechanisms of nitrogen fixation include lightning, atmospheric shock heating by meteorites, and solar ultraviolet radiation.

Nitrogen is one of the essential nutrients of life on Earth, with some organisms, such as the kinds of microbes found within the roots of legume plants, capable of converting nitrogen gas into molecules that other species can use. Nitrogen fixation, as the process is called, involves breaking the powerful chemical bonds that hold nitrogen atoms in pairs in the atmosphere and using the resulting single nitrogen atoms to help create molecules such as ammonia, which is a building block of many complex organic molecules, such as proteins, DNA and RNA. Stüeken developed a model of abiotic nitrogen processes that could have played a role in early Earth. The results showed that such abiotic processes alone could not explain the nitrogen levels seen in the Isua rocks. 

Terrestrial nitrogen isotopic compositions are distinct from solar and cometary values and similar to those of primitive meteorites, so its speculated  that Earth’s atmospheric nitrogen originates from a primordial cosmochemical source. Prebiotic organic compounds containing nitrogen that formed in the solar protoplanetary disk, such as amino acids, would have contributed to the emergence of life on Earth.

Another paper suggested an unusual mechanism to fix nitrogen in the early Earth by lightning discharges occurring inside explosive volcanic clouds containing gases characteristic of Hawaiian volcanoes as a model of Archean volcanic volatiles. 13

Nitrogen speciation in upper mantle fluids and the origin of Earth’s nitrogen-rich atmosphere
19/10/2014
We find that, under the relatively oxidized conditions of Earth’s mantle wedges at convergent plate margins, nitrogen is expected to exist predominantly as N2 in fluids and, therefore, be degassed easily. In contrast, under more reducing conditions elsewhere in the Earth’s upper mantle and in the mantles of Venus and Mars, nitrogen is expected predominantly in the form of ammonium (NH4+) in aqueous fluids. Ammonium is moderately compatible in upper mantle minerals and unconducive to nitrogen degassing. We conclude that Earth’s oxidized mantle wedge conditions—a result of subduction and hence plate tectonics—favour the development of a nitrogen-enriched atmosphere, relative to the primordial noble gases, whereas the atmospheres of Venus and Mars have less nitrogen because they lack plate tectonics  18

Nitrogen could serve as an indicator for an atmosphere thick enough to maintain stable surface water. “If you don’t have a thick enough atmosphere, then the water isn’t stable on the surface. It evaporates into the atmosphere. If we can confirm other planets have a similar amount of nitrogen as the Earth, we can rule that possibility out.” If other habitable terrestrial exoplanets are like the Earth, their atmospheres would be nitrogen-dominated. 21

Abiotic nitrogen reduction on the early Earth
Nature magazine, 24 SEPTEMBER 1998
The production of organic precursors to life depends critically on the form of the reactants. In particular, an environment dominated by N2 is far less efficient in synthesizing nitrogen-bearing organics than a reducing environment rich in ammonia. Relatively reducing lithospheric conditions on the early Earth have been presumed to favor the generation of an ammonia-rich atmosphere, but this hypothesis has not been studied experimentally. Here we demonstrate mineral-catalyzed reduction of N2, NO−2 and NO−3 to ammonia at temperatures between 300 and 800 8C and pressures of 0.1–0.4 GPa—conditions typical of crustal and oceanic hydrothermal systems. We also show that only N2 is stable above 800 8C, thus precluding significant atmospheric ammonia formation during hot accretion. We conclude that mineral-catalysed N2 reduction might have provided a significant source of ammonia to the Hadean ocean. These results also suggest that, whereas nitrogen in the Earth’s early atmosphere was present predominantly as N2, exchange with oceanic, hydrothermally derived ammonia could have provided a significant amount of the atmospheric ammonia necessary to resolve the early-faint-Sun paradox 20

Highly reduced atmosphere composed principally of methane, ammonia and other reduced gases is unlikely. Ammonia, in particular, is unlikely to have been abundant because it is rapidly photolyzed and converted to N2 and H2. The hydrogen escapes to space, leaving stable, triply-bonded N2 as the major nitrogen-bearing gas. UV shielding by hydrocarbon haze appears unable to prevent this from happening.21 To be sure, this result depends on the distribution of particle sizes and so it could change as more sophisticated haze models are developed. (More small particles would cause better UV shielding.) But, for the time being, the models suggest that Miller-Urey type synthesis would not have been an efficient method of making of prebiotic organic compounds. 22
.
Potassium
Potassium is an essential mineral micronutrient and is the main intracellular ion for all types of cells. It is important in maintaining fluid and electrolyte balance in the bodies of humans and animals. Potassium is necessary for the function of all living cells and is thus present in all plant and animal tissues. It is found in especially high concentrations within plant cells, and in a mixed diet, it is most highly concentrated in fruits. The high concentration of potassium in plants, associated with comparatively very low amounts of sodium there, historically resulted in potassium first being isolated from the ashes of plants (potash), which in turn gave the element its modern name. The high concentration of potassium in plants means that heavy crop production rapidly depletes soils of potassium, and agricultural fertilizers consume 93% of the potassium chemical production of the modern world economy.

Potassium, another solvent mineral, and a heart mineral.  It is also essential for regulation of the heartbeat, fluid balance and to maintain blood pressure.  It is also needed for buffering the blood, and cell membrane effects including nerve transmission and muscular contraction.  Deficiency can cause cramps, fatigue and heart irregularities.  Good sources are herring, sardines, halibut, goose, most nuts and seeds, watercress, garlic, lentils, spinach, artichokes, lima beans, Swiss chard, avocados, buckwheat, wheat bran, molasses, and kelp.  Be sure to drink the water in which you cook vegetables to obtain the potassium from the vegetables. [url=http://drlwilson.com/articles/minerals for life.htm]6[/url]

In our universe, potassium-40 is probably the most dangerous light radioactive isotope, yet the one most essential to life. Its abundance must be balanced on a razor’s edge. It must be high enough to help drive plate tectonics but low enough not to irradiate life. 19

Calcium
In view of the importance of calcium (Ca2+) as a universal intracellular regulator, its essential role in cell signaling and communication in many biological Intra and extracellular processes,  it is surprising how little it is mentioned in the origins ( evolution/ID) debate. Most discussions about the origin of life start with RNA worlds versus metabolism-first scenarios, panspermia, hydrothermal vent theory etc. The origin of life cannot be elucidated, without taking into consideration and explaining how the calcium signaling machinery and cell homeostasis appeared. 

Calcium, the structural element, is found mainly in our bones.  Calcium also regulates cell membrane permeability to control nerve impulse transmission and muscle contraction.  It is important for blood clotting, and it regulates hormonal secretion and cell division. Good food sources are dairy products such as cheese and yogurt.  Smaller amounts are in milk, sardines, egg yolks, almonds, sesame seeds, seaweed and dark green vegetables.  Goat cheese is better than cow’s milk cheese for most people because cows are often fed or injected with antibiotics, female hormones, and growth hormones. 6

Molybdenum 
Minerals containing the elements boron and molybdenum are key in assembling atoms into life-forming molecules. 11 The researcher points out that boron minerals help carbohydrate rings to form from pre-biotic chemicals, and then molybdenum takes that intermediate molecule and rearranges it to form ribose, and hence RNA. This raises problems for how life began on Earth, since the early Earth is thought to have been unsuitable for the formation of the necessary boron and molybdenum minerals. It is thought that the boron minerals needed to form RNA from pre-biotic soups were not available on early Earth in sufficient quantity, and the molybdenum minerals were not available in the correct chemical form. "It’s only when molybdenum becomes highly oxidised that it is able to influence how early life formed. "This form of molybdenum couldn’t have been available on Earth at the time life first began, because three billion years ago, the surface of the Earth had very little oxygen. 7

Sulfur
Sulfur, a fiery cleansing and joining mineral.  It is an important element for digestion and detoxification in the liver.  It is needed for the joints and in all connective tissue.  This includes the hair, skin and nails.  Most dietary sulfur comes from sulfur-containing amino acids found mainly in animal protein foods.  Good sources are eggs, meats, and often smelly foods like garlic and onions.  Other sources are kale, watercress, Brussels sprouts, horseradish, cabbage cauliflower, and cranberries. Vegetarians can easily become deficient in sulfur if they do not eat eggs.  Deficiency can affect hair, nails, skin, joints, energy and the ability to detoxify poisons. Today, plenty of organic or usable sulfur is needed to oppose excess copper in the body.  Most people today have too much biounavailable copper in their bodies, and sulfur is needed to help remove it.  Good sources are animal proteins such as eggs, particularly the egg yolk.  [url=http://drlwilson.com/articles/minerals for life.htm]6[/url]

Iron
The origin of life required two processes that dominated: 
(1) the generation of a proton gradient and
(2) linking this gradient to ATP production in part and in part to uptake of essential chemicals and rejection of others. The generation of a proton gradient required especially appropriate amounts of iron (Fe2+), levels for electron transfer and the ATP production depended on controlling H+, Mg2+ and phosphate in the cytoplasm. 8

Iron serves essential functions in both prokaryotes and eukaryotes, and cells have highly specialized mechanisms for acquiring and handling this metal. 
Organisms use a variety of transition metals as catalytic centers in proteins, including iron, copper, manganese, and zinc. Iron is well suited to redox reactions due to its capability to act as both an electron donor and acceptor. In eukaryotic cells, iron is a cofactor for a wide variety of metalloproteins involved in energy metabolism, oxygen binding, DNA biosynthesis and repair, synthesis of biopolymers, cofactors, and vitamins, drug metabolism, antioxidant function, and many others. Because iron is so important for survival, organisms utilize several techniques to optimize uptake and storage to ensure maintenance of sufficient levels for cellular requirements. However, the redox properties of iron also make it extremely toxic if cells have excessive amounts. Free iron can catalyze the formation of reactive oxygen species such as the hydroxyl radical, which in turn can damage proteins, lipids, membranes, and DNA. Cells must maintain a delicate balance between iron deficiency and iron overload that involves coordinated control at the transcriptional, post-transcriptional, and post-translational levels to help fine tune iron utilization and
iron trafficking.  

Iron, the oxygen carrier and an energy mineral as well.  It is required in hemoglobin for transporting oxygen in the blood, for detoxification and for energy production in the cells.  Iron is found in lean meats, organ meats, shellfish, molasses, beans, whole-grain cereals, and dark green vegetables.  Menstruating women and children on poor diets are most commonly low in iron.  For much more information about iron, read Chronic Iron Toxicity.

Magnesium
There are 24  metal and nonmetal elements, that are essential for life, amongst them magnesium, which plays a critical role in cellular metabolism,  DNA repair, its also present in all deoxyribonucleic acid (DNA) and RNA activation processes, stabilizing macromolecular complexes and membranes. As an activator of over 300 different enzymes, magnesium participates in many metabolic processes, such as glycolysis, Krebs cycle, β-oxidation or ion transport across cell membranes. Cells must have mechanisms to maintain physiological levels of Mg2+. It is indispensable for the nucleus ( in eukaryotes ) to function as a whole and for the maintenance of physical stability as well as aggregation of ribosomes into polysomes able to initiate protein synthesis. All these different essential roles elucidate that life could not have had a first go without magnesium.

But in order for the cell to be able to make use of it, Magnesium like other metal ions has to be transported inside cells across the cell membrane by specific membrane proteins.  Three distinct classes of Mg2+ transporters have been identified in bacteria. MgtA transporter proteins can sense magnesium ions down to micromolar concentrations, which is the equivalent to a pinch (1 gram) of magnesium salt in 10,000 liters of water. Wow ! This detection system depends on a specific lipid molecule in the membrane called cardiolipin. MgtA and cardiolipin have to work together in an interdependent manner.

Organisms must maintain physiological levels of Mg2+ because this divalent cation is critical for the stabilization of membranes and ribosomes, the neutralization of nucleic acids, and as a cofactor in a variety of enzymatic reactions. Furthermore, specialized biosynthesis pathways and specialized proteins exist to make these import proteins and cardiolipin.

Magnesium is the bright and shining mineral. Magnesium is named after the Greek city of Magnesia, where large deposits of magnesium carbonate were found centuries ago.  It is required for over 500 enzymes that regulate sugar metabolism, energy production, cell membrane permeability, and muscle and nerve conduction. Foods high in magnesium include milk, almonds, brazil nuts, cashews, whole soybeans (but not tofu, tempeh or soy protein), parsnips, wheat bran, whole grains, green vegetables, seafood, kelp and molasses. Most people need more magnesium than they are eating because food refining strips away magnesium.  Deficiency causes muscle cramps, weakness, depression, and fatigue.  Magnesium works closely with potassium and is a calcium antagonist. 9

Magnesium and magnesium transporters, another example of cell interdependence comes to light
http://reasonandscience.heavenforum.org/t2440-magnesium-and-magnesium-transporters-another-example-of-interdependence-comes-to-light

Phosphate
The short supply of phosphorus poses a significant problem for a naturalistic origin of life because so much of this ingredient is required to make replicator molecules. Phosphates are part of the backbone of both DNA and RNA. A phosphate molecule must accompany every nucleoside in them. Possible precursors to DNA and RNA molecules would seem to require similar phosphate richness. Without life molecules (already assembled and operating), no known natural process can harvest the amounts of phosphorus necessary for life from the environment. All the phosphate-rich deposits on Earth are produced by life.

Phosphorus, the fiercest energy mineral.  It is required for energy production, DNA synthesis, and protein synthesis.  It is also needed for calcium metabolism, muscle contraction, and cell membrane structure. Excellent sources include all meats, along with eggs, fish and other animal proteins.  All proteins have some phosphorus in them.  However, red meats and high purine proteins tend to have the most.  These include organ meats, sardines, and anchovies.  The latter two are not bad fish to eat.  Other fish tend to be too high in mercury to make them good foods for regular use.  Other decent food sources are most nuts and seeds, chickpeas, garlic, lentils, popcorn, soybeans, and some cheeses. Animal-based sources of phosphorus are often absorbed better than grains and beans that contain phytates.  These are phosphorus compounds that are not well-absorbed and that actually interfere with the absorption of calcium, magnesium, and zinc, in particular.  They are found in most grains and beans.  This is why proper cooking and preparation of bread, beans, and other foods is extremely important.  Eating these foods raw eating unleavened bread is not wise for this reason.

Sodium
the volatility and the solvent mineral.  It helps regulate blood pressure, fluid balance, transport of carbon dioxide, and affects cell membrane permeability and other cell membrane functions.  Deficiency causes fatigue and fluid imbalances such as low blood pressure. Food sources include sea salt, seafood, eggs, beet greens, Swiss chard, olives, peas, and butter.  Table salt is a refined junk food.  Most of the minerals have been stripped away, and aluminum is often added as a flowing agent.  Use natural sea salt instead. 

Zinc
It is vital for the functionality of more than 300 enzymes, for the stabilization of DNA, and for gene expression. Helps generate cells Important for growth and brain development Key for immune system Humans need up to 15 mg of zinc per day. Zinc Deficiency is 5th Leading Cause of Death and Disease in the Developing World

Zinc is required for hundreds of enzymes in the human body.  These include the sense of taste and smell, vision, growth, sexual development, digestive enzyme production, male potency, prostate gland health, blood sugar regulation and processing of alcohol.Zinc is very important for the joints, the skin, wound healing, and to prevent birth defects.  Zinc helps prevent diabetes, acne, epilepsy and childhood hyperactivity, and helps detoxify heavy metals.  Adequate zinc has a calming effect and is needed to regenerate all body tissues.Refined food is very low in zinc.   There are very few excellent sources of zinc today.  Among the best are red meats, organ meats and some seafood.  Other sources that are not quite as good are poultry such as chicken and turkey, eggs, wheat, oatmeal, pumpkin and sunflower seeds, wheat germ and colostrum.  
Vegetarians run a high risk of zinc deficiency because they avoid red meats, in most cases.  Low zinc, especially in vegetarians, tends to cause a worsening of copper toxicity.  

Chromium 
a blood sugar mineral .  It is also an energy mineral.  A desert rodent called the sand rat develops diabetes when fed a laboratory diet.  When returned to the desert, the diabetes goes away.  Extensive research indicates the problem with the laboratory food is a lack of chromium.
Chromium is essential to for insulin metabolism.  It can also help lower cholesterol.  Chromium deficiency is very common, especially in middle-aged and older people. Food sources of chromium are brewers yeast, liver, kidney, beef, whole wheat bread, wheat germ, beets, mushrooms and beer. Unfortunately, most of these foods are not recommended for various reasons.  Chromium can be obtained from supplements, and this is usually the best way to make sure you get enough each day.
 
Selenium
 is required for the development of certain higher brain centers.  Selenium is vital for detoxification and for thyroid activity in the human body, among its many functions.  It is also needed for protein synthesis, helps the body get rid of toxic cadmium and mercury, and is needed for antioxidant production (glutathione peroxidase).  As an anti-oxidant, it may help prevent cancer and birth defects.  
 
Lithium
It is also a more advanced spiritual mineral for the future.  It has a calming, balancing and protective effect on the brain and the entire nervous system.  It is found in many natural foods so it is not necessary to supplement it in many cases.  However, anyone who is taking an anti-depressant or any brain-altering drug, or is suffering from any brain-related problem may benefit from a natural lithium supplement such as lithium orotate.  The lithium used by medical doctors for bipolar disorder is quite toxic and should be avoided if at all possible.  The natural product is far less potent, but is better absorbed and much less toxic or perhaps totally non-toxic. 


Cobalt
vitamin B12 mineral.  Cobalt is essential for life as part of the vitamin B12 molecule.  Vitamin B12 is required for the nervous system and blood formation.  It is found in animal products.  Deficiency causes anemia and a very severe dementia that can be irreversible.
Deficiency occurs mainly in strict vegetarians and in those with impaired digestion or any disorder of the stomach.  It is deficient in some elderly people whose stomach does not absorb it very well.

Iodine 
a cleanser and a thyroid mineral (along with manganese).  Iodine, however, it is required for all the cells of the body.  It is somewhat more important for women.  It is needed to make thyroid hormones, and for the regulation of metabolism.  It is important for women’s breast health, cancer prevention and many other body functions in somewhat mysterious ways. 

Boron  
It is very essential for plants, though perhaps less so for human beings.  Boron can help maintain female hormone production and bone integrity. 
 
Silicon
along with selenium, is important for the bones and skin.  Food sources include lettuce, parsnips, asparagus, dandelion greens, rice bran, horseradish, onion, spinach and cucumbers, and in herbs such as horsetail.  Since it is in many foods, supplements are usually not needed.  Silicon and selenium also are both spiritual minerals needed for higher brain activity.
 
Trace minerals often work in pairs or triplets.  The interaction of minerals in the body is a complex and interesting subject.  There are many other trace minerals such as molybdenum, vanadium, bromine, germanium, nickel, tin, cesium, rubidium, strontium, gold, silver, titanium, tritium and others. 10


Functional groups
Biological molecules are constructed from a limited number of elements. Certain functional groups and linkages characterize different types of biomolecules. A familiarity with organic chemistry is useful for recognizing the functional
groups (reactive portions) of molecules as well as the linkages (bonding arrangements) among them, since these features ultimately determine the biological activity of the molecules. Some of the common functional groups
and linkages in biological molecules are shown in figure below:



Essential Molecules for life
Molecules are lifeless. Yet, the properties of living things derive from the properties of molecules. Molecules are lifeless. Yet, in appropriate complexity and number, molecules compose living things. These living systems are distinct from the inanimate world because they have certain extraordinary properties. They can grow, move, perform the incredible chemistry of metabolism, respond to stimuli from the environment, and, most significantly, replicate themselves with exceptional fidelity. The complex structure and behavior of living organisms veil the basic truth that their molecular constitution can be described and understood. The chemistry of the living cell resembles the chemistry of organic reactions. Indeed, cellular constituents, or biomolecules, must conform to the chemical and physical principles that govern all matter. Despite the spectacular diversity of life, the intricacy of biological structures, and the complexity of vital mechanisms, life functions are ultimately interpretable in chemical terms. Chemistry is the logic of biological phenomena. Living organisms are selfsustaining systems of chemical reactions. The most obvious quality of living organisms is that they are complicated and highly organized. Macromolecules themselves show an exquisite degree of organization in their intricate three-dimensional architecture, even though they are composed of simple sets of chemical building blocks, such as sugars and amino acids. Indeed, the complex three-dimensional structure of a macromolecule, known as its conformation, is a consequence of interactions between the monomeric units, according to their individual chemical properties. In biology, it is always meaningful to seek the purpose of observed structures, organizations, or patterns; that is, to ask what functional role they serve within the organism. Maintenance of the highly organized structure and activity of living systems depends on their ability to extract energy from the environment. The ultimate source of energy is the sun. Solar energy flows from photosynthetic organisms (organisms able to capture light energy by the process of photosynthesis) through food chains to herbivores and ultimately to carnivorous predators at the apex of the food pyramid. Living systems have a remarkable capacity for self-replication. Generation after generation, organisms reproduce virtually identical copies of themselves. This selfreplication can proceed by a variety of mechanisms, ranging from simple division in bacteria to sexual reproduction in plants and animals; but in every case, it is characterized by an astounding degree of fidelity.

Cells are biochemical entities that synthesize many thousands of molecules. Studying these chemicals and the biochemistry of the cell would be extremely difficult were it not for the fact that most of the chemical variation is based on six types of molecules that are assembled into just five types of macromolecules. The six basic molecules are

amino acids,
phosphate,
glycerol,
sugars,
fatty acids,
and nucleotides.


            
The stuff of life
• proteins (amino acids)
• lipids (alcohols & fatty acids)
• carbohydrates (sugars)
• nucleic acids (nucleotides)
• small molecules (water, metals, ions, etc.)

all are polymers formed by condensation reactions

Proteins
Proteins are a diverse and abundant class of biomolecules, constituting more than 50% of the dry weight of cells. Their diversity and abundance reflect the central role of proteins in virtually all aspects of cell structure and function. An extraordinary diversity of cellular activity is possible only because of the versatility inherent in proteins, each of which is specifically tailored to its biological role. The pattern by which each is tailored resides within the genetic information of cells, encoded in a specific sequence of nucleotide bases in DNA. Each such segment of encoded information defines a gene, and expression of the gene leads to synthesis of the specific protein encoded by it, endowing the cell with the functions unique to that particular protein. Proteins are the agents of biological function; they are also the expressions of genetic information.

Proteins play critical roles in nearly all life processes. The word protein comes from the Greek proteios (meaning of the first rank), which aptly describes their importance. Proteins account for about 50% of the organic material in a typical animal’s body.



Carbohydrates
Carbohydrates are the single most abundant class of organic molecules found in nature. Energy from the sun captured by green plants, algae, and some bacteria during photosynthesis  converts more than 250 billion kilograms of
carbon dioxide into carbohydrates every day on earth. In turn, carbohydrates are the metabolic precursors of virtually all other biomolecules. Breakdown of carbohydrates provides the energy that sustains animal life. In addition, carbohydrates are covalently linked with a variety of other molecules. These glycoconjugates are important components of cell walls and extracellular structures in plants, animals, and bacteria. In addition to the structural roles such molecules play, they serve in a variety of processes involving recognition between cell types or recognition of cellular structures by other molecules. Recognition events are important in normal cell growth, fertilization, transformation of cells, and other processes. All of these functions are made possible by the characteristic chemical features of carbohydrates. 

Carbohydrates are composed of carbon, hydrogen, and oxygen atoms in or close to the proportions represented by the general formula Cn(H2O)n, where n is a whole number. This formula gives carbohydrates their name—carbon-containing compounds that are hydrated, that is, contain water. Most of the carbon atoms in a carbohydrate are linked to a hydrogen atom and a hydroxyl functional group. However, other functional groups, such as amino and carboxyl groups, are also found in certain carbohydrates. Sugars are relatively small carbohydrates, whereas polysaccharides are large macromolecules.



Claim: Complex Self-replicating Systems Evolved from Simple Molecules.  During a period of chemical evolution, simple organic molecules condensed to form more complex molecules or combined end-to-end as polymers of
repeating units. In a condensation reaction, the elements of water are lost. The rate of condensation of simple compounds to form a stable polymer must therefore be greater than the rate of hydrolysis (splitting by adding the elements of water. In the prebiotic environment, minerals such as clays may have catalyzed polymerization reactions and sequestered the reaction products from water. The size and composition of prebiotic macromolecules
would have been limited by the availability of small molecular starting materials, the efficiency with which they could be joined, and their resistance to degradation.
Answer: Intelligent design literature has sufficiently explained, that a mind is necessary to produce a language and based on it, complex, specified or instructional information or blueprints, which can be used to make specific purposeful artifacts,  or in case of life, a creator had to store the  information contained in DNA to make life ( See the excellent books of Werner Gitt, In the beginning, was information, and Signature in the Cell, Stephen C. Meyer )

https://reasonandscience.catsboard.com/t2718-thermodynamics-and-the-origin-of-life#6120



The-wonders-of-water
https://reasonandscience.catsboard.com/t1532-the-wonders-of-water

1. http://www.icr.org/article/few-reasons-evolutionary-origin-life-impossible/
2. http://thisquantumworld.com/wp/a-critique-of-quantum-mechanics/fine-tuning/
3. http://www.warriormatrix.com/about13509.html&sid=0a2ba2e8e17096632a536b1d8d85f852
4. https://www.livescience.com/28466-hydrogen.html
5. https://www.astrobio.net/news-exclusive/nitrogen-ancient-rocks-sign-early-life/
6. http://drlwilson.com/articles/minerals%20for%20life.htm
7. http://www.universityherald.com/articles/4375/20130829/earth-life-began-mars-red-planet-building-blocks-rna-dna.htm
8. https://link.springer.com/chapter/10.1007/978-3-642-58306-3_1
9. http://www.living-well.info/minerals-for-life/
10. http://drlwilson.com/Articles/MINERALS%20FOR%20LIFE.htm
11. http://sci-hub.hk/https://www.nature.com/articles/ngeo2719
12. http://sci-hub.hk/http://online.liebertpub.com/doi/abs/10.1089/ast.2011.0646?journalCode=ast
13. http://onlinelibrary.wiley.com/doi/10.1029/98GL02423/pdf
14. http://sci-hub.bz/https://www.sciencedirect.com/science/article/pii/S0012825216301829
15. http://www.cell.com/current-biology/pdf/S0960-9822(15)01518-3.pdf
16. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2606772/
17. http://www.icr.org/article/few-reasons-evolutionary-origin-life-impossible/
18. https://drsamimikhail.files.wordpress.com/2014/02/mikhail-sverjenksy-nat-geo.pdf
19. THE PRIVILEGED PLANET, HOW OUR PLACE IN THE COSMOS IS DESIGNED FOR DISCOVERY, Guillermo Gonzalez and Jay W. Richards, page 202
20. https://www.nature.com/articles/26450
21. https://www.astrobio.net/news-exclusive/nitrogen-may-be-a-sign-of-habitability/
22. Prebiotic Evolution and Astrobiology,  page 59
23. http://theuniversalmatrix.com/pt-br/artigos/?tag=evolucao&paged=13

Nucleotides Are the Building Blocks of DNA and RNA
The two classes of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecules store genetic information coded in the sequence of their building blocks. RNA molecules are involved in decoding this information into instructions for linking a specific sequence of amino acids to form a polypeptide. The monomers in DNA must be arranged in a precise way so that the correct code can be read. Like other macromolecules, DNA and RNA are polymers consisting of linear sequences of repeating monomers.  Each monomer, known as a nucleotide, has three components: 

(1) a phosphate group, 
(2) a pentose (five-carbon) sugar (either ribose or deoxyribose), and 
(3) a single or a double ring of carbon and nitrogen atoms known as a base



Water
Water is a major chemical component of the earth’s surface. It is indispensable to life. Indeed, it is the only liquid that most organisms ever encounter. We are prone to take it for granted because of its ubiquity and bland nature, yet we marvel at its many unusual and fascinating properties. At the center of this fascination is the role of water as the medium of life. Organisms are not independent from water. Typically, organisms are 70% to 90% water. Indeed, normal metabolic activity can occur only when cells are at least 65% H2O. This dependency of life on water is not a simple matter, but it can be grasped by considering the unusual chemical and physical properties of H2O. Water and its ionization products, hydrogen ions and hydroxide ions, are critical determinants of the structure and function of many biomolecules, including amino acids and proteins, nucleotides and nucleic acids, and even phospholipids and membranes. In yet another essential role, water is an indirect participant—a difference in the concentration of hydrogen ions on opposite sides of a membrane represents an energized condition essential to biological mechanisms of energy transformation. 

The problems of the origin/source of the elements
1. The origin/source of the elements
2. The origin/source of small molecule precursors
3. The origin/source of monomers
4. The condensation problem
5. The self-replication problem
6. The chirality problem
7. The compartmentalization problem

Elements of life
• nucleic acids (CHOPN)
• proteins (CHOSN)
• lipids (CHO)
• polysaccharides (CHO)
• catalysts (Fe, Mg, Ca, Mn, Ni, Zn, Cu, Se, Co, Mo)
• counterions (Na, K, F, Cl, Br, I)
• neutrals, for clays (Al, Si)

in total, about 22–24 elements:
H, C, N, O, F, Na, Mg, Al, Si, P, S, Cl, K, Ca, Mn, Fe, Co, Ni, Cu, Zn, Se, Br, Mo, I

The five macromolecules are

proteins,
DNA,
RNA,
phospholipids,  
sugar polymers called polysaccharides.

The six basic molecules are used by all cells to construct five essential macromolecules: proteins, RNA, DNA, phospholipids, and polysaccharides. Macromolecules have primary, secondary, and tertiary structural levels. The primary structural level refers to the chain that is formed by linking the building blocks together. The secondary structure involves the bending of the linear chain to form a three-dimensional object. Tertiary structural elements involve the formation of chemical bonds between some of the building blocks in the chain to stabilize the secondary structure. A quaternary structure can also occur when two identical molecules interact to form a dimer or double molecule. Proteins are long chains or polymers of amino acids. The primary structure is held together by peptide bonds that link the carboxyl end of one amino acid to the amino end of a second amino acid. Thus, once constructed, every protein has an amino end and a carboxyl end. An average protein consists of about 400 amino acids.

There are 21 naturally occurring amino acids; with this number, the cell can produce an almost infinite variety of proteins. Eukaryote cells function well with 10,000 to 30,000 different proteins. In addition, this select group of proteins has been conserved (i.e., most of the proteins found in yeast can also be found, in modified form, in humans and other higher organisms). The secondary structure of a protein depends on the amino acid sequence and can be quite complicated, often producing three-dimensional structures possessing multiple functions. RNA is a polymer of the ribonucleotides adenine, uracil, cytosine, and guanine. RNA is generally single-stranded, but it can form localized double-stranded regions by a process known as the complementary base pairing, whereby adenine forms a bond with uracil and cytosine pairs with guanine. RNA is involved in the synthesis of proteins and is a structural and enzymatic component of ribosomes. 5


From DNA to Proteins
Since the structure of DNA was discovered in the early 1950s, progress in cell and molecular biology has been astounding. 1 We now know the complete genome sequences for thousands of different organisms, revealing fascinating details of their biochemistry as well as important clues of adaptation.  Knowing the maximum amount of information that is required to produce a complex organism like ourselves puts constraints on the biochemical and structural features of cells and makes it clear that biology is not infinitely complex. The DNA in genomes does not direct protein synthesis itself, but instead uses RNA as an intermediary. When the cell needs a particular protein, the nucleotide sequence of the appropriate portion of the immensely long DNA molecule in a chromosome is first copied into RNA (a process called transcription). It is these RNA copies of segments of the DNA that are used directly as templates to direct the synthesis of the protein (a process called translation). The flow of genetic information in cells is therefore from DNA to RNA to protein


The central dogma of genetics.
The usual flow of genetic information is from DNA to mRNA to polypeptide. Note: The direction of informational flow shown in this figure is the most common direction found in living organisms, but exceptions occur. For example, RNA viruses and certain transposable elements use an enzyme called reverse transcriptase to make a copy of DNA from RNA.

All cells, from bacteria to humans, express their genetic information in this way—a principle so fundamental that it is termed the central dogma of molecular biology. Despite the universality of the central dogma of molecular biology, there are important variations between organisms in the way in which information flows from DNA to protein. Principal among these is that RNA transcripts in eukaryotic cells are subject to a series of processing steps in the nucleus, including RNA splicing, before they are permitted to exit from the nucleus and be translated into protein. These processing steps can critically change the “meaning” of an RNA molecule and are therefore crucial for understanding how eukaryotic cells read their genome. For many genes, RNA is the final product. Like proteins, some of these RNAs fold into precise three-dimensional structures that have structural and catalytic roles in the cell. Other RNAs  act primarily as regulators of gene expression. But the roles of many noncoding RNAs are not yet known.

One might have predicted that the information present in genomes would be arranged in an orderly fashion, resembling a dictionary or a telephone directory. But it turns out that the genomes of most multicellular organisms are surprisingly disorderly. The genes in these organisms largely consist of a long string of alternating short exons and long introns. Moreover, small bits of DNA sequence that code for protein are interspersed with large blocks of seemingly meaningless DNA. Some sections of the genome contain many genes and others lack genes altogether. Proteins that work closely with one another in the cell often have their genes located on different chromosomes, and adjacent genes typically encode proteins that have little to do with each other in the cell. Decoding genomes is, therefore, no simple matter. Even with the aid of powerful computers, it is difficult for researchers to locate definitively the beginning and end of genes, much less to decipher when and where each gene is expressed in the life of the organism. Yet the cells do this automatically, thousands of times a second.

Much has been learned about how the genetic instructions written in an alphabet of just four “letters”—the four different nucleotides in DNA—direct the formation of an organism. Nevertheless, we still have a great deal to discover about how the information stored in an organism’s genome produces even the simplest unicellular bacterium with 500 genes, let alone how it directs the development of a human with approximately 30,000 genes. An enormous amount of ignorance remains; many fascinating challenges, therefore, await the next generation of researchers.

A cell can change (or regulate) the expression of each of its genes according to its needs—most commonly by controlling the production of its RNA.

The DNA double helix
The determination of the structure of DNA by James Watson and Francis Crick in 1953 is often said to mark the birth of modern molecular biology. The Watson–Crick structure of DNA not only provided a model of what is arguably the central molecule of life, it also suggested the molecular mechanism of heredity. Watson and Crick’s accomplishment, which is ranked as one of science’s major intellectual achievements, was based in part on two pieces of evidence in addition to Chargaff ’s rules: the correct tautomeric forms of the bases and indications that DNA is a helical molecule. Evidence that DNA is a helical molecule was provided by an X-ray diffraction photograph of a DNA fiber taken by Rosalind Franklin. The limited structural information, along with Chargaff ’s rules, provided few clues to the structure of DNA; Watson and Crick’s model sprang mostly from their imaginations and model-building studies. Once the Watson–Crick model had been published, however, its basic simplicity combined with its obvious biological relevance led to its rapid acceptance. Later investigations have confirmed the general validity of the Watson–Crick model, although its details have been modified. The Watson–Crick structure can accommodate any sequence of bases on one polynucleotide strand if the opposite strand has the complementary base sequence. This immediately accounts for Chargaff ’s rules. More importantly, it suggests that each DNA strand can act as a template for the synthesis of its complementary strand and hence that hereditary information is encoded in the sequence of bases on either strand.

The genome is like a computer hard disk, being the  medium that stores the blueprint of the organism through codified information


Francis Crick (right) and James Watson (left) point out features of their model for the structure of DNA.

Computers illustrate the mechanism by which living organisms store information. 1 The blueprint of life. Life uses various code systems, genetic and epigenetic, that is, systems inside the cell, but beside the genome, to instruct the cell how to perform its tasks. Double-stranded molecules of DNA are formed by nucleotides, which use a four-letter alphabet—A, T, C, G—and they are strung together in a long linear sequence that encodes the genetic information, just as the sequence of 1s and 0s encodes the information in a computer file. The DNA code is transcribed and translated, interpreted and deciphered by the Ribosome, or copied to replicate itself.  The mechanisms that make life possible depend on the structure of the double-stranded DNA molecule. Each monomer in a single DNA strand—that is, each nucleotide—consists of a sugar (deoxyribose), a phosphate group attached to it, and a base, which may be either adenine (A), guanine (G), cytosine (C), or thymine (T). Each sugar is linked to the next via the phosphate group, creating a polymer chain composed of a repetitive sugar-phosphate backbone with a series of bases protruding from it. The DNA polymer is extended by adding monomers at one end. For a single isolated strand, these monomers can, in principle, be added in any order, because each one links to the next in the same way, through the part of the molecule that is the same for all of them. In the living cell, however, DNA is not synthesized as a free strand in isolation, but on a template formed by a preexisting DNA strand. The bases protruding from the existing strand bind to bases of the strand being synthesized, according to a strict rule defined by the complementary structures of the bases: A binds to T, and C binds to G. This base-pairing holds fresh monomers in place and thereby controls the selection of which one of the four monomers shall be added to the growing strand next. In this way, a double-stranded structure is created, consisting of two exactly complementary sequences of As, Cs, Ts, and Gs. The two strands twist around each other, forming a DNA double helix.


The components of nucleotides. 
The three building blocks of a nucleotide are one or more phosphate groups, a sugar, and a base. The bases are categorized as purines (adenine and guanine) and pyrimidines (thymine, cytosine, and uracil).







The bonds between the base pairs are weak compared with the sugar-phosphate links, and this allows the two DNA strands to be pulled apart without breakage of their backbones. Each strand then can serve as a template, in the way just described, for the synthesis of a fresh DNA strand complementary to itself—a fresh copy, that is, of the hereditary information. In different types of cells, this process of DNA replication occurs at different rates, with different controls to start it or stop it, and different auxiliary molecules to help it along. But the basics are universal: DNA is the information store for heredity, and templated polymerization is the way in which this information is copied throughout the living world.



The information stored in DNA is transcribed into messenger RNA
In a factory, the engineer makes a blueprint. That blueprint can either be copied to be stored at another place, or sent to the factory and serve to construct the device of the blueprint. In life happens the same.  To carry out its information-bearing function, DNA must do more than copy itself. It must also express its information, by letting the information guide the synthesis of proteins and other molecules in the cell. This expression occurs by a mechanism that is the same in all living organisms, leading first and foremost to the production of  RNAs and proteins. The process begins with a process called transcription, in which segments of the DNA sequence are used as templates for the synthesis of shorter RNA molecules. Later, in the more complex process of translation, many of these RNA molecules direct the synthesis of proteins. In RNA, the backbone is formed of a slightly different sugar from that of DNA—ribose instead of deoxyribose—and one of the four bases is slightly different—uracil (U) in place of thymine (T). But the other three bases—A, C, and G—are the same, and all four bases pair with their complementary counterparts in DNA—the A, U, C, and G of RNA with the T, A, G, and C of DNA. During transcription, the RNA monomers are lined up and selected for polymerization on a template strand of DNA, just as DNA monomers are selected during replication. The outcome is a polymer molecule whose sequence of nucleotides faithfully represents a portion of the cell’s genetic information, even though it is written in a slightly different alphabet—consisting of RNA monomers instead of DNA monomers. The same segment of DNA can be used repeatedly to guide the synthesis of many identical RNA molecules. Thus, whereas the cell’s archive of genetic information in the form of DNA is fixed and sacrosanct, these RNA transcripts are mass-produced and disposable.

RNA Molecules Are Single-Stranded
The first step a cell takes in reading out a needed part of its genetic instructions is to copy a particular portion of its DNA nucleotide sequence—a gene—into an RNA nucleotide sequence (Figure 6–4). The information in RNA, although copied into another chemical form, is still written in essentially the same language as it is in DNA—the language of a nucleotide sequence. Hence the name given to producing RNA molecules on DNA is transcription. Like DNA, RNA is a linear polymer made of four different types of nucleotide subunits linked together by phosphodiester bonds.


A strand of RNA.
This structure is very similar to a DNA strand (see Figure 9.10), except that the sugar is ribose instead of deoxyribose, and uracil is substituted for thymine.

It differs from DNA chemically in two respects: 

(1) the nucleotides in RNA are ribonucleotides—that is, they contain the sugar ribose (hence the name ribonucleic acid) rather than deoxyribose; 
(2) although, like DNA, RNA contains the bases adenine (A), guanine (G), and cytosine (C), it contains the base uracil (U) instead of the thymine (T) in DNA. Since U, like T, can base-pair by hydrogen-bonding with A , the complementary base-pairing properties described for DNA  apply also to RNA (in RNA, G pairs with C, and A pairs with U). 

We also find other types of base pairs in RNA: for example, G occasionally pairs with U. Although these chemical differences are slight, DNA and RNA differ quite dramatically in overall structure. Whereas DNA always occurs in cells as a double-stranded helix, RNA is single-stranded. An RNA chain can therefore fold up into a particular shape, just as a polypeptide chain folds up to form the final shape of a protein. The ability to fold into complex three-dimensional shapes allows some RNA molecules to have precise structural and catalytic functions.

Who had the "good idea" to exchange  Thymine to Uracil? 2



 Figure 1 : The "mystery" of the exchange of uracil ( RNA for thymine (T) in the DNA. Who would have had such foresight, and such a chemical genius? 


One of the nitrogen bases used in RNA  is uracil (U), but this DNA base "appears" exchanged for thymine (T). But why? That question shows to be even more intriguing when we see that thymine and uracil differ only by a methyl more or less, and apparently, this change takes place in a "harmless" position in terms of interactions between bases that are primarily established through hydrogen bonds. Several explanations have been offered,  and today we know that this exchange U/T has an amazing logic. It was apparently a planned strategy with full mastery for any storage system and transmission of information, right from the beginning, accurately and efficiently. The importance of exchanging U/T can also be recognized by the great effort that the cell makes to process it. Such an exchange is made by the cell through the machinery of the cell, and uses a methylation reaction catalyzed by folic acid, which occurs before incorporation of T, and requires one of the nucleotides in DNA.

But why this exchange U/T so " tenue"? Everything indicates today that this exchange has two crucial and specific purposes: The first purpose is to increase the specificity pairing in DNA because it trades U of T, and T is much more selective in its pairing with adenine (A) in the duo A-T, or "Arnold - Timothy". The base U would also make a preferential pairing with A, but not as selectively,  since U can pair also efficiently with all other bases, including itself. This selectivity is best explained if we remember that DNA is made of nucleic acids, phosphates, and sugar molecules which are hydrophilic and - water-soluble - and the addition of a hydrophobic methyl causes it to be repelled from the rest of the DNA, moving it to a specific position on the helice that makes  T bind exclusively with A, increasing the efficiency of DNA to store and transmit information. Methylation which exchanges U with T is, therefore a strategy of increasing the integrity of the information that needs to be at maximum capacity in  DNA. Being an immense and fundamental nanomolecular software,  DNA can't do any wrong, and everything in it seems that was planned to minimize pairing and reading errors. Another reason for methylation and exchange of U/T also seems to relate to the integrity of information. It is known that cytosine (C) in DNA suffers over time, a reaction of deamination, thereby turning slowly into U (Figure 1).

This deamination C generates a  "foreign" U base in  DNA. In RNA, this deamination is not worrisome because  RNA is quickly used and recycled, and there is not enough time to accumulate this "error". But DNA has a lifetime much longer and so this "damage", via natural degradation, becomes critical. And without proper repair, the deamination of C in U would be catastrophic. Who or what designed  DNA, then - blind unguided evolutionary processes or chance ( since there was no evolution prior DNA replication ),  or a intelligent mind - realizing and considering this deadly obstacle, that would cause a point mutation, deleterious, random and frequently, which used his foresight capacity, and solved the problem in two ingenious ways ?  If U would not have been swapped into T in DNA, the cell would not know and recognize what would be a  "legitimate", or an "illegitimate" U, and that U "alien" formed by the degradation of C. But just changing the U of T,  DNA would only be able  to recognize each and every U as" alien ", but how to eliminate it? For this, another ingenious solution was found to create a machinery and a repair enzyme - the "uracil DNA glycosylase"  - that is used specifically to correct this natural, seemingly "inevitable" defect. The exchange of U/T appears well be a spectacle of irreducible complexity associated with brilliant foresight that, according to scientific design detection methods, provides seemingly irrefutable evidence of intelligence that created life. Well, there is another hypothesis, that evolution has created such a process via a 'frozen accident "[frozen accident] or simply chance. Something that would have happened slow, gradual and successively by unguided natural processes. Do you believe in miracles without a saint that  synchronized these miracles? You decide and choose.

The Dilemma of exchanging U/T. Notice here a huge dilemma. Assume now that life started in an event known as "RNA world". Lets put aside for a moment the enormous difficulties encountered to justify the synthesis, catalysis, and transformation in DNA of this "primordial RNA", and imagine - since only imagination seems to work here - that in fact,  RNA gave rise to DNA. But one that uses the same DNA bases of RNA, U and C together, and not T and C as "intelligent DNA" today, it would be "fatal" to Life. As seen, the use of the T in the DNA would cause a catastrophic confusion because the natural deamination of C to T in the DNA-RNA processing would be feasible, evolution would have required, before the DNA-based Life existed,  the foresight of a brilliant providing, a priori, all the U T methylation machinery before replacing such "primordial RNA" into the primordial DNA, and at the same time and in the same "miraculous" place, provide to the "newborn" DNA an efficient mechanism of enzymatic repair replacing U by C. Two chemistry "miracles", and simultaneously would have to occur synchronically. Incidentally, three miracles, because the machinery removed from the hydroxyl of RNA ribose would have to be there too, but running the DNA was degraded too fast, 100 times too fast. And life could not wait for the chance to regain viability. Chance or design?

Transcription Produces RNA Complementary to One Strand of DNA
The RNA in a cell is made by DNA transcription, a process that has certain similarities to the process of DNA replication. Transcription begins with the opening and unwinding of a small portion of the DNA double helix to expose the bases on each DNA strand. One of the two strands of the DNA double helix then acts as a template for the synthesis of an RNA molecule. As in DNA replication, the nucleotide sequence of the RNA chain is determined by the complementary base-pairing between incoming nucleotides and the DNA template.

Overview of Transcription 
One key concept important in the process of transcription is that short base sequences define the beginning and ending of a gene and also play a role in regulating the level of RNA synthesis. The functions of regulatory For genes to be actively transcribed, proteins must recognize particular DNA sequences and act on them in a way that affects the transcription process. At the molecular level, gene expression is the overall process by which the information within a gene is used to produce a functional product, such as a polypeptide.


Organization of sequences of a bacterial gene and its mRNA transcript. 
This figure depicts the general organization of sequences that are needed to create a functional gene that encodes an mRNA.

For a gene to be expressed, a few different types of base sequences perform specific roles. The figure above shows a common organization of base sequences needed to create a structural gene that functions in a bacterium such as
E. coli. Each type of base sequence performs its role during a particular stage of gene expression. For example, the promoter and terminator are base sequences used during gene transcription. Specifically, the promoter provides a site to begin transcription, and the terminator specifies the end of transcription. These two sequences cause RNA synthesis to occur within a defined location. The DNA is transcribed into RNA from the end of the promoter to the terminator. As described later, the base sequence in the RNA transcript is complementary to the template strand of DNA. The opposite strand is the nontemplate strand. For structural genes, the nontemplate strand is also called the coding strand because its sequence is the same as the transcribed mRNA that encodes a polypeptide, except that the DNA has T’s in places where the mRNA contains U’s.

A category of proteins called transcription factors recognizes base sequences in the DNA and controls transcription. Some transcription factors bind directly to the promoter and facilitate transcription. Other transcription factors recognize regulatory sequences, or regulatory elements —short stretches of DNA involved in the regulation of transcription. Certain transcription factors bind to such regulatory sequences and increase the rate of transcription while others inhibit transcription. Base sequences within an mRNA are used during the translation process. In bacteria, a short sequence within the mRNA, the ribosome -binding site, provides a location for the ribosome to bind and begin translation. The bacterial ribosome recognizes this site because it is complementary to a sequence in ribosomal RNA. In addition, mRNA contains a series of codons, read as groups of three nucleotides, which contain the information for a polypeptide’s sequence. The first codon, which is very close to the ribosome-binding site, is the start codon. This is followed by many more codons that dictate the sequence of amino acids within the synthesized polypeptide. Finally, a stop codon signals the end of translation. 

The three stages of transcription are Initiation, Elongation, and Termination
Transcription occurs in three stages: initiation; elongation, or synthesis of the RNA transcript; and termination.


Stages of transcription.
The ability of genes to produce an organism’s traits relies on the molecular process of gene expression. Transcription is the first step in gene expression. During transcription, the gene’s sequence within the DNA is used as a template to make a complimentary copy of RNA.

These steps involve protein-DNA interactions in which proteins such as RNA polymerase, the enzyme that synthesizes RNA, interact with DNA sequences. What causes transcription to begin? The initiation stage in the transcription process is a recognition step. The sequence of bases within the promoter region is recognized by transcription factors. The specific binding of transcription factors to the promoter sequence identifies the starting site for transcription.
Transcription factors and RNA polymerase first bind to the promoter region when the DNA is in the form of a double helix. For transcription to occur, the DNA strands must be separated. This allows one of the two strands to be used as a template for the synthesis of a complementary strand of RNA. This synthesis occurs as RNA polymerase slides along the DNA, forming a small bubble-like structure known as the open promoter complex, or simply as the open complex. Eventually, RNA polymerase reaches a terminator, which causes both RNA polymerase and the newly made RNA transcript to dissociate from the DNA.

RNA Transcripts Have Different Functions
Once they are made, RNA transcripts play different functional roles (Table below ). 



Well over 90% of all genes are structural genes, which are transcribed into mRNA. For structural genes, mRNAs are made first, but the final, functional products are polypeptides that are components of proteins. The remaining types of RNAs described in the Table above are never translated. The RNA transcripts from such nonstructural genes have various important cellular functions. For nonstructural genes, the functional product is the RNA. In some cases, the RNA transcript becomes part of a complex that contains both protein subunits and one or more RNA molecules. Examples of protein-RNA complexes include ribosomes, signal recognition particles, RNaseP, spliceosomes, and telomerase.

Transcription in Bacteria
The first suggestion that RNA is derived from the transcription of DNA was made by Elliot Volkin and Lazarus Astrachan in 1956. In 1960, Matthew Meselson and François Jacob found that proteins are synthesized on ribosomes. One year later, Jacob and his colleague Jacques Monod proposed that a certain type of RNA acts as a genetic messenger (from the DNA to the ribosome) to provide the information for protein synthesis. They hypothesized that this RNA, which they called messenger RNA (mRNA), is transcribed from the sequence within DNA and then directs the synthesis of particular polypeptides. In the early 1960s, this proposal was remarkable, considering that it was made before the actual isolation and characterization of the mRNA molecules in vitro. In 1961, the hypothesis was confirmed by Sydney Brenner in collaboration with Jacob and Meselson. They found that when a virus infects a bacterial cell, a virus-specific RNA is made that rapidly associates with preexisting ribosomes in the cell. Since these pioneering studies, a great deal has been learned about the molecular features of bacterial gene transcription. Much of our knowledge comes from studies of E. coli.


A Promoter Is a short sequence of DNA that is necessary to initiate transcription
The type of DNA sequence known as the promoter gets its name from the idea that it “promotes” gene expression. More precisely, this sequence of bases directs the exact location for the initiation of RNA transcription. Most of the promoter region is located just ahead of or upstream from the site where transcription of a gene actually begins. By convention, the bases in a promoter sequence are numbered in relation to the transcriptional start site (Figure
below ).


The conventional numbering system of promoters
The first nucleotide that acts as a template for transcription is designated +1. The numbering of nucleotides to the left of this spot is in a negative direction, whereas the numbering to the right is in a positive direction. For example, the nucleotide that is immediately to the left of the +1 nucleotide is numbered –1, and the nucleotide to the right of the +1 nucleotide is numbered +2. There is no zero nucleotide in this numbering system. In many bacterial promoters, sequence elements at the –35 and –10 regions play a key role in promoting transcription.

This site is the first base used as a template for RNA transcription and is denoted +1. The bases preceding this site are numbered in a negative direction. No base is numbered zero. Therefore, most of the promoter region is labeled with negative numbers that describe the number of bases preceding the beginning of transcription. Although the promoter may encompass a region several dozen nucleotides in length, short sequence elements are particularly critical for promoter recognition. By comparing the sequence of DNA bases within many promoters, researchers have learned that certain sequences of bases are necessary to create a functional promoter. In many promoters found in E. coli and similar species, two sequence elements are important. These are located at approximately the –35 and –10 sites in the promoter region (see Figure above). The sequence in the top DNA strand at the –35 region is 5ʹ –TTGACA–3ʹ, and the one at the –10 region is 5ʹ–TATAAT–3ʹ. The TATAAT sequence is called the Pribnow box after David Pribnow, who initially discovered it in 1975. The sequences at the –35 and –10 sites can vary among different genes. For example, the Figure below illustrates the sequences found in several different E. coli promoters.


Examples of –35 and –10 sequences within a variety of bacterial promoters. 
This figure shows the –35 and –10 sequences for one DNA strand found in seven different bacterial and bacteriophage promoters. The consensus sequence is shown at the bottom. The spacer regions contain the designated number of nucleotides between the –35 and –10 region or between the –10 region and the transcriptional start site. For example, N17 means there are 17 nucleotides between the end of the –35 region and the beginning of the –10 region.

The most commonly occurring bases within a sequence element form the consensus sequence. This sequence is efficiently recognized by proteins that initiate transcription. For many bacterial genes, a strong correlation is found between the maximal rate of RNA transcription and the degree to which the –35 and –10 regions agree with their consensus sequences.

Bacterial transcription is initiated when RNA Polymerase Holoenzyme binds at a promoter sequence
Thus far, we have considered the DNA sequences that constitute a functional promoter. Let’s now turn our attention to the proteins that recognize those sequences and carry out the transcription process. The enzyme that catalyzes the synthesis of RNA is RNA polymerase . In E. coli, the core enzyme is composed of five subunits, α2ββʹω . The association of a sixth subunit, sigma ( σ) factor, with the core enzyme is referred to as RNA polymerase holoenzyme. The different subunits within the holoenzyme play distinct functional roles. The two α subunits are important in the proper assembly of the holoenzyme and in the process of binding to DNA. The β and βʹ subunits are also needed for binding to the DNA and carry out the catalytic synthesis of RNA. The ω (omega) subunit is important for the proper assembly of the core enzyme. The holoenzyme is required to initiate transcription; the primary role of σ factor is to recognize the promoter. Proteins, such as σ factor, that influence the function of RNA polymerase are types of transcription factors. After RNA polymerase holoenzyme is assembled into its six subunits, it binds loosely to the DNA and then slides along the DNA, much as a train rolls down the tracks. How is a promoter identified? When the holoenzyme encounters a promoter sequence, σ factor recognizes the bases at both the –35 and –10 regions. σ factor protein contains a structure called a helix-turnhelix motif that can bind tightly to these regions. Alpha (α) helices within the protein fit into the major groove of the DNA double helix and form hydrogen bonds with the bases. This phenomenon of molecular recognition is shown in Figure below .


The binding of σ factor protein to the DNA double helix. 
In this example, the protein contains two α helices connected by a turn, termed a helix-turn-helix motif. Two α helices of the protein can fit within the major groove of the DNA. Amino acids within the α helices form hydrogen bonds with the bases in the DNA.

Hydrogen bonding occurs between nucleotides in the –35 and–10 regions of the promoter and amino acid side chains in the helix-turn-helix structure of σ factor. As shown in Figure below, the process of transcription is
initiated when σ factor within the holoenzyme has bound to the promoter region to form the closed complex.


The initiation stage of transcription in bacteria 
The σ factor subunit of the RNA polymerase holoenzyme recognizes the –35 and –10 regions of the promoter. The DNA unwinds in the –10 region to form an open complex, and a short RNA is made. σ factor then dissociates from the holoenzyme, and the RNA polymerase core enzyme can proceed down the DNA to transcribe RNA, forming an open complex as it goes.

For transcription to begin, the double-stranded DNA must then be unwound into an open complex. This unwinding first occurs at the TATAAT sequence in the –10 region, which contains only AT base pairs, as shown in Figure The conventional numbering system of promoters.. AT base pairs form only two hydrogen bonds, whereas GC pairs form three. Therefore, DNA in an AT-rich region is more easily separated because fewer hydrogen bonds must be broken. A short strand of RNA is made within the open complex, and then σ factor is released from the core enzyme. The release of σ factor marks the transition to the elongation phase of transcription. The core enzyme may now slide down the DNA to synthesize a strand of RNA.


The RNA transcript Is synthesized during the elongation stage
After the initiation stage of transcription is completed, the RNA transcript is made during the elongation stage. During the synthesis of the RNA transcript, RNA polymerase moves along the DNA, causing it to unwind (Figure below ).


Synthesis of the RNA transcript

As previously mentioned, the DNA strand used as a template for RNA synthesis is called the template, or antisense, strand. The opposite DNA strand is the coding, or sense, strand; it has the same sequence as the RNA transcript except that T in the DNA corresponds to U in the RNA. Within a given gene, only the template strand is used for RNA synthesis, whereas the coding strand is never used. As it moves along the DNA, the open complex formed by the action of RNA polymerase is approximately 17 bp long. On average, the rate of RNA synthesis is about 43 nucleotides per second! Behind the open complex, the DNA rewinds back into a double helix. As described in the Figure above, the chemistry of transcription by RNA polymerase is similar to the synthesis of DNA via DNA polymerase. RNA polymerase always connects nucleotides in the 5ʹ to 3ʹ direction. During this process, RNA polymerase catalyzes the formation of a bond between the 5ʹ phosphate group on one nucleotide and the 3ʹ–OH group on the previous nucleotide. The complementarity rule is similar to the AT/GC rule, except that uracil substitutes for thymine
in the RNA. In other words, RNA synthesis obeys an ADNA-URNA/ TDNA-ARNA/GDNA-CRNA/CDNA-GRNA rule. When considering the transcription of multiple genes within a chromosome, the direction of transcription and the
DNA strand used as a template varies among different genes. The figure below shows three genes adjacent to each other within a chromosome.


The transcription of three different genes found in the same chromosome 
RNA polymerase synthesizes each RNA transcript in a 5ʹ to 3ʹ direction, sliding along a DNA template strand in a 3ʹ to 5ʹ direction. However, the use of the template strand varies from gene to gene. For example, genes A and B use the bottom strand, but gene C uses the top strand.

Genes A and B are transcribed from left to right, using the bottom DNA strand as a template. By comparison, gene C is transcribed from right to left and uses the top DNA strand as a template. Note that in all three cases, the template strand is read in the 3ʹ to 5ʹ direction, and the synthesis of the RNA transcript occurs in a 5ʹ to 3ʹ direction.

Transcription Is terminated by either an RNA-binding protein or an intrinsic terminator
The end of RNA synthesis is referred to as termination. Prior to termination, the hydrogen bonding between the DNA and RNA within the open complex is of central importance in preventing dissociation of RNA polymerase from the template strand. Termination occurs when this short RNA-DNA hybrid region is forced to separate, thereby releasing RNA polymerase as well as the newly made RNA transcript. In E. coli, two different mechanisms for termination have been identified. For certain genes, an RNA-binding protein known as ρ (rho) is responsible for terminating transcription, in a mechanism called ρ-dependent termination. For other genes, termination does not require the involvement of the ρ protein. This is referred to as ρ-independent termination. In ρ-dependent termination, the termination process requires two components. First, a sequence upstream from the terminator, called the rut site for rho utilization site, acts as a recognition site for the binding of the ρ protein (Figure below ).


ρ-Dependent termination

How does ρ protein facilitate termination? The ρ protein functions as a helicase, an enzyme that can separate RNA-DNA hybrid regions. After the rut site is synthesized in the RNA, ρ protein binds to the RNA and moves in the direction of RNA polymerase. The second component of ρ-dependent termination is the site where termination actually takes place. At this terminator site, the DNA encodes an RNA sequence containing several GC base pairs that form a stem-loop structure. RNA synthesis terminates several nucleotides beyond this stem-loop. A stem-loop structure, also called a hairpin, can form due to complementary sequences within the RNA. This stem-loop forms almost immediately after the RNA sequence is synthesized and quickly binds to RNA polymerase. This binding results in a conformational change that causes RNA polymerase to pause in its synthesis of RNA. The pause allows ρ protein to catch up to the stem-loop, pass through it, and break the hydrogen bonds between the DNA and RNA within the open complex. When this occurs, the completed RNA strand is separated from the DNA along with RNA polymerase. Let’s now turn our attention to ρ-independent termination, a process that does not require the ρ protein. In this case, the terminator is composed of two adjacent nucleotide sequences that function within the RNA (Figure below ).


ρ-Independent or intrinsic termination
When RNA polymerase reaches the end of the gene, it transcribes a uracil-rich sequence. As this uracil-rich sequence is transcribed, stem-loop forms just upstream from the open complex. The formation of this stem-loop causes RNA polymerase to pause in its synthesis of the transcript. This pausing is stabilized by NusA, which binds near the region where RNA exits the open complex. While it is pausing, the RNA in the RNA-DNA hybrid is a uracil-rich sequence. Because hydrogen bonds between U and A are relatively weak interactions, the transcript and RNA polymerase dissociates from the DNA.

One is a uracilrich sequence located at the 3ʹ end of the RNA. The second sequence is adjacent to the uracil-rich sequence and promotes the formation of a stem-loop structure. As shown in above Figure, the formation of the stem-loop causes RNA polymerase to pause in its synthesis of RNA. This pausing is stabilized by other proteins that bind to RNA polymerase. For example, a protein called NusA, which is bound to RNA polymerase, promotes pausing at stemloop sequences. At the precise time, RNA polymerase pauses, the uracil-rich sequence in the RNA transcript is bound to the DNA template strand. As previously mentioned, the hydrogen bonding of RNA to DNA keeps RNA polymerase clamped onto the DNA. However, the binding of this uracil-rich sequence to the DNA template strand is relatively weak, causing the RNA transcript to spontaneously dissociate from the DNA and cease further transcription. Because this process does not require a protein (the ρ protein) to physically remove the RNA transcript from the DNA, it is also referred to as intrinsic termination. In E. coli, about half of the genes show intrinsic termination, and the other half are terminated by ρ protein.

Transcription in eukaryotes 
Many of the basic features of gene transcription are very similar in bacterial and eukaryotic species. Much of our understanding of transcription has come from studies in Saccharomyces cerevisiae (baker’s yeast) and other eukaryotic species, including mammals. In general, gene transcription in eukaryotes is more complex than that of their bacterial counterparts. Eukaryotic cells are larger and contain a variety of compartments known as organelles. This added level of cellular complexity dictates that eukaryotes contain many more genes encoding cellular proteins. In addition, most eukaryotic species are multicellular, being composed of many different cell types. Multicellularity adds the requirement that genes be transcribed in the correct type of cell and during the proper stage of development. Therefore, in any given species, the transcription of the thousands of different genes that an organism possesses requires appropriate timing and coordination. An important factor that affects eukaryotic gene transcription is chromatin structure. Eukaryotic gene transcription requires changes in the positions and structures of nucleosomes.

Eukaryotes have multiple RNA Polymerases that are structurally similar to the bacterial enzyme
The genetic material within the nucleus of a eukaryotic cell is transcribed by three different RNA polymerase enzymes, designated RNA polymerase I, II, and III. What are the roles of these enzymes? Each of the three RNA polymerases transcribes different categories of genes. RNA polymerase I transcribes all of the genes that encode ribosomal RNA (rRNA) except for the 5S rRNA. RNA polymerase II plays a major role in cellular transcription because it transcribes all of the structural genes. It is responsible for the synthesis of all mRNA and also transcribes certain snRNA genes, which are needed for pre-mRNA splicing. RNA polymerase III transcribes all tRNA genes and the 5S rRNA gene. All three RNA polymerases are structurally very similar and are composed of many subunits. They contain two large catalytic subunits similar to the β and βʹ subunits of bacterial RNA polymerase. The structures of RNA polymerase from a few different species have been determined by X-ray crystallography. A remarkable similarity exists between the bacterial enzyme and its eukaryotic counterparts. Figure a below compares the structures of a bacterial RNA polymerase with RNA polymerase II from yeast.


Structure and molecular function of RNA polymerase. 
(a) A comparison of the crystal structures of a bacterial RNA polymerase (left) to a eukaryotic RNA polymerase II (right). The bacterial enzyme is from Thermus aquaticus. The eukaryotic enzyme is from Saccharomyces cerevisiae. 
(b) A mechanism for transcription based on the crystal structure. In this diagram, the direction of transcription is from left to right. The double-stranded DNA enters the polymerase along a bridge surface that is between the jaw and clamp. At a region termed the wall, the RNA-DNA hybrid is forced to make a right-angle turn, which enables nucleotides to bind to the template strand. Mg2+ is located at the catalytic site. Nucleoside triphosphates (NTPs) enter the catalytic site via a pore region and bind to the template DNA. At the catalytic site, the nucleotides are covalently attached to the 3ʹ end of the RNA. As RNA polymerase slides down the template, a small region of the protein termed the rudder separates the RNA-DNA hybrid. The single-stranded RNA then exits under a small lid.

DNA enters the enzyme through the jaw and lies on a surface within RNA polymerase termed the bridge. The part of the enzyme called the clamp is thought to control the movement of the DNA through RNA polymerase. A wall in the enzyme forces the RNA-DNA hybrid to make a right-angle turn. This bend facilitates the ability of nucleotides to bind to the template strand. Mg2+ is located at the catalytic site, which is precisely at the 3ʹ end of the growing RNA strand. Nucleoside triphosphates (NTPs) enter the catalytic site via a pore region. The correct nucleotide binds to the template DNA and is covalently attached to the 3ʹ end. As RNA polymerase slides down the template, a rudder, which is about 9 bp away from the 3ʹ end of the RNA, forces the RNA-DNA hybrid apart. The single-stranded RNA then exits under a small lid.

Eukaryotic structural genes have a core promoter and regulatory elements
In eukaryotes, the promoter sequence is more variable and often more complex than that found in bacteria. For structural genes, at least three features are found in most promoters: regulatory elements, a TATA box, and a transcriptional start site. The figure below shows a common pattern of sequences found within the promoters of eukaryotic structural genes.


A common pattern found for the promoter of structural genes recognized by RNA polymerase II 
The start site usually occurs at adenine; two pyrimidines (Py: cytosine or thymine) and a cytosine precede this adenine, and five pyrimidines (Py) follow it. A TATA box is approximately 25 bp upstream. However, the sequences that constitute eukaryotic promoters are quite diverse, and not all structural genes have a TATA box. Regulatory elements, such as GC or CAAT boxes, vary in their locations but are often found in the –50 to –100 region. The core promoters for RNA polymerase I and III are quite different. A single upstream regulatory element is involved in the binding of RNA polymerase I to its promoter, whereas two regulatory elements, called A and B boxes, facilitate the binding of RNA polymerase III.

The core promoter is a relatively short DNA sequence that is necessary for transcription to take place. It consists of a TATAAA sequence called the TATA box and the transcriptional start site, where transcription begins. The TATA box, which is usually about 25 bp upstream from a transcriptional start site, is important in determining the precise starting point for transcription. If it is missing from the core promoter, the transcription start site point becomes undefined, and transcription may start at a variety of different locations. The core promoter, by itself, produces a low level of transcription. This is termed basal transcription. Regulatory elements are short DNA sequences that affect the ability of RNA polymerase to recognize the core promoter and begin the process of transcription. These elements are recognized by transcription factors—proteins that bind to regulatory elements and influence the rate of transcription. There are two categories of regulatory elements. Activating sequences, known as enhancers, are needed to stimulate transcription. In the absence of enhancer sequences, most eukaryotic genes have very low levels of basal transcription. Under certain conditions, it may also be necessary to prevent transcription of a given gene. This occurs via silencers—DNA sequences that are recognized by transcription factors that inhibit transcription. As seen in Figure above, a common location for regulatory elements is the –50 to –100 region. However, the locations of regulatory elements vary considerably among different eukaryotic genes. These elements can be far away from the core promoter yet strongly influence the ability of RNA polymerase to initiate transcription. DNA sequences such as the TATA box, enhancers, and silencers exert their effects only over a particular gene. They are called cis-acting elements. The term cis comes from chemistry nomenclature meaning “next to.” Cis-acting elements, though possibly far away from the core promoter, are always found within the same chromosome as the genes they regulate. By comparison, the regulatory transcription factors that bind to such elements are called trans-acting factors (the term trans means “across from”). The transcription factors that control the expression of a gene are themselves encoded by genes; regulatory genes that encode transcription factors may be far away from the genes they control. When a gene encoding a trans-acting factor is expressed, the transcription factor protein that is made can diffuse throughout the cell and bind to its appropriate cis-acting element.

Transcription of eukaryotic structural genes is initiated when RNA Polymerase II and general transcription factors bind to a promoter sequence
Thus far, we have considered the DNA sequences that play a role in the promoter region of eukaryotic structural genes. By studying transcription in a variety of eukaryotic species, researchers have discovered that three categories of proteins are needed for basal transcription at the core promoter: RNA polymerase II, general transcription factors, and mediator (Table below ).



Five different proteins called general transcription factors (GTFs) are always needed for RNA polymerase II to initiate transcription of structural genes. Figure below describes the assembly of GTFs and RNA polymerase II at the TATA box. 


Steps leading to the formation of the open complex

As shown here, a series of interactions lead to the formation of the open complex. Transcription factor IID (TFIID) first binds to the TATA box and thereby plays a critical role in the recognition of the core promoter. TFIID is composed of several subunits, including TATA-binding protein (TBP), which directly binds to the TATA box, and several other proteins called TBP-associated factors (TAFs). After TFIID binds to the TATA box, it associates with TFIIB. TFIIB promotes the binding of RNA polymerase II and TFIIF to the core promoter. Lastly, TFIIE and TFIIH bind to the complex. This completes the assembly of proteins to form a closed complex, also known as a preinitiation complex. TFIIH plays a major role in the formation of the open complex. TFIIH has several subunits that perform different functions. Certain subunits act as helicases, which break the hydrogen bonding between the double-stranded DNA and thereby promote the formation of the open complex. Another subunit hydrolyzes ATP and phosphorylates a domain in RNA polymerase II known as the carboxyl terminal domain (CTD). Phosphorylation of the CTD releases the contact between RNA polymerase II and TFIIB. Next, TFIIB, TFIIE, and TFIIH dissociate, and RNA polymerase II is free to proceed to the elongation stage of transcription. In vitro, when researchers mix together TFIID, TFIIB, TFIIF, TFIIE, TFIIH, RNA polymerase II, and a DNA sequence containing a TATA box and transcriptional start site, the DNA is transcribed into RNA. Therefore, these components are referred to as the basal transcription apparatus. In a living cell, however, additional components regulate transcription and allow it to proceed at a reasonable rate. In addition to GTFs and RNA polymerase II, another component required for transcription is a large protein complex termed mediator. This complex was discovered by Roger Kornberg and colleagues in 1990. In 2006, Kornberg was awarded the Nobel Prize in chemistry for his studies regarding the molecular basis of eukaryotic transcription. Mediator derives its name from the observation that it mediates interactions between RNA polymerase II and regulatory transcription factors that bind to enhancers or silencers. It serves as an interface between RNA polymerase II and many diverse regulatory signals. The subunit composition of mediator is quite complex and variable. The core subunits form an elliptically shaped complex that partially wraps around RNA polymerase II. Mediator itself may phosphorylate the CTD of RNA polymerase II, and it may regulate the ability of TFIIH to phosphorylate the CTD. Therefore, it can play a pivotal role in the switch between transcriptional initiation and elongation.

Transcriptional termination of RNA Polymerase II occurs after the 3ʹ end of the transcript is cleaved near the PolyA signal sequence
Eukaryotic pre-mRNAs are modified by cleavage near their 3ʹ end and the subsequent attachment of a string of adenine nucleotides. This processing, which is called polyadenylation, requires a polyA signal sequence that directs the cleavage of the pre-mRNA. Transcription via RNA polymerase II typically terminates about 500 to 2000 nucleotides downstream from the polyA signal.
Figure below shows a simplified scheme for the transcriptional termination of RNA polymerase II.


Possible mechanisms for transcriptional termination of RNA polymerase II.

After RNA polymerase II has transcribed the polyA signal sequence, the RNA is cleaved just downstream from this sequence. This cleavage occurs before transcriptional termination. Two models have been proposed for transcriptional termination. According to the allosteric model, RNA polymerase II becomes destabilized after it has transcribed the polyA signal sequence, and it eventually dissociates from the DNA. This destabilization may be caused by the loss of proteins that function as elongation factors or by the binding of proteins that function as termination factors. A second model, called the torpedo model, suggests that RNA polymerase II is physically removed from the DNA. According to this model, the region of RNA that is downstream from the polyA signal sequence is cleaved by an exonuclease that degrades the transcript in the 5ʹ to 3ʹ direction. When the exonuclease catches up to RNA polymerase II, this causes RNA polymerase II to dissociate from the DNA. Which of these two models is correct? Additional research is needed, but the results of studies over the past few years have provided evidence that the two models are not mutually exclusive. Therefore, both mechanisms may play a role in transcriptional termination.

1. Molecular biology of the cell, 6th edition, page 299
2. https://www.widbook.com/ebook/chapters/life-and-the-universe-by-intelligent-design
3. http://sphweb.bumc.bu.edu/otlt/MPH-Modules/PH/DNA-Genetics/DNA-Genetics3.html
4. GENETICS: ANALYSIS & PRINCIPLES, FOURTH EDITION, page 336
5. Fundamentals of  Biochemistry, fourth edition, page 45

Lipids
Lipids are a class of biological molecules defined by low solubility in water and high solubility in nonpolar solvents. As molecules that are largely hydrocarbon in nature, lipids represent highly reduced forms of carbon and, upon oxidation in metabolism, yield large amounts of energy. Lipids are thus the molecules of choice for metabolic energy storage. Lipid molecules are key components of membranes and also serve a myriad of roles as signal molecules in biological systems. Lipids are integrators of cellular function and intercellular communication. Lipid–lipid and lipid–protein interactions regulate cellular physiology.

Lipids are hydrophobic molecules composed mainly of hydrogen and carbon atoms, and some oxygen. The defining feature of lipids is that they are nonpolar and therefore insoluble in water. Lipids account for about 40% of the organic matter in the average human body and include fats, phospholipids, steroids, and waxes.

Nucleic Acids
Nucleotides and nucleic acids are substances that contain nitrogen bases (aromatic cyclic groups possessing nitrogen atoms) as part of their structure. Nucleotides are essential to cellular metabolism, and nucleic acids are the molecules of genetic information storage and expression. Nucleotides are biological molecules that possess a heterocyclic nitrogenous base, a five-carbon sugar (pentose), and phosphate as principal components of their structure. The biochemical roles of nucleotides are numerous; they participate as essential intermediates in virtually all aspects of cellular metabolism. Serving an even more central biological purpose are the nucleic acids, the elements of heredity and the agents of genetic information transfer. Just as proteins are linear polymers of amino acids, nucleic acids are linear polymers of nucleotides. Like the letters in this sentence, the orderly sequence of nucleotide residues in a nucleic acid can encode information. The two basic kinds of nucleic acids are deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). The five-carbon sugar in DNA is 2-deoxyribose; in RNA, it is ribose.  DNA is the repository of genetic information in cells, whereas RNA serves in the expression of this information through the processes of transcription and translation. An interesting exception to this rule is that some viruses have their genetic information stored as RNA. This chapter describes the chemistry of nucleotides and the major classes of nucleic acids.

Nucleic acids account for only about 2% of the weight of animals like humans, yet these molecules are extremely important because they are responsible for the storage, expression, and transmission of genetic information. The expression of genetic information in the form of specific proteins determines whether an organism is a human, a frog, an onion, or a bacterium.

RNA modification
During the 1960s and 1970s, studies in bacteria established the physical structure of the gene. The analysis of bacterial genes showed that the sequence of DNA within the coding strand corresponds to the sequence of nucleotides in the mRNA, except that T is replaced with U. During translation, the sequence of codons in the mRNA is then read, providing the instructions for the correct amino acid sequence in a polypeptide. The one-toone correspondence between the sequence of codons in the DNA coding strand and the amino acid sequence of the polypeptide has been termed the colinearity of gene expression. The situation dramatically changed in the late 1970s, when the tools became available to study eukaryotic genes at the molecular level. The scientific community was astonished by the discovery that eukaryotic structural genes are not always colinear with their functional mRNAs. Instead, the coding sequences within many eukaryotic genes are separated by DNA sequences that are not translated into protein. The coding sequences are found within exons, which are regions that are contained within mature RNA. By comparison, the sequences that are found between the exons are called intervening sequences, or introns. During transcription, an RNA is made corresponding to the entire gene sequence. Subsequently, as it matures, the sequences in the RNA that correspond to the introns are removed and the exons are connected, or spliced, together. This process is called RNA splicing. Since the 1970s, research has revealed that splicing is a common genetic phenomenon in eukaryotic species. Splicing occurs occasionally in bacteria as well. Aside from splicing, research has also shown that RNA transcripts can be modified in several other ways. Table below describes the general types of RNA modifications.


For example, rRNAs and tRNAs are synthesized as long transcripts that are processed into smaller functional pieces. In addition, most eukaryotic mRNAs have a cap attached to their 5ʹ end and a tail attached at their 3ʹ end. In this section, we will examine the molecular mechanisms that account for several types of RNA modifications and consider why they are functionally important.

Messenger RNA is translated in the Ribosome to make proteins
How the information in DNA specifies the production of proteins was a complete mystery in the 1950s when the double-stranded structure of DNA was first revealed as the basis of heredity. But in the intervening years, scientists discovered the complex mechanisms involved. The translation of genetic information from the 4-letter alphabet of polynucleotides into the 20-letter alphabet of proteins is done by the Ribosome. The rules of this translation seem in some respects neat and rational but in other respects strangely arbitrary, given that they are (with minor exceptions) identical in all living things. These arbitrary features have not found a better explanation as a "frozen accident". It turns out that the information in the sequence of a messenger RNA molecule is read out in groups of three nucleotides at a time: each triplet of nucleotides, or codon, specifies (codes for) a single amino acid in a corresponding protein. Since the number of distinct triplets that can be formed from four nucleotides is 43, there are 64 possible codons, all of which occur in nature. However, there are only 20 naturally occurring amino acids. That means there are necessarily many cases in which several codons correspond to the same amino acid. This genetic code is read out by a special class of small RNA molecules, the transfer RNAs (tRNAs).

Each Protein Is Encoded by a Specific Gene
DNA molecules are normally very large, specifying thousands of proteins. Special sequences of start and stop codons in the DNA serve to define where the instructions to make each protein starts and ends. And individual segments of the long DNA sequence are transcribed into separate mRNA molecules, coding for a variety of proteins. Each such DNA segment represents one gene. A remarkable fact is that RNA molecules transcribed from the same DNA segment can often be spliced by a molecular machine named spliceosome, and expressed in more than one way, so as to give rise to a set of different versions of proteins, especially in more complex eukaryotic cells. In addition, some DNA segments—a smaller number— commonly held as Junk DNA, are transcribed into RNA molecules that are not translated but have catalytic, regulatory, or structural functions; such DNA segments also count as genes. A gene, therefore, is defined as the segment of DNA sequence corresponding to a single protein or set of alternative protein variants or to a single catalytic, regulatory, or structural RNA molecule. In all cells, the expression of individual genes is regulated: instead of manufacturing its full repertoire of possible proteins at full tilt all the time, the cell adjusts the rate of transcription and translation of different genes independently, according to need. Stretches of regulatory DNA are interspersed among the segments that code for protein, and these noncoding regions bind to special protein molecules that control the local rate of transcription. The quantity and organization of the regulatory DNA vary widely from one class of organisms to another, but the basic strategy is universal. In this way, the genome of the cell—that is, the totality of its genetic information as embodied in its complete DNA sequence— dictates not only the nature of the cell’s proteins, but also when and where they are to be made.



How is the code translated?

One can think of the sequence of bases on mRNA as a series of code letters that are read as a series of three-letter "words." 3

For example, if mRNA had a sequence of bases such as

"...AUGAAGCCGAGUUAAGAU...."

This sequence would, in effect, be read as a series of three-letter words referred to as "codons", each of which specified the insertion of a specific amino acid. In the example just above, the codons or "words" would be:

"...AUG-AAG-CCG-AGU-UAA-GAU...."

Each of these three letter words specifies the insertion of one of the 20 amino acids that make up proteins. The amino acids are shuttled to the ribosome by a family of transfer RNAs (tRNA), and there are specific tRNAs for each amino acid. The tRNAs consist of a single strand of RNA, but the strand tends to fold back on itself and create loops that are held in place by hydrogen bonds between segments of the tRNA as shown in the illustration below.



In the illustration above the base sequence CAT on DNA was transcribed to become the codon GUA on messenger RNA. The mRNA left the nucleus and attached to a ribosome where protein synthesis (translation) was initiated. Each codon on mRNA specified a particular amino acid to be added to the growing protein chain. In this example, the first four amino acids are designated as "AA1-AA2-AA3-AA4". The next codon on mRNA was "GUA." The complement to GUA is "CAU" which is the anticodon on a transfer RNA that carries the amino acid valine. The anticodon CAU on the tRNA for valine bonded to the GUA codon on mRNA. This positioned valine as the next amino acid in sequence, and with the addition of cellular energy (ATP), valine became covalently bonded to AA4 in the amino acid chain.

In the section above on transcription, we focused on creating the mRNA for a specific gene; those events took place in the cell nucleus. The figure below illustrates the subsequent events that take place after mRNA leaves the nucleus and attaches to a ribosome and initiates translation.



Sixty-one codons specify an amino acid, and the remaining three act as stop signals for protein synthesis. For example, the codon UGA signals an end to synthesis of the protein. The code for all possible three-letter codons on mRNA is shown in the blue table below. Note that there is some redundancy in the code. For example, there are four separate codons for the amino acid proline. Nevertheless, the code is unambiguous, because no triplet codes for more than one amino acid. In addition, with only a few minor exceptions, the same code is universally found in viruses, bacteria, protists, plants, fungi, and animals. Note that in the example below, UGA, is a signal to STOP, meaning that the amino acid chain is complete and no more amino acids are to be added. Bear in mind that these illustrations include just short sequences of codons, and an actual protein would generally have a much longer sequence. Nevertheless, these examples illustrated how the code is transcribed from DNA to mRNA and how the mRNA is then translated in order to specify the sequence of amino acids in a particular protein which is the product of that particular gene on a chromosome.



Each type of tRNA becomes attached at one end to a specific amino acid, and displays at its other end a specific sequence of three nucleotides—an anticodon— that enables it to recognize, through base-pairing, a particular codon or subset of codons in mRNA. The intricate chemistry that enables these tRNAs to translate a specific sequence of A, C, G, and U nucleotides in a mRNA molecule into a specific sequence of amino acids in a protein molecule occurs on the ribosome, a large multimolecular machine composed of both protein and ribosomal RNA.

During translation, the Genetic Code within mRNA is used to make a Polypeptide with a Specific Amino Acid sequence 4 
Why have researchers named this process translation? At the molecular level, translation involves an interpretation of one language—the language of mRNA, a nucleotide sequence—into the language of proteins—an amino acid sequence. The ability of mRNA to be translated into a specific sequence of amino acids relies on the genetic code. The sequence of bases within an mRNA molecule provides coded information that is read in groups of three nucleotides known as codons. 


The relationships among the DNA coding sequence, mRNA codons, tRNA anticodons, and amino acids in a polypeptide. The sequence of nucleotides within DNA is transcribed to make a complementary sequence of nucleotides within mRNA. This sequence of nucleotides in mRNA is translated into a sequence of amino acids of a polypeptide. tRNA molecules act as intermediates in this translation process.

The sequence of three bases in most codons specifies a particular amino acid. These codons are termed sense codons. For example, the codon AGC specifies the amino acid serine, whereas the codon GGG encodes the amino acid glycine. The codon AUG, which specifies methionine, is used as a start codon; it is usually the first codon that begins a polypeptide sequence. The AUG codon can also be used to specify additional methionines within the coding sequence. Finally, three codons are used to end the process of translation. These are UAA, UAG, and UGA, which are known as stop codons. They are also known as termination or nonsense codons. The codons in mRNA are recognized by the anticodons in transfer RNA (tRNA) molecules (see Figure 13.3). Anticodons are three-nucleotide sequences that are complementary to codons in mRNA. The tRNA molecules carry the amino acids that correspond
to the codons in the mRNA. In this way, the order of codons in mRNA dictates the order of amino acids within a polypeptide. The details of the genetic code are shown below .


Because polypeptides are composed of 20 different kinds of amino acids, a minimum of 20 codons is needed in order to specify each type. With four types of bases in mRNA (A, U, G, and C), a genetic code containing two bases in a codon would not be sufficient because it would only have 42, or 16, possible types. By comparison, a three-base codon system can specify 43, or 64, different codons. Because the number of possible codons exceeds 20—which is the number of different types of amino acids—the genetic code is termed degenerate . This means that more than one codon can specify the same amino acid. For example, the codons GGU, GGC, GGA, and GGG all specify the amino acid glycine. Such codons are termed synonymous codons. In most instances, the third base in the codon is the base that varies. The third base is sometimes referred to as the wobble base. This term is derived from the idea that the complementary base in the tRNA can “wobble” a bit during the recognition of the third base of the codon in mRNA. The start codon (AUG) defines the reading frame of an mRNA—a sequence of codons determined by reading bases in groups of three, beginning with the start codon. This concept is best understood with a few examples. 

The mRNA sequence shown below encodes a short polypeptide with 7 amino acids:

5ʹ–AUGCCCGGAGGCACCGUCCAAU–3ʹ
Met–Pro–Gly–Gly–Thr–Val–Gln

If we remove one base (C) adjacent to the start codon, this changes the reading frame to produce a different polypeptide sequence:
5ʹ–AUGCCGGAGGCACCGUCCAAU–3ʹ
Met–Pro–Glu–Ala–Pro–Ser–Asn

Alternatively, if we remove three bases (CCC) next to the start codon, the resulting polypeptide has the same reading frame as the first polypeptide, though one amino acid (Pro, proline) has been deleted:

5ʹ–AUGGGAGGCACCGUCCAAU–3ʹ
Met–Gly–Gly–Thr–Va l – G l n

Polypeptide synthesis has a directionality that parallels the order of codons in the mRNA. As a polypeptide is made, a peptide bond is formed between the carboxyl group in the last amino acid of the polypeptide chain and the amino group in the amino acid being added. As shown in the  Figure below, this occurs via a condensation reaction that releases a water molecule. 


The directionality of polypeptide synthesis
(a) An amino acid is connected to a polypeptide chain via a condensation reaction that releases a water molecule. The letter R is a general designation for an amino acid side chain. 
(b) The first amino acid in a polypeptide chain (usually methionine) is located at the amino-terminal end, and the last amino acid is at the carboxyl-terminal end. Thus, the directionality of amino acids in a polypeptide chain is from
the amino terminal-end to the carboxyl-terminal end, which corresponds to the 5ʹ to 3ʹ orientation of codons in mRNA.

The newest amino acid added to a growing polypeptide always has a free carboxyl group. b in the Figure above compares the sequence of a very short polypeptide with the mRNA that encodes it. The first amino acid is said to be at the N-terminus, or amino-terminal end, of the polypeptide. An amino group (NH3+) is found at this site. The term N-terminus refers to the presence of a nitrogen atom (N) at this end. The first amino acid is specified by a codon that is near the 5ʹ end of the mRNA. By comparison, the last amino acid in a completed polypeptide is located at the C-terminus or carboxyl-terminal end. A carboxyl group (COO–) is always found at this site in the polypeptide chain. This last amino acid is specified by a codon that is closer to the 3ʹ end of the mRNA.

Ribosome structure and assembly
The ribosome can be thought of as the macromolecular arena where translation takes place. Bacterial cells have one type of ribosome that is found within the cytoplasm. Eukaryotic cells contain biochemically distinct ribosomes
in different cellular locations. The most abundant type of ribosome functions in the cytosol, which is the region of the eukaryotic cell that is inside the plasma membrane but outside the membrane-bound organelles. Besides the cytosolic ribosomes, all eukaryotic cells have ribosomes within the mitochondria. In addition, plant cells and algae have ribosomes in their chloroplasts. The compositions of mitochondrial and chloroplast ribosomes are quite different from that of the cytosolic ribosomes. Each ribosome is composed of structures called the large and small subunits. This term is perhaps misleading because each ribosomal subunit itself is formed from the assembly of many different proteins and RNA molecules called ribosomal RNA or rRNA. In bacterial ribosomes, the 30S subunit is formed from the assembly of 21 different ribosomal proteins and a 16S rRNA molecule; the 50S subunit contains 34 different proteins and 5S and 23S rRNA molecules (Table below ).



Together, the 30S and 50S subunits form a 70S ribosome.  In bacteria, the ribosomal proteins and rRNA molecules are synthesized in the cytoplasm, and the ribosomal subunits are assembled there. The synthesis of eukaryotic rRNA occurs within the nucleus, and the ribosomal proteins are made in the cytosol, where translation takes place. The 40S subunit is composed of 33 proteins and an 18S rRNA; the 60S subunit is made of 49 proteins and 5S, 5.8S, and 28S rRNAs. The assembly of the rRNAs and ribosomal proteins to make the 40S and 60S subunits occurs within the nucleolus, a region of the nucleus specialized for this purpose. The 40S and 60S subunits are then exported into the cytosol, where they associate to form an 80S ribosome during translation.

Components of ribosomal subunits form functional sites for translation
To understand the structure and function of the ribosome at the molecular level, researchers must determine the locations and functional roles of the individual ribosomal proteins and rRNAs. In recent years, many advances have been made toward a molecular understanding of ribosomes. Microscopic and biophysical methods have been used to study ribosome structure. An electron micrograph of bacterial ribosomes is shown in Figure a, below.


Ribosomal structure 
(a) Electron micrograph of ribosomes attached to a bacterial mRNA molecule. 
(b) Crystal structure of the 50S and 30S subunits in bacteria. This model shows the interface between the two subunits. The rRNA is shown in gray strands (50S subunit) and turquoise strands (30S subunit), and proteins are
shown in violet (50S subunit) and navy blue (30S subunit). 
(c) A model depicting the sites where tRNA and mRNA bind to an intact ribosome. The mRNA lies on the surface of the 30S subunit. The E, P, and A sites are formed at the interface between the large and small subunits. The
growing polypeptide chain exits through a hole in the 50S subunit

More recently, a few research groups have succeeded in crystallizing ribosomal subunits, and even intact ribosomes. This is an amazing technical feat, because it is difficult to find the right conditions under which large macromolecules will form highly ordered crystals. Figure b shows the crystal structure of bacterial ribosomal subunits. The overall shape of each subunit is largely determined by the structure of the rRNAs, which constitute most of the mass of the ribosome. The interface between the 30S and 50S subunits is primarily composed of rRNA. Ribosomal proteins cluster on the outer surface of the ribosome and on the periphery of the interface. During bacterial translation, the mRNA lies on the surface of the 30S subunit within a space between the 30S and 50S subunits. As the polypeptide is being synthesized, it exits through a channel within the 50S subunit (Figure c). Ribosomes contain discrete sites where tRNAs bind and the polypeptide is synthesized. In 1964, James Watson was the first to propose a two-site model for tRNA binding to the ribosome. These sites are known as the peptidyl site (P site) and aminoacyl site (A site). In 1981, Knud Nierhaus, Hans Sternbach, and Hans-J örg Rheinberger proposed a three-site model. This model incorporated the observation that uncharged tRNA molecules can bind to a site on the ribosome that is distinct from the P and A sites. This third site is now known as the exit site (E site). The locations of the E, P, and A sites are shown in Figure c. Next, we will examine the roles of these sites during the three stages of translation.

Structure and function of tRNA
Biochemical studies of protein synthesis and tRNA molecules began in the 1950s. As work progressed toward an understanding of translation, research revealed that different kinds of RNA molecules are involved in the incorporation of amino acids into growing polypeptides. Francis Crick proposed the adaptor hypothesis. According to this idea, the position of an amino acid within a polypeptide chain is determined by the binding between the mRNA and an adaptor molecule carrying a specific amino acid. Later, work by Paul Zamecnik and Mahlon Hoagland suggested that the adaptor molecule is tRNA. During translation, a tRNA has two functions: 

(1) It recognizes a three-base codon sequence in mRNA, and 
(2) it carries an amino acid specific for that codon. 

The function of a tRNA depends on the specificity between the amino acid it carries and its anticodon
The adaptor hypothesis proposes that tRNA molecules recognize the codons within mRNA and carry the correct amino acids to the site of polypeptide synthesis. During mRNA-tRNA recognition, the anticodon in a tRNA molecule binds to a codon in mRNA due to their complementary sequences ( See figure below ) 


Recognition between tRNAs and mRNA. 
The anticodon in the tRNA binds to a complementary sequence in the mRNA. At its other end, the tRNA carries the amino acid that corresponds to the codon in the mRNA via the genetic code.

Importantly, the anticodon in the tRNA corresponds to the amino acid that it carries. For example, if the anticodon in the tRNA is 3ʹ–AAG–5ʹ, it is complementary to a 5ʹ–UUC–3ʹ codon. According to the genetic code, described earlier in this chapter, the UUC codon specifies phenylalanine. Therefore, the tRNA with a 3ʹ–AAG–5ʹ anticodon must carry a phenylalanine. As another example, if the tRNA has a 3ʹ–GGC–5ʹ anticodon, it is complementary to a 5ʹ–CCG–3ʹ codon that specifies proline. This tRNA must carry proline. Recall that the genetic code has 64 codons. Of these, 61 are sense codons that specify the 20 amino acids. Therefore, to synthesize proteins, a cell must produce many different tRNA molecules having specific anticodon sequences. To do so, the chromosomal DNA contains many distinct tRNA genes that encode tRNA molecules with different sequences. According to the adaptor hypothesis, the anticodon in a tRNA specifies the type of amino acid that it carries. Due to this specificity, tRNA molecules are named according to the type of amino acid they carry. For example, a tRNA that attaches to phenylalanine is described as tRNAPhe, whereas a tRNA that carries proline is tRNAPro.

Common structural features are shared by all tRNAs
To understand how tRNAs act as carriers of the correct amino acids during translation, researchers have examined the structural characteristics of these molecules in great detail. Though a cell makes many different tRNAs, all tRNAs share common structural features. As originally proposed by Robert W. Holley in 1965, the secondary structure of tRNAs exhibits a cloverleaf pattern. A tRNA has three stem-loop structures, a few variable sites, and an acceptor stem with a 3ʹ single-stranded region (Figure below ).


Secondary structure of tRNA
The conventional numbering of nucleotides begins at the 5ʹ end and proceeds toward the 3ʹ end. In all tRNAs, the nucleotides at the 3ʹ end contain the sequence CCA. Certain locations can have additional nucleotides not found in all tRNA molecules. These variable sites are shown in blue. The figure also shows the locations of a few modified bases specifically found in a yeast tRNA that carries alanine. The modified bases are as follows:  I = inosine, mI = methylinosine, T = ribothymidine, UH2 = dihydrouridine, m2G = dimethylguanosine, and P = pseudouridine. The inset shows an amino acid covalently attached to the 3ʹ end of a tRNA.

The acceptor stem is where an amino acid becomes attached to a tRNA (see inset). A conventional numbering system for the nucleotides within a tRNA molecule begins at the 5ʹ end and proceeds toward the 3ʹ end. Among different types of tRNA molecules, the variable sites (shown in blue) can differ in the number of nucleotides they contain. The anticodon is located in the second loop region. The actual three-dimensional, or tertiary, structure of tRNA molecules involves additional folding of the secondary structure. In the tertiary structure of tRNA, the stem-loop regions are folded into a much more compact molecule. Interestingly, in addition to the normal A, U, G, and C nucleotides, tRNA molecules commonly contain modified nucleotides within their primary structures. For example, Figure above illustrates a tRNA that contains several modified bases. Among many different species, researchers have found that more than 80 different nucleotide modifications can occur in tRNA molecules. 

Aminoacyl-tRNA Synthetases charge tRNAs by attaching the appropriate amino acid
To function correctly, each type of tRNA must have the appropriate amino acid attached to its 3ʹ end. How does an amino acid get attached to a tRNA with the correct anticodon? Enzymes in the cell known as aminoacyl-tRNA synthetases catalyze the attachment of amino acids to tRNA molecules. Cells produce 20 different aminoacyl-tRNA synthetase enzymes, 1 for each of the 20 distinct amino acids. Each aminoacyl-tRNA synthetase is named for the specific amino acid it attaches to tRNA. For example, alanyl-tRNA synthetase recognizes a tRNA with an alanine anticodon—tRNAAla—and attaches an alanine to it. Aminoacyl-tRNA synthetases catalyze a chemical reaction involving three different molecules: an amino acid, a tRNA molecule, and ATP. In the first step of the reaction, a synthetase recognizes a specific amino acid and also ATP (Figure below )

Catalytic function of aminoacyltRNA synthetase 
Aminoacyl-tRNA synthetase has binding sites for a specific amino acid, ATP, and a particular tRNA. In the first step, the enzyme catalyzes the covalent attachment of AMP to an amino acid, yielding an activated amino acid. In the second step, the activated amino acid is attached to the appropriate tRNA.


The ATP is hydrolyzed, and AMP becomes attached to the amino acid; pyrophosphate is released. During the second step, the correct tRNA binds to the synthetase. The amino acid becomes covalently attached to the 3ʹ end of the tRNA molecule at the acceptor stem, and AMP is released. Finally, the tRNA with its attached amino acid is released from the enzyme. At this stage, the tRNA is called a charged tRNA or an aminoacyl-tRNA. In a charged tRNA molecule, the amino acid is attached to the 3ʹ end of the tRNA by a covalent bond (see Figure Secondary structure of tRNA , above,  inset). The ability of the aminoacyl-tRNA synthetases to recognize tRNAs has sometimes been called the “second genetic code.” This recognition process is necessary to maintain the fidelity of genetic information. The frequency of error for aminoacyl-tRNA synthetases is less than 10–5. In other words, the wrong amino acid is attached to a tRNA less than once in 100,000 times! As you might expect, the anticodon region of the tRNA is usually important for precise recognition by the correct aminoacyl-tRNA synthetase. In studies of Escherichia coli synthetases, 17 of the 20 types of aminoacyl-tRNA synthetases recognize the anticodon region of the tRNA. However, other regions of the tRNA are also important recognition sites. These include the acceptor stem and bases in the stem-loop regions. As mentioned previously, tRNA molecules frequently contain bases within their structure that have been chemically modified. These modified bases can have important effects on tRNA function. For example, modified bases within tRNA molecules affect the rate of translation and the recognition of tRNAs by aminoacyl-tRNA synthetases. Positions 34 and 37 contain the largest variety of modified nucleotides; position 34 is the first base in the anticodon that matches the third base in the codon of mRNA. As discussed next, a modified base at position 34 can have important effects on codon-anticodon recognition.

Mismatches that follow the wobble rule can occur at the third position in codon-anticodon pairing
After considering the structure and function of tRNA molecules, let’s reexamine some subtle features of the genetic code. As discussed earlier, the genetic code is degenerate, which means that more than one codon can specify the same amino acid. Degeneracy usually occurs at the third position in the codon. For example, valine is specified by GUU, GUC, GUA, and GUG. In all four cases, the first two bases are G and U. The third base, however, can be U, C, A, or G. To explain this pattern of degeneracy, Francis Crick proposed in 1966 that it is due to “wobble” at the third position in the codon-anticodon recognition process. According to the wobble rules, the first two positions pair strictly according to the AU/GC rule. However, the third position can tolerate certain types of mismatches (Figure below ).


Wobble position and base-pairing rules 
(a) The wobble position occurs between the first base (meaning the first base in the 5ʹ to 3ʹ direction) in the anti codon and the third base in the mRNA codon. 
(b) The revised wobble rules are slightly different from those originally proposed by Crick. The standard bases found in RNA are G, C, A, and U. In addition, the structures of bases in tRNAs may be modified. Some modified bases that may occur in the wobble position in tRNA are I = inosine; xm5s2U = 5-methyl- 2-thiouridine; xm5Um = 5-methyl-2ʹ-O-methyluridine; Um = 2ʹ-O-methyluridine; xm5U = 5 methyluridine; xo5U = 5-hydroxyuridine; k2C = lysidine (a cytosine derivative). The mRNA bases in parentheses are recognized very poorly by the tRNA.

This proposal suggested that the base at the third position in the codon does not have to hydrogen bond as precisely with the corresponding base in the anticodon. Because of the wobble rules, some flexibility is observed in the recognition between a codon and anticodon during the process of translation. When two or more tRNAs that differ at the wobble base are able to recognize the same codon, these are termed isoacceptor tRNAs. As an example, tRNAs with an anticodon of 3ʹ–CCA–5ʹ or 3ʹ–CCG–5ʹ can recognize a codon with the sequence of 5ʹ–GGU–3ʹ. In addition, the wobble rules enable a single type of tRNA to recognize more than one codon. For example, a tRNA with an anticodon sequence of 3ʹ– AAG–5ʹ can recognize a 5ʹ–UUC–3ʹ and a 5ʹ–UUU–3ʹ codon. The 5ʹ–UUC–3ʹ codon is a perfect match with this tRNA. The 5ʹ–UUU–3ʹ codon is mismatched according to the standard RNA-RNA hybridization rules (namely, G in the anticodon is mismatched to U in the codon), but the two can fit according to the wobble rules described in the Figure above. Likewise, the modification of the wobble base to an inosine allows a tRNA to recognize three different codons. At the cellular level, the ability of a single tRNA to recognize more than one codon makes it unnecessary for a cell to make 61 different tRNA molecules with anticodons that are complementary to the 61 possible sense codons. E. coli cells, for example, make a population of tRNA molecules that have just 40 different anticodon sequences.

Stages of translation 
Like transcription, the process of translation can be viewed as occurring in three stages: initiation, elongation, and termination.
The Figure below  presents an overview of these stages.



Overview of the stages of translation
The initiation stage involves the assembly of the ribosomal subunits, mRNA, and the initiator tRNA carrying the first amino acid. During elongation, the ribosome slides along the mRNA and synthesizes a polypeptide chain. Translation ends when a stop codon is reached and the polypeptide is released from the ribosome. (Note: In this and succeeding figures in this chapter, the ribosomes are drawn schematically to emphasize different aspects of the translation process. 

During initiation, the ribosomal subunits, mRNA, and the first tRNA assemble to form a complex. After the initiation complex is formed, the ribosome slides along the mRNA in the 5ʹ to 3ʹ direction, moving over the codons. This is the elongation stage of translation. As the ribosome moves, tRNA molecules sequentially bind to the mRNA at the A site in the ribosome, bringing with them the appropriate amino acids. Therefore, amino acids are linked in the order dictated by the codon sequence in the mRNA. Finally, a stop codon is reached, signaling the termination of translation. At this point, disassembly occurs, and the newly made polypeptide is released. In this section, we will examine the components required for the translation process and consider their functional roles during the three stages of translation.

1. Reginald H. Garrett, Biochemistry, 6th edition

The Cell

Differences in the 3 domains of life
https://reasonandscience.catsboard.com/t2144-differences-in-the-3-domains-of-life


Carl Woese and the three domains of life.
A. Woese proposed that archaea constitute a third domain of life.
B. Three domains form a monophyletic tree based on small-subunit rRNA sequences. The length of each branch approximates the time of divergence from the last common ancestor

Some History
The first person to use the term cell was Robert Hooke (1635–1703) of England. He used a simple kind of microscope to study thin slices of cork from the bark of a cork oak tree. 



He saw many cubicles fitting neatly together, which reminded him of the barren rooms (cells) in a monastery. He used the term cell when he described his observations in 1665 in the publication Micrographia , the first picture book of science to come off the press, with 38 beautiful engravings. The book became a best-seller. The tiny cork boxes Hooke saw, and described in his book were, in fact, only the cell walls that surrounded the once living portions of these plant cells. We now know that the cell wall of a plant cell is produced on the outside of the cell and is composed of the complex carbohydrate called cellulose. It provides strength and protection to the living contents of the cell. Although the cell wall appears to be a rigid, solid layer of material, it is actually composed of many interwoven strands of cellulose molecules.





Hooke’s Observations
The concept of a cell has changed considerably over the past 300 years. Robert Hooke’s idea of a cell was based on his observation of slices of cork (cell walls of the bark of the cork oak tree). Hooke constructed his own simple microscope to be able to make these observations.

Thus, most kinds of molecules pass easily through it. Anton van Leeuwenhoek (1632–1723), a Dutch merchant who sold cloth, was one of the first individuals to carefully study magnified cells. He apparently saw a copy of Hooke’s Micrographia and began to make his own microscopes, so that he could study biological specimens. He was interested in magnifying glasses, because magnifiers were used to count the number of threads in cloth. He used a very simple kind of microscope that had only one lens. Basically, it was a very powerful magnifying glass. 



What made his microscope better than others of the time was his ability to grind very high-quality lenses. He used his skill at lens grinding to make about 400 lenses during his lifetime. One of his lenses was able to magnify 270 times. Van Leeuwenhoek made thousands of observations of many kinds of microscopic objects. He also made very detailed sketches of the things he viewed with his simple microscopes and communicated his findings to Robert Hooke and the Royal Society of London. His work stimulated further investigation of magnification techniques and descriptions of cell structures. When van Leeuwenhoek discovered that he could see things moving in pond water using his microscope, his curiosity stimulated him to look at a variety of other things. He studied many things such as blood, semen, feces, and pepper, for example. He was the first to see individual cells and recognize
them as living units, but he did not call them cells. The name he gave to the “little animals” he saw moving around in the pond water was animicules.

The idea that organisms are composed of cells originated in the mid-1800s. German botanist Matthias Schleiden studied plant material under the microscope and was struck by the presence of many similar-looking compartments, each of which contained a dark area. Today we call those compartments cells and the dark area the nucleus. In 1838, Schleiden speculated that cells are living entities and that plants are aggregates of cells arranged according to definite laws. Schleiden was a good friend of the German physiologist Theodor Schwann. Over dinner one evening, their conversation turned to the nuclei of plant cells, and Schwann remembered having seen similar structures in animal tissue. Schwann conducted additional studies that showed animal tissue contains large numbers of nuclei that are located in cell-like compartments and occur at regular intervals. In 1839, Schwann extended Schleiden’s hypothesis to animals. About two decades later, German biologist Rudolf Virchow proposed that omnis cellula e cellula, or “every cell originates from another cell.” This idea arose from his research, which showed that diseased cells divide to produce more diseased cells. The cell theory, which is credited to both Schleiden and Schwann with contributions from Virchow, has three parts.

Although Hooke, van Leeuwenhoek, and others continued to make observations, nearly 200 years passed before it was generally recognized that all living things are made of cells and that these cells can reproduce themselves. In 1838, Mathias Jakob Schleiden of Germany stated that all plants are made up of smaller cellular units. In 1839, Theodor Schwann, another German, published the idea that all animals are composed of cells. Soon after the term cell caught on, it was recognized that the cell wall of plant cells was essentially lifeless and that it was really the contents of the cell that had “life.” This living material was termed protoplasm, which means first-formed substance.
Scientists used the term protoplasm to distinguish between the living portion of the cell and the nonliving cell wall. As better microscopes were developed, people began to distinguish two different regions of protoplasm. One region, called the nucleus, appeared as a central body within a more fluid material surrounding it. Today, we know the nucleus is the part of a cell that contains the genetic information. Cytoplasm was the name given to the fluid portion of the protoplasm surrounding the nucleus. Although the term protoplasm is seldom used today, the term cytoplasm is still common. The development of special staining techniques, better light microscopes, and ultimately powerful electron microscopes revealed that the cytoplasm contains many structures, called organelles (little organs) . Further research has shown that each kind of organelle has certain functions related to its structure.

Cell biology is the study of life at the cellular level. Although cells are the simplest units of life, biologists have come to realize that they are wonderfully complex and interesting, providing information about all living things. 

1. All living organisms are composed of one or more cells.
2. Cells are the smallest units of life.
3. New cells come only from pre-existing cells by cell division.

Most cells are so small they cannot be seen with the unaided eye. However, as cell biologists have begun to unravel cell structure and function at the molecular level, the cell has emerged as a unit of incredible complexity and adaptability. In this chapter, we begin our examination of cells with an overview of their structures and functions. Later chapters in this unit will explore certain aspects of cell biology in greater detail. But first, let’s look at the
tools and techniques that allow us to observe cells.


A comparison of the sizes of various chemical and biological structures, and the resolving power of the unaided eye, light microscope, and electron microscope. 
The scale at the bottom is logarithmic to accommodate the wide range of sizes in this drawing.


Prokaryotic Cells
Based on cell structure, all forms of life can be placed into two categories called prokaryotes and eukaryotes. The term comes from the Greek pro and karyon, which means before a kernel— a reference to the kernel-like appearance of what would later be named the cell nucleus. Prokaryotic cells lack a membraneenclosed nucleus. the two categories of organisms that have prokaryotic cells are bacteria and archaea.  Bacteria are abundant throughout the world, being found in soil, water, and even our digestive tracts. Most bacterial species are not harmful to humans, and they play vital roles in ecology. Archaea are also widely found throughout the world, though they are less common than bacteria and often occupy extreme environments such as hot springs and deep-sea vents. Figure below shows a typical bacterial cell.



Structure of a typical bacterial cell. 
Prokaryotic cells, which include bacteria and archaea, lack internal compartmentalization.

The plasma membrane, which is a double layer of phospholipids and embedded proteins, forms an important barrier between the cell and its external environment. The cytoplasm is the region of the cell contained within the plasma membrane. Certain structures in the bacterial cytoplasm are visible via microscopy. These include the nucleoid (not to be confused with the eukaryotic nucleus), where the genetic material is located, and ribosomes, which are involved in polypeptide synthesis. Some bacterial structures are located outside the plasma membrane. Nearly all species of bacteria and archaea have a relatively rigid cell wall that supports and protects the plasma membrane and cytoplasm. The cell-wall composition varies widely among prokaryotic cells but commonly contains peptides and carbohydrates. The cell wall, which is relatively porous, allows most nutrients in the environment to reach the plasma membrane. Many bacteria also secrete a glycocalyx, an outer viscous covering surrounding the bacterium. The glycocalyx traps water and helps protect bacteria from drying out. Certain strains of bacteria that invade animals’ bodies produce a very thick, gelatinous glycocalyx called a capsule that may help them avoid being destroyed by the animal’s immune (defense) system or may aid in the attachment to cell surfaces. Finally, many prokaryotic cells have appendages such as pili and flagella. Pili allow cells to attach to surfaces and to each other. Flagella provide prokaryotic cells with a way to move, also called motility.

Eukaryotic Cells 
Aside from bacteria and archaea, all other species are eukaryotes (from the Greek, meaning true nucleus), which include protists, fungi, plants, and animals. Paramecia and algae are types of protists; yeasts and molds are types of fungi. Figure below illustrates the morphology of a typical animal cell.


Cells are the most basic units of life. 
A cell, such as the animal cell illustrated here, is the smallest unit that satisfies all of the characteristics of living organisms.Not every cell type will contain all the organelles, granules, and fibrous structures shown here, and other substructures can be present in some cell types. Cells also differ considerably in shape and in the prominence of various organelles and substructures. 


General structure of a plant cell. 
Plant cells lack lysosomes and centrioles. Unlike animal cells, plant cells have an outer cell wall; a large central vacuole that functions in storage and the regulation of cell volume; and chloroplasts, which carry out photosynthesis.


Subcellular organization of eukaryotic cells.
Electron micrograph of a plasma cell, a type of white blood cell that secretes antibodies, showing some of the larger organelles.




Surface area and volume are critical parameters that affect cell sizes and shapes
A  common feature of most cells is their small size. For example, most bacterial cells are about 1–10 μm in diameter, and a typical eukaryotic cell is 10–100 μm in diameter.


Relationship between cell size and the surface area/volume ratio
As cells get larger, the surface area/volume ratio gets smaller. Note: The three spheres shown here are not drawn precisely to scale.

Small size is a nearly universal characteristic of cells. In general, large organisms attain their large sizes by having more cells, not by having larger cells. For example, the various types of cells found in an elephant and a mouse are roughly the same sizes. However, an elephant has many more cells than a mouse. Why are cells usually small? One key factor is the interface between a cell and its extracellular environment, which is the plasma membrane. For cells to survive, they must import substances across their plasma membranes and export waste products. If the internal volume of a cell is large, it will require a greater amount of nutrient uptake and waste export. The rate of transport of substances across the plasma membrane, however, is limited by its surface area. Therefore, a critical issue for sustaining a cell is the surface area/volume ratio.

“Although living things occupy a three-dimensional space, their internal physiology and anatomy operate as if they were four-dimensional. Quarter-power scaling laws are perhaps as universal and as uniquely biological as the biochemical pathways of metabolism, the structure and function of the genetic code and the process of natural selection.,,, The conclusion here is inescapable, that the driving force for these invariant scaling laws cannot have been natural selection." 1

Though Jerry Fodor and Massimo Piatelli-Palmarini rightly find it inexplicable for 'random' Natural Selection to be the rational explanation for the scaling of the physiology, and anatomy, of living things to four-dimensional parameters, they do not seem to fully realize the implications this 'four dimensional scaling' of living things presents. This 4-D scaling is something we should rightly expect from a Intelligent Design perspective. This is because Intelligent Design holds that ‘higher dimensional transcendent information’ is more foundational to life, and even to the universe itself, than either matter or energy are. This higher dimensional 'expectation' for life, from a Intelligent Design perspective, is directly opposed to the expectation of the Darwinian framework, which holds that information, and indeed even the essence of life itself, is merely an 'emergent' property of the 3-D material realm. 2










The Cytosol
The cytosol (shown in yellow), is the region of a eukaryotic cell that is outside the membrane bound organelles but inside the plasma membrane. The other regions of the cell  include the interior of the nucleus (blue), the endomembrane system (purple and pink), and the semiautonomous organelles (orange and green). As in prokaryotic cells, the term cytoplasm refers to the region enclosed by the plasma membrane. This includes the cytosol and the organelles.


Compartments within (a) animal and (b) plant cells. 
The cytosol, which is outside the organelles but inside the plasma membrane, is shown in yellow. The membranes of the endomembrane system are shown in purple, and the fluid-filled interiors are pink. The peroxisome is dark purple. The interior of the nucleus is blue. Semiautonomous organelles are shown in orange (mitochondria) and green (chloroplasts).

Synthesis and breakdown of Molecules occur in the cytosol
Metabolism is defined as the sum of the chemical reactions by which cells produce the materials and utilize the energy necessary to sustain life. Although many steps of metabolism also occur in cell organelles, the cytosol is a central coordinating region for many metabolic activities of eukaryotic cells. Metabolism often involves a series of steps called a metabolic pathway. Each step in a metabolic pathway is catalyzed by a specific enzyme—a protein that accelerates the rate of a chemical reaction.  Some pathways involve the breakdown of a molecule into smaller components, a process termed catabolism. Such pathways are needed by the cell to utilize energy and also to generate molecules that provide the building blocks to construct macromolecules. Conversely, other pathways are involved in anabolism, the synthesis of molecules and macromolecules. For example, polysaccharides are made by linking
sugar molecules. To make proteins, amino acids are covalently connected to form a polypeptide, using the information within an mRNA . Translation occurs on ribosomes, which are found in various locations in the cell. Some ribosomes may float freely in the cytosol, others are attached to the outer membrane of the nuclear envelope and endoplasmic reticulum membrane, and still others are found within the mitochondria or chloroplasts.

The Cytoskeleton
The cytoskeleton is a network of three different types of protein filaments: microtubules, intermediate filaments, and actin filaments (Table below).



Each type is constructed from many protein monomers. The cytoskeleton is a striking example of protein-protein interactions. The cytoskeleton is found primarily in the cytosol and also in the nucleus along the inner nuclear membrane. Let’s first consider the structure of cytoskeletal filaments and their roles in the construction and organization of cells. Later, we will examine how they are involved in cell movement. Microtubules Microtubules are long, hollow, cylindrical structures about 25 nm in diameter composed of protein subunits called α- and β-tubulin. The assembly of tubulin to form a microtubule results in a structure with a plus end and a minus end (see Table above). Microtubules grow only at the plus end, but can shorten at either the plus or minus end. A single microtubule can oscillate between growing and shortening phases, a phenomenon termed dynamic instability. This phenomenon is important in many cellular activities, including the sorting of chromosomes during cell division. The sites where microtubules form within a cell vary among different types of organisms. Nondividing animal cells contain a single structure near their nucleus called the centrosome, also called a microtubule-organizing center. Within the centrosome are the centrioles, a conspicuous pair of structures arranged perpendicular to each other. In animal cells, microtubule growth typically starts at the centrosome in such a way that the minus end is anchored there. In contrast, most plant cells and many protists lack centrosomes and centrioles. Microtubules are created at many sites that are scattered throughout a plant cell. In plants, the nuclear membrane appears to function as a microtubule-organizing center. Microtubules are important for cell shape and organization. Organelles such as the Golgi apparatus are attached to microtubules. In addition, microtubules are involved in the organization and movement of chromosomes during mitosis and in the orientation of cells during cell division.

Intermediate Filaments Intermediate filaments are another class of cytoskeletal filament found in the cells of many but not all animal species. Their name is derived from the observation that they are intermediate in diameter between actin filaments and microtubules. Intermediate filament proteins bind to each other in a staggered array to form a twisted, ropelike structure with a diameter of approximately 10 nm (see Table above). They function as tension-bearing fibers that help maintain cell shape and rigidity. Intermediate filaments tend to be relatively permanent. By comparison, microtubules and actin filaments readily lengthen and shorten in cells. Several types of proteins assemble into intermediate filaments. Keratins form intermediate filaments in skin, intestinal, and kidney cells, where they are important for cell shape and mechanical strength. They are also a major constituent of hair and nails. In addition, intermediate filaments are found inside the cell nucleus. Nuclear lamins form a network of intermediate filaments that line the inner nuclear membrane and provide anchor points for the nuclear pores.

Actin Filaments  are also known as microfilaments, because they are the thinnest cytoskeletal filaments. They are long, thin fibers approximately 7 nm in diameter (see Table above). Like microtubules, actin filaments have plus and minus ends, and they are very dynamic structures in which each strand grows at the plus end by the addition of actin monomers. This assembly process produces a fiber composed of two strands of actin monomers that spiral around each other. Despite their thinness, actin filaments play a key role in cell shape and strength. Although actin filaments are dispersed throughout the cytosol, they tend to be highly concentrated near the plasma membrane. In many types of cells, actin filaments support the plasma membrane and provide shape and strength to the cell. The sides of actin filaments are often anchored to other proteins near the plasma membrane, which explains why actin filaments are typically found there. The plus ends grow toward the plasma membrane and play a key role in cell shape and movement.

Motor proteins interact with cytoskeletal filaments to promote movements
Motor proteins are a category of proteins that use ATP as a source of energy to promote various types of movements. As shown in Figure a, a motor protein consists of three domains: the head, hinge, and tail.


Motor proteins and their interactions with cytoskeletal filaments. 
The example illustrated here is the motor protein myosin (discussed in Chapter 44), which interacts with actin filaments. (a) Three-domain structure of myosin. (b) Conformational changes in a motor protein that allow it to “walk” along a cytoskeletal filament.

The head is the site where ATP binds and is hydrolyzed to adenosine diphosphate (ADP) and inorganic phosphate (Pi). ATP binding and hydrolysis cause a bend in the hinge, which results in movement. The tail region is attached to other proteins or to other kinds of cellular molecules. To promote movement, the head region of a motor protein interacts with a cytoskeletal filament, such as an actin filament (Figure b above ). When ATP binds and is hydrolyzed, the motor protein attempts to “walk” along the filament. The head of the motor protein is initially attached to a filament. To move forward, the head detaches from the filament, cocks forward, binds to the filament, and cocks backward. To picture how this works, consider the act of walking and imagine that the ground is a cytoskeletal filament, your leg is the head of the motor protein, and your hip is the hinge. To walk, you lift your leg up, you move it forward, you place it on the ground, and then you cock it backward (which propels you forward). This series of events is analogous to how a motor protein moves along a cytoskeletal filament. Motor proteins can cause three different kinds of movements: movement of cargo via the motor protein, movement of the filament, or bending of the filament.

In the example shown in Figure a, the tail region of a motor protein called kinesin is attached to a cargo, so the motor protein moves the cargo from one location to another.
Alternatively, a motor protein called myosin can remain in place and cause the filament to move (Figure b).
A third possibility is that both the motor protein and filament are restricted in their movement due to the presence of linking proteins. In this case, when motor proteins called dynein attempt to walk toward the minus end, they exert a force that causes the microtubules to bend (Figure c).


Three ways that motor proteins and cytoskeletal filaments cause movement

In certain kinds of cells, microtubules and motor proteins facilitate movement involving cell appendages called flagella and cilia (singular, flagellum and cilium). The difference between the two is that flagella are usually longer than cilia and are typically found singly or in pairs. Both flagella and cilia cause movement by generating bends that move along the length and push backwards against the surrounding fluid. A sperm cell generates bends alternatively in each direction, which begin at the head and move (propagate) toward the tip of the flagellum. (Figure a below).



Cellular movements due to the actions of flagella and cilia. 
(a) Spermatozoa (singular, spermatozoon) are sperm cells that are motile. They swim by producing repeated bends that move along a single, long flagellum. 
(b) The swimming of Chlamydomonas reinhardtii, a unicellular green algae, also involves a bending motion at the base, but the motion is precisely coordinated between two flagella. This results in swimming behavior that resembles a breaststroke. 
(c) Ciliated protozoa such as this Paramecium swim via many shorter cilia.

Alternatively, a pair of flagella may move in a synchronized manner to pull a microorganism through the water (think of a human swimmer doing the breaststroke). Certain unicellular algae swim in this manner (Figure b above). By comparison, cilia are often shorter than flagella and tend to cover all or part of the surface of a cell. Protists such as paramecia may have hundreds of adjacent cilia that beat in a coordinated fashion to propel the organism through the water (Figure c). Despite their differences in length, flagella and cilia have the same internal structure called the axoneme. The axoneme contains microtubules, the motor protein dynein, and linking proteins (Figure
below).


Structure of a eukaryotic cilium or flagellum. 
The structure of a cilium of a protist, Tetrahymena thermophila (see inset), consists of a 9 + 2 arrangement of nine outer doublet microtubules and two central microtubules. This structure is anchored to the basal body,
which has nine triplet microtubules, in which three microtubules are fused together. Note: The structure of the basal body is very similar to centrioles in animal cells.

In the cilia and flagella of most eukaryotic organisms, the microtubules form an arrangement called a 9 + 2 array. The outer nine are doublet microtubules, which are composed of a partial microtubule attached to a complete microtubule. Each of the two central microtubules consists of a single microtubule. Radial spokes project from the outer doublet microtubules toward the central pair. The microtubules in flagella and cilia emanate from basal bodies, which are anchored to the cytoplasmic side of the plasma membrane. At the basal body, the microtubules form a triplet structure. Much like the centrosome of animal cells, the basal bodies provide a site for microtubules to grow.
The movement of both flagella and cilia involves the propagation of a bend, which begins at the base of the structure and proceeds toward the tip . The bending occurs because dynein is activated to walk toward the minus end of the microtubules. However, the microtubules and dynein are not free to move relative to each other because of linking proteins. Therefore, instead of dyneins freely walking along the microtubules, they exert a force that bends the microtubules. The dyneins at the base of the flagellum or cilium are activated first, followed by dyneins that are progressively closer to the tip, and the resulting movement propels the organism.

The nucleus and endomembrane system
The nucleus is an organelle found in eukaryotic cells that contains most of the cell’s genetic material. A small amount of genetic material is also found outside the nucleus, in mitochondria and chloroplasts. The membranes that enclose the nucleus are part of a larger network of membranes called the endomembrane system. This system includes not only the nuclear envelope, which encloses the nucleus, but also the endoplasmic reticulum, Golgi apparatus, lysosomes, vacuoles, and peroxisomes. The prefix endo- (from the Greek, meaning inside) originally referred only to these organelles and internal membranes. However, we now know that the plasma membrane is
also part of this integrated membrane system (Figure below).


The nucleus and endomembrane system. 
This figure highlights the internal compartment of the nucleus (blue), the membranes of the endomembrane system (purple), and the fluid-filled interiors of the endomembrane system (pink). The nuclear envelope is part of the
endomembrane system, but the interior of the nucleus is not.


The eukaryotic nucleus contains chromosomes
The nucleus is the compartment that is enclosed by a double-membrane structure termed the nuclear envelope and houses the genetic material (Figure below).





The nucleus and nuclear envelope.
The nuclear envelope is composed of an inner membrane  and an outer membrane that meet at the nuclear pores. The inner nuclear membrane is lined with lamin proteins to  form the nuclear lamina. The interior of the nucleus 
contains chromatin, which is attached to the nuclear matrix, and a nucleolus, where ribosome subunits are assembled.


The cell nucleus. The SEM shows the nucleus of a liver cell (in pink); the TEM, the nucleus of a pancreas cell.

Nuclear pores are formed where the inner and outer nuclear membranes make contact with each other. The pores provide a passageway for the movement of molecules and macromolecules into and out of the nucleus. Although cell biologists view the nuclear envelope as part of the endomembrane system, the materials within the nucleus are not. Inside the nucleus are the chromosomes and a filamentous network of proteins called the nuclear matrix. Each chromosome is composed of genetic material, namely DNA, and many types of proteins that help to compact the chromosome to fit inside the nucleus. The complex formed between DNA and such proteins is termed chromatin. The nuclear matrix consists of two parts: the nuclear lamina, which is composed of intermediate filaments that line the inner nuclear membrane, and an internal nuclear matrix, which is connected to the lamina and fills the interior of the nucleus. The nuclear matrix serves to organize the chromosomes within the nucleus. Each chromosome is located in a distinct, nonoverlapping chromosome territory, which is visible when cells are exposed to dyes that label specific types of chromosomes.

The primary function of the nucleus is the protection, organization, replication, and expression of the genetic material.. Another important function is the assembly of ribosome subunits—cellular structures involved in producing polypeptides during the process of translation. The assembly of ribosome subunits occurs in the nucleolus (plural, nucleoli), a prominent region in the nucleus of nondividing cells. A ribosome is composed of two subunits: one small and one large. Each subunit contains one or more RNA molecules and several types of proteins. Most of the RNA molecules that are components of ribosomes are made in the vicinity of the nucleolus. By comparison, the ribosomal proteins are produced in the cytosol and then imported into the nucleus through the nuclear pores. The ribosomal proteins and RNA molecules then assemble in the nucleolus to form the ribosomal subunits. Finally, the subunits exit through the nuclear pores into the cytosol, where they are needed for protein synthesis.

The endoplasmic reticulum (ER)
The endoplasmic reticulum (ER) is a network of membranes that form flattened, fluid-filled tubules, or cisternae (Figure below). The terms endoplasmic (Greek, for in the cytoplasm) and reticulum (Latin, for little net) refer to the location and shape of this organelle when viewed under a microscope. The term lumen describes the internal space of an organelle. The ER membrane encloses a single compartment called the ER lumen. There are two distinct, but continuous types of ER: rough ER and smooth ER.


Structure of the endoplasmic reticulum. 
(Left side) The endoplasmic reticulum (ER) is composed of a network of flattened tubules called cisternae that enclose a continuous ER lumen. The rough ER is studded with ribosomes, whereas the smooth ER lacks ribosomes. The rough ER is continuous with the outer nuclear membrane. (Right side) A colorized TEM of the ER. The lumen of the ER is colored yellow and the ribosomes are red.

Rough ER The outer surface of the rough endoplasmic reticulum (rough ER) is studded with ribosomes, giving it a bumpy appearance. Rough ER plays a key role in the sorting of proteins that are destined for the ER, Golgi apparatus, lysosomes, vacuoles, plasma membrane, or outside of the cell. Proteins are packaged into membrane vesicles— small spheres composed of membrane—and moved from one location in the endomembrane system to another. In conjunction with protein sorting, a second function of the rough ER is the insertion of certain newly made proteins into the ER membrane. A third important function of the rough ER is the attachment of carbohydrates to proteins and lipids. This process is called glycosylation.

Smooth ER The smooth endoplasmic reticulum (smooth ER), which lacks ribosomes, functions in diverse metabolic processes. The extensive network of smooth ER membranes provides an increased surface area for enzymes that play important metabolic roles. In liver cells, enzymes in the smooth ER detoxify many potentially harmful organic molecules, including barbiturate drugs and ethanol. These enzymes convert hydrophobic toxic molecules into more hydrophilic molecules, which are easily excreted from the body. Chronic alcohol consumption, as in alcoholics, leads to a greater amount of smooth ER in liver cells, which increases the rate of alcohol breakdown. This explains why people who consume alcohol regularly must ingest more alcohol to experience its effects. It also explains why alcoholics often have enlarged livers. The smooth ER of liver cells also plays a role in carbohydrate metabolism. The liver cells of animals store energy in the form of glycogen, which is a polymer of glucose. Glycogen granules sit very close to the smooth ER membrane. When chemical energy is needed, enzymes are activated that break down the glycogen to glucose-6-phosphate. Then, an enzyme in the smooth ER called glucose-6-phosphatase removes the phosphate group, and glucose is exported from the cell into the bloodstream. Another important function of the smooth ER in all eukaryotes is the accumulation of calcium ions (Ca2+). The smooth ER contains calcium pumps that transport Ca2+ into the ER lumen. The regulated release of Ca2+ into the cytosol is involved in many vital cellular processes, including muscle contraction in animals. Finally, enzymes in the smooth ER are critical in the synthesis and modification of lipids. For example, the smooth ER is the primary site for the synthesis of phospholipids, which are the main lipid component of eukaryotic cell membranes. In addition, enzymes in the smooth ER are necessary for certain modifications of the lipid cholesterol that are needed to produce steroid hormones such as estrogen and testosterone

The golgi apparatus directs the processing, sorting, and secretion of cellular molecules
The Golgi apparatus (also called the Golgi body, Golgi complex, or simply Golgi) was discovered by the Italian microscopist Camillo Golgi in 1898. It consists of a stack of flattened membranes, with each flattened membrane enclosing a single compartment. The Golgi compartments are named according to their orientation in the cell. The cis Golgi is near the ER membrane, the trans Golgi is closest to the plasma membrane, and the medial Golgi is found in the middle. Two models have been proposed to explain how materials move through the Golgi apparatus:

• Vesicular transport model: Materials are transported between the Golgi cisternae via membrane vesicles that bud from one compartment in the Golgi (for example, the cis Golgi) and fuse with another compartment (for example, the medial Golgi).
• Cisternal maturation model: Vesicles from the ER fuse to form a cisterna at the cis face; the cisterna that was previously at the cis face becomes a medial cisterna. This addition of a cisterna moves the other medial cisternae toward the trans face. A cisterna at the trans face is lost as a result of the export of vesicles from its surface.

Further research is needed to determine the validity of these models. The Golgi apparatus performs three overlapping functions:

(1) processing,
(2) protein sorting, and
(3) secretion.

Enzymes in the Golgi apparatus process, or modify, certain proteins and lipids. As mentioned earlier, carbohydrates can be attached to proteins and lipids in the endoplasmic reticulum. Glycosylation continues in the Golgi. For this to occur, a protein or lipid is transported via vesicles from the ER to the cis Golgi. Most of the glycosylation occurs in the medial Golgi. A second type of processing event is proteolysis, whereby enzymes called proteases make cuts in polypeptides. For example, the hormone insulin is first made as a large precursor termed proinsulin. In the Golgi apparatus, proinsulin is packaged with proteases into vesicles. The proteases cut out a portion of the proinsulin to create a smaller insulin polypeptide that is a functional hormone. This happens just prior to secretion, which is described next. The Golgi apparatus packages different types of materials (cargo) into secretory vesicles that fuse with the plasma membrane, thereby releasing their contents outside the cell. Proteins destined for secretion are synthesized into the ER, travel to the Golgi, and then are transported by vesicles to the plasma membrane. The vesicles then fuse with the plasma membrane, and the proteins are secreted to the outside of the cell. The entire route is called the secretory pathway (Figure below).


The Golgi apparatus and secretory pathway. 
The Golgi is composed of stacks of membranes that enclose distinct compartments. Transport to and from the Golgi compartments occurs via membrane vesicles. Vesicles bud from the ER and go to the Golgi, and vesicles from the
Golgi fuse with the plasma membrane to release cargo to the outside. The pathway from the ER to the Golgi to the plasma membrane is termed the secretory pathway.

In addition to secretory vesicles, the Golgi also produces vesicles that travel to other parts of the cell, such as the lysosomes.
Lysosomes are involved in the intracellular digestion of macromolecules
We now turn to another organelle of the endomembrane system, lysosomes, which are small organelles found in animal cells that break down macromolecules. Lysosomes contain many acid hydrolases, which are hydrolytic enzymes that use a molecule of water to break a covalent bond. This type of chemical reaction is called hydrolysis: The acid hydrolases in a lysosome function optimally at an acidic pH. The fluid-filled interior of a lysosome has a pH of approximately 4.8. If a lysosomal membrane breaks, releasing acid hydrolases into the cytosol, the enzymes are not very active because the cytosolic pH is neutral (approximately pH 7.2) and buffered. This prevents significant damage to the cell from lysosome breakage. Lysosomes contain many different types of acid hydrolases that break down carbohydrates, proteins, lipids, and nucleic acids. This enzymatic function enables lysosomes to break down complex materials. One function of lysosomes involves the digestion of substances that are taken up from outside the cell via a process called endocytosis. In addition, lysosomes break down intracellular molecules and macromolecules to recycle their building blocks to make new molecules and macromolecules in a process called autophagy.

Peroxisomes catalyze detoxifying reactions
Peroxisomes, discovered by Christian de Duve in 1965, are small organelles found in all eukaryotic cells. Peroxisomes consist of a single membrane that encloses a fluid-filled lumen. A typical eukaryotic cell contains several hundred of them. Peroxisomes catalyze a variety of chemical reactions, including some reactions that break down organic molecules and others that are biosynthetic. In mammals, large numbers of peroxisomes are found in liver cells, where toxic molecules accumulate and are broken down. A common by-product of the breakdown of toxins is hydrogen peroxide, H2O2. Hydrogen peroxide has the potential to damage cellular components. In the presence of metals such as iron (Fe2+), which are found naturally in living cells, H2O2 is broken down to form a hydroxide ion (OH−) and a molecule called a hydroxide free radical (·OH). The ·OH is highly reactive and can damage proteins, lipids, and
DNA. Therefore, it is beneficial for cells to break down H2O2 in an alternative manner that does not form a ·OH. Peroxisomes contain an enzyme called catalase that breaks down H2O2 to make water and oxygen gas (hence the name peroxisome). Aside from detoxification, peroxisomes usually contain enzymes involved in the metabolism of fats and amino acids. For example, plant seeds contain specialized organelles called glyoxysomes, which are
similar to peroxisomes. Seeds often store fats instead of carbohydrates. Because fats have higher energy per unit mass, a plant can make seeds that are smaller and less heavy. Glyoxysomes contain enzymes that are needed to convert fats to sugars. These enzymes become active when a seed germinates and the seedling begins to grow. A general model for peroxisome formation is shown in Figure below,  though the details may differ among animal, plant, and fungal cells. To initiate peroxisome formation, vesicles bud from the ER membrane and form a premature peroxisome. Following the import of additional proteins, the premature peroxisome becomes a mature peroxisome.
Once the mature peroxisome has formed, it may then divide to further increase the number of peroxisomes in the cell.


Formation of peroxisomes. The inset is a TEM of mature peroxisomes.

To initiate peroxisome formation, vesicles bud from the ER membrane and form a premature peroxisome. Following the import of additional proteins, the premature peroxisome becomes a mature peroxisome. Once the mature peroxisome has formed, it may then divide to further increase the number of peroxisomes in the cell.

The plasma membrane Is the interface between a cell and iIts environment
The cytoplasm of eukaryotic cells is surrounded by a plasma membrane, which is part of the endomembrane system and provides a boundary between a cell and the extracellular environment. Proteins in the plasma membrane perform many important functions that affect the activities inside the cell


Major functions of the plasma membrane. Three important roles are membrane transport, cell signaling, and cell adhesion.

Membrane Transport
First, many plasma membrane proteins are involved in membrane transport. Some of these proteins function to transport essential nutrients or ions into the cell, and others are involved in the export of substances. Due to the functioning of these protein transporters, the plasma membrane is selectively permeable; it allows only certain substances in and out. We will examine the structure and function of the plasma membrane, as well as a variety
of transporters.

Cell Signaling 
A second vital function of the plasma membrane is cell signaling. To survive and adapt to changing conditions, cells must be able to sense changes in their environment. In addition, the cells of a multicellular organism need to communicate with each other to coordinate their activities. The plasma membrane of all cells contains receptors that recognize signals—either environmental agents or molecules secreted by other cells. When a signaling molecule binds to a receptor, it activates a signal transduction pathway—a series of steps that cause the cell to respond to the signal. For example, when you eat a meal, the hormone insulin is secreted into your bloodstream. This hormone binds to receptors in the plasma membranes of your cells, which results in a cellular response that allows your cells to increase their uptake of certain molecules found in food, such as glucose.

Cell Adhesion 
A third important role of the plasma membrane in animal cells is cell adhesion. Protein-protein interactions among proteins in the plasma membranes of adjacent cells promote cell-to-cell adhesion. This phenomenon is critical for animal cells to properly interact to form a multicellular organism and allows cells to recognize each other.

Mitochondria supply cells with most of their ATP
Mitochondrion (plural, mitochondria) literally means thread granule, which is what mitochondria look like under a light microscope—either threadlike or granular-shaped. They are similar in size to bacteria. A typical cell may contain a few hundred to a few thousand mitochondria. Cells with particularly heavy energy demands, such as muscle cells, have more mitochondria than other cells. Research has shown that regular exercise increases the number and size of mitochondria in human muscle cells to meet the expanded demand for energy. A mitochondrion has an outer membrane and an inner membrane separated by a region called the intermembrane space (Figure below).


Structure of a mitochondrion. 
This figure emphasizes the membrane organization of a mitochondrion, which has an outer and inner membrane. The invaginations of the inner membrane are called cristae. The mitochondrial matrix lies inside the inner membrane. 

The inner membrane is highly invaginated (folded) to form projections called cristae. The cristae greatly increase the surface area of the inner membrane, which is the site where ATP is made. The compartment enclosed by the inner membrane is the mitochondrial matrix. The primary role of mitochondria is to make ATP. Even though mitochondria produce most of a cell’s ATP, mitochondria do not create energy. Rather, their primary function is to convert chemical energy that is stored within the covalent bonds of organic molecules into a form that can be readily used by cells. Covalent bonds in sugars, fats, and amino acids store a large amount of energy. The breakdown of these molecules into simpler molecules releases energy that is used to make ATP. Many proteins in living cells use ATP as a source of energy to carry out their functions, such as muscle contraction, the uptake of nutrients, cell division, and many other cellular processes. Mitochondria perform other functions as well. They are involved in the synthesis, modification, and breakdown of several types of cellular molecules. For example, the synthesis of certain hormones requires enzymes that are found in mitochondria. Another interesting role of mitochondria is to generate heat in specialized fat cells known as brown fat cells. Groups of brown fat cells serve as “heating pads” that help to revive hibernating animals and protect sensitive areas of young animals from the cold.

Chloroplasts carry out photosynthesis
Chloroplasts are organelles that capture light energy and use some of that energy to synthesize organic molecules such as glucose. Chloroplasts are found in nearly all species of plants and algae. Figure below shows the structure of a typical chloroplast.



Structure of a chloroplast. 
Like a mitochondrion, a chloroplast is enclosed in a double membrane. In addition, it has an internal thylakoid membrane system that forms flattened compartments. These compartments stack on each other to form grana. The stroma is located inside the inner membrane but outside the thylakoid membrane.


Like a mitochondrion, a chloroplast contains an outer and inner membrane. An intermembrane space lies between these two membranes. A third system of membranes, the thylakoid membrane, forms many flattened, fluidfilled tubules that enclose a single, convoluted compartment called the thylakoid lumen. These tubules tend to stack on top of each other to form a structure called a granum (plural, grana). The stroma is the compartment of the chloroplast that is enclosed by the inner membrane but outside the thylakoid membrane. Chloroplasts are a specialized version of plant organelles that are more generally known as plastids. All plastids are derived from unspecialized proplastids. The various types of plastids are distinguished by their synthetic abilities and the types of pigments they contain. Chloroplasts, which carry out photosynthesis, contain the green pigment chlorophyll. The abundant number of chloroplasts in the leaves of plants gives them their green color. Chromoplasts, a second type of plastid, function in synthesizing and storing the yellow, orange, and red pigments known as carotenoids. Chromoplasts give many fruits and flowers their colors. In autumn, the chromoplasts also give many leaves their yellow, orange, and red colors. A third type of plastid, leucoplasts, typically lacks pigment molecules. An amyloplast is a leucoplast that synthesizes and stores starch. Amyloplasts are common in underground structures such as roots and tubers.

Mitochondria and chloroplasts contain their own genetic material and divide by binary fission
To fully appreciate the structure and organization of mitochondria and chloroplasts, we also need to briefly examine their genetic properties. In 1951, Yasutane Chiba exposed plant cells to Feulgen stain, a DNA-specific dye, and discovered that the chloroplasts became stained. Based on this observation, he was the first to suggest that chloroplasts contain their own DNA. Researchers in the 1970s and 1980s isolated DNA from both chloroplasts and mitochondria. These studies revealed that the DNA of these organelles resembled smaller versions of bacterial chromosomes. The chromosomes found in mitochondria and chloroplasts are referred to as the mitochondrial genome and chloroplast genome, respectively, whereas the chromosomes found in the nucleus of the cell constitute the nuclear genome. Like bacteria, the genomes of most mitochondria and chloroplasts are composed of a single circular chromosome. Compared with the nuclear genome, they are very small. For example, the amount of DNA in the human nuclear genome (about 3 billion base pairs) is about 200,000 times greater than the mitochondrial genome. In terms of genes, the human genome has approximately 22,000 different genes, whereas the human mitochondrial genome has only a few dozen. Chloroplast genomes tend to be larger than mitochondrial genomes, and they have a correspondingly greater number of genes. Depending on the particular species of plant or algae, a chloroplast genome is about 10 times larger than the mitochondrial genome of human cells. Just as the genomes of mitochondria and chloroplasts resemble bacterial genomes, the production of new mitochondria and chloroplasts bears a striking resemblance to the division of bacterial cells. Like their bacterial counterparts, mitochondria and chloroplasts
increase in number via binary fission, or splitting in two. Figure below illustrates the process for a mitochondrion.


Division of mitochondria by binary fission

The mitochondrial chromosome, which is found in a region called the nucleoid, is duplicated, and the organelle divides into two separate organelles. Mitochondrial and chloroplast divisions are needed to maintain a full complement of these organelles when cell growth occurs following cell division. In addition, environmental conditions may influence the sizes and numbers of these organelles. For example, when plants are exposed to more sunlight, the number of chloroplasts in leaf cells increases. 

Protein Sorting to Organelles
Eukaryotic cells contain a variety of membranebound organelles. Each protein that a cell makes usually functions within one cellular compartment or is secreted from the cell. How does each protein reach its appropriate destination? For example, how does a mitochondrial protein get sent to the mitochondrion rather than to a different organelle such as a lysosome? In eukaryotes, most proteins contain short stretches of amino acid sequences that direct them to their correct cellular location. These sequences are called sorting signals, or traffic signals. Each sorting signal is recognized by specific cellular components that facilitate the proper movement of that protein to its correct location. Most eukaryotic proteins begin their synthesis on ribosomes in the cytosol, using messenger RNA (mRNA) that contains the information for polypeptide synthesis (Figure below).



The cytosol provides amino acids, which are used as building blocks to make these proteins during translation. Cytosolic proteins lack any sorting signal, so they remain there. By comparison, the synthesis of proteins destined for the ER, Golgi, lysosomes, vacuoles, or secretory vesicles begins in the cytosol and then halts temporarily until the ribosome has become bound to the ER membrane. After this occurs, translation resumes and the polypeptide is synthesized into the ER. Proteins that are destined for the ER, Golgi, lysosome, vacuole, plasma membrane, or secretion are first directed to the ER. This is called cotranslational sorting because the first step in the sorting process begins while translation is occurring. Finally, the uptake of most proteins into the nucleus, mitochondria, chloroplasts, and peroxisomes occurs after the protein is completely made (that is, completely translated) in the cytosol. This is called post-translational sorting because sorting does not happen until translation is finished.

The cotranslational sorting of some proteins occurs at the endoplasmic reticulum membrane
The concept of sorting signals in proteins was first proposed by Günter Blobel in the 1970s. Blobel and colleagues discovered a sorting signal in proteins that sends them to the ER membrane, which is the first step in cotranslational sorting (Figure below).


First step in cotranslational sorting: sending proteins to the ER.

To be directed to the rough ER membrane, a polypeptide must contain a sorting signal called an ER signal sequence, which is a sequence of about 6–12 amino acids that are predominantly hydrophobic and usually located near the N-terminus. As the ribosome is making the polypeptide in the cytosol, the ER signal sequence emerges from the ribosome and is recognized by a protein-RNA complex called signal recognition particle (SRP). SRP has two functions. First, it recognizes the ER signal sequence and pauses translation. Second, SRP binds to an SRP receptor in the ER membrane, which docks the ribosome over a channel. At this stage, SRP is released and translation resumes. The growing polypeptide is threaded through the channel to cross the ER membrane. If the protein is not a membrane protein, it will be released into the lumen of the ER. In most cases, the ER signal sequence is removed by an enzyme, signal peptidase. In 1999, Blobel won the Nobel Prize in Physiology or Medicine for his discovery of sorting signals in proteins. The process shown in the Figure above illustrates another important role of protein-protein interactions—a series of interactions causes the steps of a process to occur in a specific order. Some proteins are meant to function in the ER. Such proteins contain ER retention signals in addition to the ER signal sequence.

Alternatively, other proteins that are destined for the Golgi, lysosomes, vacuoles, plasma membrane, or secretion leave the ER and are transported to their correct location. This transport process occurs via vesicles that are formed from one compartment and then move through the cytosol and fuse with another compartment. Vesicles from the ER may go to the Golgi, and then vesicles from the Golgi may go to the lysosomes, vacuoles, or plasma membrane. Sorting signals within proteins’ amino acid sequences are responsible for directing them to the correct location. 



Second step in cotranslational sorting: vesicle transport from the ER to the Golgi.

Figure above describes the second step in cotranslational sorting, vesicle transport from the ER to the Golgi. A cargo, such as protein molecules, is loaded into a developing vesicle by binding to cargo receptors in the ER membrane. Vesicle formation is facilitated by the binding of coat proteins, which, by shaping the surrounding membrane into a sphere, helps a vesicle to bud from a given membrane.

As a vesicle forms, other proteins called V-snares are incorporated into the vesicle membrane (hence the name V-snare). Many types of V-snares are known to exist. The particular V-snare that is found in a vesicle membrane depends on the type of cargo it carries. After a vesicle is released from one compartment, such as the ER, the coat is shed. The vesicle then travels through the cytosol. But how does the vesicle know where to go? The answer is that the V-snares in the vesicle membrane are recognized by T-snares in a target membrane. After V-snares recognize T-snares, the vesicle fuses with the membrane containing the T-snares. The recognition between V-snares and T-snares ensures that a vesicle carrying a specific cargo moves to the correct target membrane in the cell. Like the sorting of proteins to the ER membrane, the formation and sorting of vesicles also involves a series of protein-protein interactions that cause the steps to occur in a defined manner.

Proteins are sorted post-translationally to the nucleus, peroxisomes, mitochondria, and chloroplasts
The organization and function of the nucleus, peroxisomes, mitochondria, and chloroplasts depend on the uptake of proteins from the cytosol. Most of their proteins are synthesized in the cytosol and then taken up into their respective organelles. For example, most proteins involved in ATP synthesis are made in the cytosol and taken up into mitochondria after they have been completely synthesized. For this to occur, a protein must have the appropriate sorting signal as part of its amino acid sequence. As one example of post-translational sorting, let’s consider how a protein is directed to the mitochondrial matrix. Such a protein has a short amino acid sequence at the N-terminus called a matrix-targeting sequence. As shown in Figure below, the process of protein import into the matrix involves a series of intricate proteinprotein interactions.


Post-translational sorting of a protein to the mitochondrial matrix.

A protein destined for the mitochondrial matrix is first made in the cytosol, where proteins called chaperones keep it in an unfolded state. A receptor protein in the outer mitochondrial membrane recognizes the matrix-targeting sequence. The protein is released from the chaperone as it is transferred to a channel in the outer mitochondrial membrane. Because it is in an unfolded state, the mitochondrial protein can be threaded through this channel, and then through another channel in the inner mitochondrial membrane. These channels lie close to each other at contact sites between the outer and inner membranes. As the protein emerges in the matrix, other chaperone proteins already in the matrix continue to keep it unfolded. Eventually, the matrix-targeting sequence is cleaved, and the entire protein is threaded into the matrix. At this stage, the chaperone proteins are released, as the protein folds into its three-dimensional active structure.

1. Jerry Fodor and Massimo Piatelli-Palmarini, What Darwin Got Wrong (London: Profile Books, 2010), p. 78-79
2. https://uncommondescent.com/evolution/16037/#comment-369806

Membrane Structure, Synthesis, and Transport

Cell membranes are crucial to the life of the cell. The plasma membrane encloses the cell, defines its boundaries, and maintains the essential differences between the cytosol and the extracellular environment. Inside eukaryotic cells, the membranes of the nucleus, endoplasmic reticulum, Golgi apparatus, mitochondria, and other membrane-enclosed organelles maintain the characteristic differences between the contents of each organelle and the cytosol. Ion gradients across membranes, established by the activities of specialized membrane proteins, can be used to synthesize ATP, to drive the transport of selected solutes across the membrane, or, as in nerve and muscle cells, to produce and transmit electrical signals. In all cells, the plasma membrane also contains proteins that act as sensors of external signals, allowing the cell to change its behavior in response to environmental cues, including signals from other cells; these protein sensors, or receptors, transfer information—rather than molecules—across the membrane.

 Despite their differing functions, all biological membranes have a common general structure: each is a very thin film of lipid and protein molecules, held together mainly by noncovalent interactions. Cell membranes are dynamic, fluid structures, and most of their molecules move about in the plane of the membrane. The lipid molecules are arranged as a continuous double layer about 5 nm thick. This lipid bilayer provides the basic fluid structure of the membrane and serves as a relatively impermeable barrier to the passage of most water-soluble molecules. Most membrane proteins span the lipid bilayer and mediate nearly all of the other functions of the membrane, including the transport of specific molecules across it, and the catalysis of membrane-associated reactions such as ATP synthesis. In the plasma membrane, some transmembrane proteins serve as structural links that connect the cytoskeleton through the lipid bilayer to either the extracellular matrix or an adjacent cell, while others serve as receptors to detect and transduce chemical signals in the cell’s environment. It takes many kinds of membrane proteins to enable a cell to function and interact with its environment, and it is estimated that about 30% of the proteins encoded in an animal’s genome are membrane proteins.

Membrane Structure

Biological membranes are a mosaic of lipids, proteins, and carbohydrates
The Figure below shows the biochemical organization of a membrane, which is similar in composition among all living organisms.


Fluid-mosaic model of membrane structure
The basic framework of a plasma membrane is a phospholipid bilayer. Proteins may span the membrane and may be bound on the surface to other proteins or to lipids. Proteins and lipids that have covalently bound carbohydrates are called glycoproteins and glycolipids, respectively. The inset shows nine phospholipids and one cholesterol molecule in a bilayer, and it emphasizes the two leaflets and the polar and nonpolar regions of the bilayer.

The framework of the membrane is the phospholipid bilayer, which consists of two layers of phospholipids.  Phospholipids are amphipathic molecules. They have a hydrophobic (water-fearing) or nonpolar region, and also a hydrophilic (water-loving) or polar region. The hydrophobic tails of the lipids are found in the interior of the membrane, and the hydrophilic heads are on the surface. Biological membranes also contain proteins, and most membranes have carbohydrates attached to lipids and proteins. Overall, the membrane is considered a mosaic of lipid, protein, and carbohydrate molecules. The membrane structure illustrated in the Figure above is referred to as the fluid-mosaic model, originally proposed by S. Jonathan Singer and Garth Nicolson in 1972. The membrane exhibits properties that resemble a fluid because lipids and proteins can move relative to each other within the membrane. Half of a phospholipid bilayer is termed a leaflet. Each leaflet faces a different region. For example, the plasma membrane contains a cytosolic leaflet and an extracellular leaflet (see Figure above). With regard to lipid composition, the two leaflets of cellular membranes are asymmetrical. Certain types of lipids may be more abundant in one leaflet compared to the other. A striking asymmetry occurs with glycolipids—lipids with carbohydrate attached. These are found primarily in the extracellular leaflet. The carbohydrate portion of a glycolipid protrudes into the extracellular medium.

Proteins associate with membranes in three different ways
Although the phospholipid bilayer forms the basic foundation of cellular membranes, the protein component carries out many key functions.  Membrane proteins in the smooth ER membrane function as enzymes that break down glycogen. Membrane proteins are involved in transporting ions and molecules across membranes. Membrane proteins have three different ways of associating with a membrane (Figure below)


Types of membrane proteins.
Integral membrane proteins are of two types: transmembrane proteins and lipid-anchored proteins. Peripheral membrane proteins are noncovalently bound to the hydrophilic regions of integral membrane proteins or to the polar head groups of lipids. Inset: The protein bacteriorhodopsin contains seven transmembrane segments, depicted as cylinders, each having an α helix structure. Bacteriorhodopsin is found in halophilic (saltloving) archaea.


Membranes Are Semifluid
Though membranes are often described as fluid, it is more appropriate to say they are semifluid. In a fluid substance, molecules can move in three dimensions. By comparison, most phospholipids can rotate freely around their long axes and move laterally within the membrane leaflet (Figure below).



Semifluidity of the lipid bilayer 
(a) Spontaneous movements in the bilayer. Lipids can rotate (that is, move 360˚ ) and move laterally (for example, from left to right in the plane of the bilayer). 
(b) Flip-flop does not happen spontaneously, because the polar head group would have to pass through the hydrophobic region of the bilayer. Instead, the enzyme flippase uses ATP to flip phospholipids from one leaflet to the other.

This type of motion is considered two-dimensional, which means it occurs within the plane of the membrane. Because rotational and lateral movements keep the lipid tails within the hydrophobic interior, such movements are energetically favorable. At 37°C, a typical lipid molecule exchanges places with its neighbors about 107 times per second, and it can move several micrometers per second. At this rate, a lipid can traverse the length of a bacterial cell (approximately 1 μm) in only 1 second and the length of a typical animal cell in 10 to 20 seconds. In contrast to rotational and lateral movements, the “flip-flop” of lipids from one leaflet to the opposite leaflet does not occur spontaneously. Flip-flop is energetically unfavorable because the hydrophilic polar head of a phospholipid would have to travel through the hydrophobic interior of the membrane. How are lipids moved from one leaflet to the other? The transport of lipids between leaflets requires the action of the enzyme flippase, which requires energy input in the form of ATP (Figure b). Although most lipids diffuse rotationally and laterally within the plane of the lipid bilayer, researchers have discovered that certain types of lipids in animal cells tend to strongly associate with each other to form structures called lipid rafts. As the word raft suggests, a lipid raft is a group of lipids that float together as a unit within a larger sea of lipids. Lipid rafts have a lipid composition that differs from the surrounding membrane. For example, they usually have a high amount of cholesterol. In addition, lipid rafts may contain unique sets of lipid-anchored proteins and transmembrane proteins. The functional importance of lipid rafts is the subject of a large amount of current research. Lipid rafts may play an important role in endocytosis  and cell signaling. Depending on the cell type, 10–70% of membrane proteins may be restricted in their movement. Transmembrane proteins may be bound to components of the cytoskeleton, which restricts the proteins from moving (Figure below), or may be attached to molecules that are outside the cell, such as the interconnected network of proteins that forms the
extracellular matrix of animal cells.


Attachment of transmembrane proteins to the cytoskeleton and extracellular matrix of an animal cell. 
Some transmembrane proteins have regions that extend into the cytosol and are anchored to large cytoskeletal filaments via linker proteins. Being bound to these large filaments restricts the movement of these proteins. Similarly, some transmembrane proteins are bound to large, immobile fibers in the extracellular matrix, which restricts their movements.

Synthesis of Membrane Components in Eukaryotic Cells
Cellular membranes are composed of lipids, proteins, and carbohydrates. Most of the membrane components of eukaryotic cells are made at the endoplasmic reticulum (ER).  We will  examine the process by which transmembrane proteins are inserted into the ER membrane and explore how carbohydrates are attached to some proteins. In eukaryotic cells, the cytosol and endomembrane system work together to synthesize most lipids. This process occurs at the cytosolic leaflet of the smooth ER membrane. Figure below shows a simplified pathway for the synthesis of phospholipids.


A simplified pathway for the synthesis of membrane phospholipids at the ER membrane. 
Note: Phosphate is abbreviated P when it is attached to an organic molecule and Pi when it is unattached. The subscript i refers to the inorganic form of phosphate.

The building blocks for a phospholipid are two fatty acids, each with a long tail, one glycerol molecule, one phosphate, and a polar head group. These building blocks are made via enzymes in the cytosol, or they are taken into cells from food. To begin the process of phospholipid synthesis, the fatty acids are activated by attachment to an organic molecule called coenzyme A (CoA). This activation promotes the bonding of the two fatty acids to a glycerol-phosphate molecule, and the resulting molecule is inserted into the cytosolic leaflet of the ER membrane. The phosphate is removed from glycerol, and then a polar molecule already linked to phosphate is attached to glycerol. In the example shown in Figure below, the polar head group contains choline, but many other types of head groups are possible.

Phospholipids are initially inserted into the cytosolic leaflet. Flippases in the ER membrane transfer some of the newly made lipids to the other leaflet so similar amounts of lipids are found in both leaflets. The lipids made in the ER membrane are transferred to other membranes in the cell by a variety of mechanisms. Phospholipids in the ER can diffuse laterally to the nuclear envelope. In addition, lipids are transported via vesicles to the Golgi, lysosomes, vacuoles, or plasma membrane. A third mode of lipid transfer involves lipid exchange proteins, which extract a lipid from one membrane, diffuse through the cell, and insert the lipid into another membrane. Such transfer can occur between any two membranes, even between the endomembrane system and semiautonomous organelles. For example, lipid exchange proteins transfer lipids between the ER and mitochondria. In addition, chloroplasts and mitochondria synthesize certain types of lipids that are transferred from these organelles to other cellular membranes via lipid exchange proteins.

Most transmembrane proteins are first inserted into the ER membrane
Eukaryotic proteins contain sorting signals that direct them to their proper destination. With the exception of proteins destined for semiautonomous organelles, most transmembrane proteins contain an ER signal sequence that directs them to the ER membrane. If a polypeptide also contains a stretch of 20 amino acids that are mostly hydrophobic and form an α helix, this region will become a transmembrane segment. In the example shown in Figure below, the polypeptide contains one such sequence.


Insertion of membrane proteins into the ER membrane.

After the ER signal sequence is removed by signal peptidase, a membrane protein with a single transmembrane segment is the result. Other polypeptides may contain more than one transmembrane segment. Each time a polypeptide sequence contains a region of 20 amino acids that are mostly hydrophobic and form an α helix, an additional transmembrane segment is synthesized into the membrane. From the ER, membrane proteins can be transferred via vesicles to other regions of the cell, such as the Golgi, lysosomes, vacuoles, or plasma membrane.

The attachment of carbohydrates to proteins occurs in the ER and golgi apparatus
Glycosylation refers to the process of covalently attaching a carbohydrate to a lipid or protein. When a carbohydrate is attached to a lipid, a glycolipid is created, whereas attachment of a carbohydrate to a protein produces a glycoprotein.  What is the function of glycosylation? Though the roles of carbohydrates in cell structure and function are not entirely understood, some functional consequences of glycosylation have emerged. Glycolipids and glycoproteins often play a role in cell surface recognition. When glycolipids and glycoproteins are found in the plasma membrane, the carbohydrate portion is located in the extracellular region. During embryonic development in animals, significant cell movement occurs. Layers of cells slide over each other to create body structures such as the spinal cord and internal organs. The proper migration of individual cells and cell layers relies on the recognition of cell types via the carbohydrates on their cell surfaces. Carbohydrates often have a protective effect. The carbohydraterich zone on the surface of certain animal cells shields the cell from mechanical and physical damage. Similarly, the carbohydrate portion of glycosylated proteins protects them from the harsh conditions of the extracellular environment and degradation by extracellular proteases, which are enzymes that digest proteins. Two forms of protein glycosylation occur in eukaryotes: N-linked and O-linked. N-linked glycosylation, which also occurs in archaea, involves the attachment of a carbohydrate to the amino acid asparagine in a polypeptide. It is called N-linked because the carbohydrate is attached to a nitrogen atom of the asparagine side chain. For this to occur, a group of 14 sugar molecules, called a carbohydrate tree, is first built onto a lipid found in the ER membrane (Figure below).


N-linked glycosylation in the endoplasmic reticulum.

An enzyme in the ER, oligosaccharide transferase, transfers the carbohydrate tree from the lipid to an asparagine in the polypeptide. N-linked glycosylation commonly occurs on membrane proteins that are transported to the cell surface. The second form of glycosylation, O-linked glycosylation, occurs only in the Golgi apparatus. This form involves the addition of a string of sugars to the oxygen atom of serine or threonine side chains in polypeptides. In animals, O-linked glycosylation is important for the production of proteoglycans, which are highly glycosylated proteins that are secreted from cells and help to organize the extracellular matrix that surrounds cells. Proteoglycans are also a component of mucus, a slimy material that coats many cell surfaces and is secreted into fluids such as saliva. High concentrations of carbohydrates give mucus its slimy texture. We now turn to one of the key functions of membranes, membrane transport—the movement of ions and molecules across biological membranes. All cells contain a plasma membrane that exhibits selective permeability, allowing the passage of some ions and molecules but not others. As a protective envelope, its structure ensures that essential molecules such as glucose and amino acids enter the cell, metabolic intermediates remain in the cell, and waste products exit. The selective permeability of the plasma membrane allows the cell to maintain a favorable internal environment. Substances can move directly across a membrane in three general ways (Figure below).


Three general types of membrane transport.

Simple diffusion occurs when a substance moves from a region of high concentration to a region of lower concentration. Some substances can move directly through a biological membrane via simple diffusion. In facilitated diffusion, a transport protein provides a passageway for a substance to diffuse across a membrane. Simple diffusion and facilitated diffusion are examples of passive transport—the transport of a substance across a membrane that does not require an input of energy. In contrast, a third mode of transport, called active transport, moves a substance from an area of low concentration to one of high concentration with the aid of a transport protein. Active transport requires an input of energy from a source such as ATP. In this section, we will begin with a discussion of how the phospholipid bilayer presents a barrier to the movement of ions and molecules across membranes. We will then consider the concept of gradients across membranes and how such gradients affect the movement of water.

The phospholipid bilayer is a barrier to the movement of hydrophilic solutes
Because of their hydrophobic interiors, phospholipid bilayers are a barrier to the movement of ions and hydrophilic molecules. Such ions and molecules are called solutes; they are dissolved in water, which is a solvent. The rate of movement across a phospholipid bilayer depends on the chemistry of the solute and its concentration. Figure below compares the relative permeabilities of an artificial phospholipid bilayer to various solutes.


Relative permeability of an artificial phospholipid bilayer to a variety of solutes. 
Solutes that easily penetrate are shown with a straight arrow that passes through the bilayer. The dashed arrow indicates solutes for which the bilayer is moderately permeable. Permeability is low to very low for the remaining solutes toward the bottom of the figure.


This artificial bilayer does not contain any proteins or carbohydrates. Gases and a few small, uncharged molecules can readily cross the bilayer by simple diffusion. However, the permeability of the bilayer to ions and larger polar molecules, such as sugars, is relatively low, and the permeability to macromolecules, such as proteins and polysaccharides, is even lower. When we consider how different solutes cross a lipid bilayer by simple diffusion, the greatest variation occurs in the ability of solutes to enter the hydrophobic interior of the bilayer. As an example, let’s compare urea and diethylurea. Diethylurea is much more hydrophobic because it contains two nonpolar ethyl groups (— CH2CH3) (Figure below).


Structures of urea and diethylurea.

For this reason, it can pass more quickly through the hydrophobic region of the bilayer. The rate of simple diffusion of diethylurea through a phospholipid bilayer is about 50 times faster than that of urea.

Cells maintain gradients across their membranes
A hallmark of living cells is their ability to maintain a relatively constant internal environment that is distinctively different from their external environment. Solute gradients are formed across the plasma membrane and across organellar membranes. When we speak of a transmembrane gradient or concentration gradient, we mean the concentration of a solute is higher on one side of a membrane than the other. Transmembrane gradients of solutes are a universal feature of all living cells. For example, immediately after you eat a meal containing carbohydrates, a higher concentration of glucose is found outside your cells than inside; this is an example of a chemical gradient (Figure a below).


Gradients across cell membranes.


Gradients involving ions have two components—electrical and chemical. An electrochemical gradient is a dual gradient with both electrical and chemical components (Figure 5.b). It occurs with solutes that have a net positive or negative charge. For example, let’s consider a gradient involving Na+. An electrical gradient can exist in which the amount of net positive charge outside a cell is greater than inside. In Figure b above, an electrical gradient is due to differences in the amounts of different types of ions across the membrane, including sodium, potassium, and chloride (Na+, K+, and Cl–). At the same time, a chemical gradient—a difference in Na+ concentration across the membrane—could exist in which the concentration of Na+ outside is greater than inside. The Na+ electrochemical gradient is composed of both an electrical gradient due to charge differences across the membrane and a chemical gradient for Na+. One way to view the transport of solutes across membranes is to consider how the transport process affects the pre-existing gradients across membranes. Passive transport tends to dissipate a pre-existing gradient. Such a process is energetically favorable and does not require an input of energy. As mentioned, passive transport can occur in two ways, via simple diffusion or facilitated diffusion. By comparison, active transport produces a chemical gradient or electrochemical gradient. The formation of a gradient requires an input of energy.

Osmosis is the movement of water across membranes to balance solute concentrations
When the concentrations of dissolved particles (solutes) on both sides of the plasma membrane are equal, the two solutions are said to be isotonic (Figure a below).


Relative solute concentrations outside and inside cells.

However, we have also seen that transmembrane gradients commonly exist across membranes. When the concentration of solutes outside the cell is higher, it is said to be hypertonic relative to the inside of the cell (Figureb). Alternatively, the outside of the cell could be hypotonic— have a lower concentration of solutes relative to the inside (Figure c). If solutes cannot readily move across the membrane, water will move and tend to balance the solute concentrations. In this process, called osmosis, water moves across a membrane from the hypotonic compartment (with a lower concentration) into the hypertonic compartment (with a higher concentration). Animal cells, which are not surrounded by a rigid cell wall, must maintain a balance between the extracellular and intracellular solute concentrations; the two solutions need to be isotonic. Animal cells contain a variety of transport proteins that sense changes in cell volume and allow the necessary movements of solutes across the membrane to prevent osmotic changes and maintain normal cell shape. However, if an animal cell is placed in a hypotonic medium, water will enter the cell to equalize solute concentrations on both sides of the membrane. In extreme cases, a cell may take up so much water that it ruptures, a phenomenon called osmotic lysis (Figure a below).


The phenomenon of osmosis. 
(a) In cells that lack a cell wall, such as animal cells, osmosis may promote cell shrinkage (crenation) or swelling. 
(b) In cells that have a rigid cell wall, such as plant cells, a hypertonic medium causes the plasma membrane to pull away from the cell wall, whereas a hypotonic medium causes only a minor amount of expansion.

Alternatively, if an animal cell is placed in a hypertonic medium, water will exit the cell via osmosis and equalize solute concentrations on both sides of the membrane, causing the cell to shrink in a process called crenation. How does osmosis affect cells with a rigid cell wall, such as bacteria, fungi, algae, and plant cells? If the extracellular fluid is hypotonic, a plant cell will take up a small amount of water, but the cell wall prevents osmotic lysis from occurring (Figure 5.b). Alternatively, if the extracellular fluid surrounding a plant cell is hypertonic, water will exit the cell and the plasma membrane will pull away from the cell wall, a process called plasmolysis. Some freshwater microorganisms, such as amoebae and paramecia, are found in extremely hypotonic environments where the external solute concentration is always much lower than the concentration of solutes in their cytosol. Because of the great tendency for water to move into the cell by osmosis, such organisms contain one or more contractile vacuoles to prevent osmotic lysis. A contractile vacuole takes up water from the cytosol and periodically discharges it by fusing with the plasma membrane (Figure below).


The contractile vacuole in Paramecium caudatum.
In the upper photo, a contractile vacuole is filled with water from radiating canals that collect fluid from the cytosol. The lower photo shows the cell after the contractile vacuole has fused with the plasma
membrane (which would be above the plane of this page) and released the water from the cell.

Transport Proteins
Because the phospholipid bilayer is a physical barrier to the diffusion of most hydrophilic molecules and ions, cells can separate their internal contents from the external environment. However, this barrier also poses a potential problem because cells must take up nutrients from the environment and export waste products. How do cells overcome this dilemma? Over the course of millions of years, species have evolved a multitude of transport proteins—transmembrane proteins that provide passageways for the movement of ions and hydrophilic molecules across the phospholipid bilayer. Transport proteins play a central role in the selective permeability of biological membranes. In this section, we will examine the two categories of transport proteins— channels and transporters—based on the manner in which they move solutes across the membrane.

Channels provide open passageways for solute movement
A channel is a transmembrane protein that forms an open passageway for the facilitated diffusion of ions or molecules across the membrane (Figure below).


Mechanism of transport by a channel protein.

Solutes move directly through a channel to get to the other side. When a channel is open, the transmembrane movement of solutes can be extremely rapid, up to 100 million ions or molecules per second! Most channels are gated, which means they open to allow the diffusion of solutes and close to prohibit diffusion. The phenomenon of gating allows cells to regulate the movement of solutes. For example, gating may involve the direct binding of a molecule to the channel protein itself. These gated channels are controlled by the noncovalent binding of small molecules—called ligands—such as hormones or neurotransmitters. The ligands are often important in the transmission of signals between neurons and muscle cells or between two neurons.

Transporters bind their solutes and undergo conformational changes
Let’s now turn our attention to a second category of transport proteins known as transporters.* These transmembrane proteins bind their solutes in a hydrophilic pocket and undergo a conformational change that switches the exposure of the pocket from one side of the membrane to the other side (Figure below).


Mechanism of transport by a transporter, also called a carrier.
For example, in 1995, American biologist Robert Brooker and colleagues proposed that a transporter called lactose permease, which is found in the bacterium E. coli, has a hydrophilic pocket that binds lactose. They further proposed that the two halves of the transporter protein come together at an interface that moves in such a way that the lactose-binding site alternates between an outwardly accessible pocket and an inwardly accessible pocket, as shown in Figure above. This idea was later confirmed by studies that determined the structure of the lactose permease and related transporters. Transporters provide the principal pathway for the uptake of organic molecules, such as sugars, amino acids, and nucleotides. In animals, they also allow cells to take up certain hormones and neurotransmitters. In addition, many transporters play a key role in export. Waste products of cellular metabolism must be released from cells before they reach toxic levels. For example, a transporter removes lactic acid, a by-product of muscle cells during exercise. Other transporters, which are involved with ion transport, play an important role in regulating internal pH and controlling cell volume. Transporters tend to be much slower than channels. Their rate of transport is typically 100 to 1,000 ions or molecules per second. Transporters are named according to the number of solutes they bind and the direction in which they transport those solutes (Figure below).



Types of transporters based on the direction of transport.

Uniporters bind a single ion or molecule and transport it across the membrane. Symporters bind two or more ions or molecules and transport them in the same direction. Antiporters bind two or more ions or molecules and transport them in opposite directions.

Active transport is the movement of solutes against a gradient
As mentioned, active transport is the movement of a solute across a membrane against its concentration gradient—that is, from a region of low concentration to higher concentration. Active transport is energetically unfavorable and requires an input of energy. Primary active transport involves the functioning of a pump—a type of transporter that directly uses energy to transport a solute against a concentration gradient. Figure a below shows a pump that uses ATP to transport H+ against a gradient. Such a pump can establish an H+ electrochemical gradient across a membrane.


Types of active transport. 
(a) During primary active transport, a pump directly uses energy, in this case from ATP, to transport asolute against a concentration gradient. The pump shown here uses ATP to establish an H+ electrochemical gradient. 
(b) Secondary active transport via symport involves the use of this gradient to drive the active transport of a solute, such as sucrose.

Na+/solute symporters are prevalent in animal cells. Symporters enable cells to actively import nutrients against a gradient. These proteins use the energy stored in the electrochemical gradient of H+ or Na+ to power the uphill movement of organic solutes such as sugars, amino acids, and other needed molecules. Therefore, with symporters in their plasma membrane, cells can scavenge nutrients from the extracellular environment and accumulate them to high levels within the cytoplasm.

ATP-driven ion pumps generate ion electrochemical gradients
The phenomenon of active transport was discovered in the 1940s based on the study of the transport of sodium ions (Na+) and potassium ions (K+). In animal cells, the concentration of Na+ is lower inside the cell than outside, whereas the concentration of K+ is higher inside the cell than outside. After analyzing the movement of these ions across the plasma membrane of muscle cells, neurons, and red blood cells, researchers determined that the export of Na+ is coupled to the import of K+. In the late 1950s, Danish biochemist Jens Skou proposed that a single transporter is responsible for this phenomenon. He was the first to describe an ATP-driven ion pump, which was later named Na+/K+-ATPase. This pump actively transports Na+ and K+ against their gradients by using the energy from ATP hydrolysis. The plasma membrane of a typical animal cell contains thousands of Na+/K+-ATPase pumps that maintain large concentration gradients in which the concentration of Na+ is higher outside the cell and the concentration of K+ is higher inside the cell. Let’s take a closer look at the Na+/K+-ATPase that Skou discovered. Every time one ATP is hydrolyzed, the Na+/K+-ATPase functions as an antiporter that pumps three Na+ into the extracellular environment and two K+ into the cytosol (Figure a below).


Structure and function of the Na+/K+-ATPase. 
(a) Active transport by the Na+/K+-ATPase. Each time this protein hydrolyzes one ATP molecule, it pumps out three Na+ and pumps in two K+. 
(b) Pumping mechanism. This figure illustrates the protein conformational changes between E1 and E2. As this occurs, ATP is hydrolyzed to ADP and phosphate. During the process, phosphate is covalently attached to the protein but is released after two K+ bind.

Because one cycle of pumping results in the net export of one positive charge, the Na+/K+-ATPase also produces an electrical gradient across the membrane. For this reason, it is called an electrogenic pump, because it generates an electrical gradient. By studying the interactions of Na+, K+, and ATP with the Na+/K+-ATPase, researchers have pieced together a molecular road map of the steps that direct the pumping of ions across the membrane (Figure b above). The Na+/K+-ATPase alternates between two conformations, designated E1 and E2. In E1, the ion-binding sites are accessible from the cytosol—Na+ binds tightly to this conformation, whereas K+ has a low affinity. In E2, the ion-binding sites are accessible from the extracellular environment—Na+ has a low affinity, and K+ binds tightly. To examine the pumping mechanism of the Na+/K+-ATPase, let’s begin with the E1 conformation. Three Na+ bind to the Na+/K+-ATPase from the cytosol (Figure b above). When this occurs, ATP is hydrolyzed to ADP and phosphate. Temporarily, the phosphate is covalently bound to the pump, an event called phosphorylation. The pump then switches to the E2 conformation. The three Na+ are released into the extracellular environment, because they have a lower affinity for the E2 conformation. In this conformation, two K+ bind from the outside. The binding of two K+ causes the release of phosphate, which, in turn, causes a switch to E1. Because the E1 conformation has a low affinity for K+ the two K+ are released into the cytosol. The Na+/K+-ATPase is now ready for another round of pumping. The Na+/K+-ATPase is a critical ion pump in animal cells because it maintains Na+ and K+ gradients across the plasma membrane. Many other types of ion pumps are also found in the plasma membrane and in organellar membranes. Ion pumps play the primary role in the formation and maintenance of ion gradients that drive many important cellular processes (Table below).



ATP is commonly the source of energy to drive ion pumps, and cells typically use a substantial portion of their ATP to keep them working. For example, neurons use up to 70% of their ATP just to operate ion pumps!

Exocytosis and Endocytosis
We have seen that most small substances are transported via membrane proteins such as channels and transporters, which provide a passageway for the movement of ions and molecules directly across the membrane. Eukaryotic cells have two other mechanisms, exocytosis and endocytosis, to transport larger molecules such as proteins and polysaccharides,
and even very large particles. Both mechanisms involve the packaging of the transported substance, sometimes called the cargo, into a membrane vesicle or vacuole. Table below describes some examples.



Exocytosis During exocytosis, material inside the cell is packaged into vesicles and then excreted into the extracellular environment (Figure below).


Exocytosis.

These vesicles are usually derived from the Golgi apparatus. As the vesicles form, a specific cargo is loaded into their interior. The budding process involves the formation of a protein coat around the emerging vesicle. The assembly of coat proteins on the surface of the Golgi membrane causes the bud to form. Eventually, the bud separates from the membrane to form a vesicle. After the vesicle is released, the coat is shed. Finally, the vesicle fuses with
the plasma membrane and releases the cargo into the extracellular environment.

Endocytosis
During endocytosis, the plasma membrane invaginates, or folds inward, to form a vesicle that brings substances into the cell. Three types of endocytosis are receptor-mediated endocytosis, pinocytosis, and phagocytosis.

Receptor-Mediated Endocytosis
In receptor-mediated endocytosis, a receptor in the plasma membrane is specific for a given cargo (Figure below ) .


Receptor-mediated endocytosis.

Cargo molecules binding to their specific receptors stimulate many receptors to aggregate, and then coat proteins bind to the membrane. The protein coat causes the membrane to invaginate and form a vesicle. Once it is released into the cell, the vesicle sheds its coat. In most cases, the vesicle fuses with an internal membrane organelle, such as a lysosome, and the receptor releases its cargo. Depending on the cargo, the lysosome may release it directly into the cytosol or digest it into simpler building blocks before releasing it.

Pinocytosis
Other specialized forms of endocytosis occur in certain types of cells. Pinocytosis (from the Greek, meaning cell-drinking) involves the formation of membrane vesicles from the plasma membrane as a way for cells to internalize the extracellular fluid. This allows cells to sample the extracellular solutes. Pinocytosis is particularly important in cells that are actively involved in nutrient absorption, such as cells that line the intestine in animals.

Phagocytosis
Phagocytosis (from the Greek, meaning cell-eating) involves the formation of an enormous membrane vesicle called a phagosome, or phagocytic vacuole, which engulfs a large particle such as a bacterium. Only certain kinds of cells can carry out phagocytosis. For example, macrophages, which are cells of the immune system in mammals, kill bacteria via phagocytosis. Macrophages engulf bacterial cells into phagosomes. Once inside the cell, the phagosome fuses with a lysosome, and the digestive enzymes within the lysosome destroy the bacterium.

Energy, Enzymes, and Metabolism

Enzymes are proteins that act as critical catalysts to speed up thousands of different reactions in cells. Enzymes are proteins that act as critical catalysts to speed up thousands of different reactions in cells.  A chemical reaction is a process in which one or more substances are changed into other substances. Such reactions may involve molecules attaching to each other to form larger molecules, molecules breaking apart to form two or more smaller molecules, rearrangements of atoms within molecules, or the transfer of electrons from one atom to another. Every living cell continuously performs thousands of such chemical reactions to sustain life. Metabolism is the sum total of all chemical reactions that occur within an organism. Metabolism also refers to a specific set of chemical reactions occurring at the cellular level.

Energy Exists in Different Forms
To understand why a chemical reaction occurs, we first need to consider energy, which is the ability to promote change or do work. Physicists often consider energy in two general forms: kinetic energy and potential energy (Figure below). 



Kinetic energy is energy associated with movement, such as the movement of a baseball bat from one location to another. By comparison, potential energy is the energy that a substance or object possesses due to its structure or location. An electron in an atom has potential energy based on its position relative to other electrons and the positively charged nucleus. Electrons occupy orbitals of different shapes and sizes, which are found within electron shells, or energy levels. An electron in an outer shell has a higher amount of potential energy than one in an inner shell. If an electron drops to a lower shell, some of its potential energy is converted to kinetic energy. The energy that is stored in atoms and in the bonds between atoms is called chemical potential energy (or simply, chemical energy). This energy can be released during chemical reactions. Organic molecules, such as glucose, store a great deal of potential energy. The breakdown of glucose releases energy that is harnessed to make energy intermediate molecules such as ATP. Table below summarizes chemical potential energy and other forms of energy that are common in biological systems. An important issue in biology is the ability of energy to be converted from one form to another. The study of energy interconversions is called thermodynamics. Physicists have determined that two laws govern energy interconversions:

1. The first law of thermodynamics
—The first law of thermodynamics, also called the law of conservation of energy, states that energy cannot be created or destroyed. However, energy can be transferred from one place to another and can be transformed from one type to another (as when, for example, chemical energy is transformed into heat).

2. The second law of thermodynamics
—The second law states that any energy transfer or transformation from one form to another increases the degree of disorder of a system, called entropy (Figure below). Entropy is a measure of the randomness of molecules in a system. When a physical system becomes more disordered, the entropy increases. As the energy becomes more evenly distributed, that energy is less able to promote change or do work. When energy is converted from one form to another, some energy may become unusable by living organisms. For example, a chemical reaction may release unusable heat.


Entropy, a measure of the disorder of a system. An increase in entropy means an increase in disorder.

The change in free energy determines the direction of a chemical reaction
Energy is required for many cellular processes, including chemical reactions, cellular movements such as those occurring in muscle contraction, and the maintenance of cell organization. To understand how organisms use energy, we need to distinguish between the energy that can be used to promote change or do work (usable energy) and the energy that cannot (unusable energy). Why is some energy unusable? The main culprit is entropy. As stated by the second law of thermodynamics, energy transfers or transformations involve an increase in entropy, a degree of disorder that cannot be harnessed in a useful way. The total energy is termed enthalpy (H ), and the usable energy—the amount of available energy that can be used to promote change or do work—is called the free energy (G). The letter G is in recognition of the American physicist J. Willard Gibbs, who proposed the concept of free energy in 1878. The unusable energy is the system’s entropy (S). A critical issue in biology is whether a process does or does not occur spontaneously. For example, will glucose be broken down into carbon dioxide and water? Another way of framing this question is to ask: “Is the breakdown of glucose a spontaneous reaction?” A spontaneous reaction or process is one that occurs without being driven by an input of energy. However, a spontaneous reaction does not necessarily proceed quickly. In some cases, the rate of a spontaneous reaction can be quite slow. For example, the breakdown of sugar is a spontaneous reaction, but the rate at which sugar in a sugar bowl breaks down into CO2 and H2O is very slow. Chemists have determined free-energy changes for a variety of chemical reactions, which allows them to predict their direction. As an example, let’s consider adenosine triphosphate (ATP), which is a molecule that is a common energy source for all cells. ATP is broken down to adenosine diphosphate (ADP) and inorganic phosphate (HPO4 2–, abbreviated Pi). Because water is used to remove a phosphate group, chemists refer to this reaction as the hydrolysis of ATP (Figure below).



The hydrolysis of ATP to ADP and Pi. 
As shown in this figure, ATP has a net charge of –4, while ADP and Pi are shown with net charges of 22 each. When these compounds are shown in chemical reactions with other molecules, the net charges are also indicated. Otherwise, these compounds are simply designated ATP, ADP, and Pi. At neutral pH, ADP2– dissociates to ADP3– and H+.

In converting 1 mole of ATP to 1 mole of ADP and Pi, ΔG equals –7.3 kcal/mol. Because this is a negative value, the reaction strongly favors the formation of products. As discussed later, the energy liberated by the hydrolysis of ATP is used to drive a variety of cellular processes.

Chemical reactions eventually reach a state of equilibrium
Even when a chemical reaction is associated with a negative freeenergy change, not all of the reactants are converted to products. The reaction reaches a state of chemical equilibrium in which the rate of formation of products equals the rate of formation of reactants.

Cells use ATP to drive endergonic reactions
In living organisms, many vital processes require the addition of free energy; that is, they are endergonic and do not occur spontaneously. How do cells overcome this problem? Cells often couple exergonic reactions with endergonic reactions. If an exergonic reaction is coupled with an endergonic reaction, the endergonic reaction will proceed spontaneously if the net free-energy change for both processes combined is negative.

Enzymes and Ribozymes
For most chemical reactions in cells to proceed at a rapid pace, a catalyst is needed. A catalyst is an agent that speeds up the rate of a chemical reaction without being permanently changed or consumed by it. In living cells, the most common catalysts are enzymes, which are proteins. The term was coined in 1876 by a German physiologist, Wilhelm Kühne, who discovered trypsin, an enzyme in pancreatic juice that is needed for the digestion of food proteins. In this section, we will explore how enzymes increase the rates of chemical reactions. Interestingly, some biological catalysts are RNA molecules called ribozymes.

Enzymes increase the rates of chemical reactions
If a chemical reaction has a negative free-energy change, the reaction will be spontaneous; it will tend to proceed in the direction of reactants to products. Although thermodynamics governs the direction of an energy transformation, it does not determine the rate of a chemical reaction. For example, the breakdown of the molecules in gasoline to smaller molecules is an exergonic reaction. Even so, we could place gasoline and oxygen in a container and nothing much would happen (provided it wasn’t near a flame). If we came back several days later, we would expect to see the gasoline still sitting there. Perhaps if we came back in a few million years, the gasoline would have been broken down. On a timescale of months or a few years, however, the chemical reaction would proceed very slowly. In living cells, the rates of enzyme-catalyzed reactions typically occur millions of times faster than the corresponding uncatalyzed reactions. A dramatic example involves the enzyme catalase, which catalyzes the breakdown of hydrogen peroxide (H2O2) into water and oxygen. Catalase speeds up this reaction 1015-fold faster than the uncatalyzed reaction! Why are catalysts necessary to speed up a chemical reaction? Chemical reactions between molecules involve bond breaking and bond forming. When a covalent bond is broken or formed, this process initially involves the straining or stretching of one or more bonds in the starting molecule(s), and/or it may involve the positioning of two molecules so they interact with each other properly. Enzymes help to facilitate these kinds of events. For a reaction to occur between glucose and ATP, the molecules must collide in the correct orientation and possess enough energy so the chemical bonds can be changed. As glucose and ATP approach each other, electrons in the outer shells of their atoms repel each other. To overcome this repulsion, an initial input of energy, called the activation energy, is required (Figure below).



Activation energy of a chemical reaction. 
This figure depicts an exergonic reaction. The activation energy (EA) is needed for molecules to achieve a transition state. One way that enzymes lower the activation energy is by straining chemical bonds in the reactants so less energy is required to attain the transition state. A second way is by binding two reactants so they are close to each other and in a favorable orientation.

Activation energy (EA) allows the molecules to get close enough to cause a rearrangement of bonds. With the input of activation energy, glucose and ATP can achieve a transition state in which the original bonds have stretched to their limit. Once the reactants have reached the transition state, the chemical reaction can readily proceed to the formation of products, which in this case is glucose-6-phosphate and ADP. The activation energy required to achieve the transition state is a barrier to the formation of products. This barrier is the reason why the rate of many chemical reactions is very slow. Enzymes lower the activation energy to a point where a small amount of available heat can push the reactants to a transition state. How do enzymes lower the activation energy barrier of chemical reactions? Let's consider two common ways that enzymes exert their effects.

- Enzymes are proteins that bind relatively small reactants. When bound to an enzyme, the bonds in the reactants can be strained, thereby making it easier for them to achieve the transition state (see Figure above).

- In addition, when a chemical reaction involves two or more reactants, the enzyme provides a site in which the reactants are positioned very close to each other in an orientation that facilitates the formation of new covalent bonds. This also lowers the necessary activation energy for a chemical reaction.

Enzymes recognize their substrates with high specificity and undergo conformational changes
Thus far, we have considered how enzymes lower the activation energy of a chemical reaction, and thereby increase its rate. Let’s consider some other features of enzymes that enable them to serve as effective catalysts in chemical reactions. The active site is the location in an enzyme where the chemical reaction takes place. The substrates for an enzyme are the reactant molecules that bind to an enzyme at the active site and participate in the chemical reaction. For example, hexokinase is an enzyme whose substrates are glucose and ATP (Figure below).


The steps of an enzyme-catalyzed reaction. 
The example shown here involves the enzyme hexokinase, which binds glucose and ATP. The products are glucose-6-phosphate and ADP, which are released from the enzyme.

The binding between an enzyme and substrate produces an enzyme-substrate complex. A key feature of nearly all enzymes is their ability to bind their substrates with a high degree of specificity. For example, hexokinase recognizes glucose but does not recognize other similar sugars, such as fructose and galactose, very well. In 1894, the German chemist Emil Fischer proposed that the recognition of a substrate by an enzyme resembles the interaction between a lock and key: Only the right-sized key (the substrate) will fit into the keyhole (active site) of the lock (the enzyme). Further research revealed that the interaction between an enzyme and its substrates also involves movements or conformational changes in the enzyme itself. As shown in step 2 in Figure above, these conformational changes cause the substrates to bind more tightly to the enzyme, a phenomenon called induced fit, which was proposed by American biochemist Daniel Koshland in 1958. Only after this induced fit takes place does the enzyme catalyze the conversion of reactants to products. Induced fit is a key phenomenon that lowers the activation energy.

Enzyme function is influenced by the substrate concentration and by inhibitors
The degree of attraction between an enzyme and its substrate(s) is called the affinity of the enzyme for its substrate(s). Some enzymes recognize their substrates with very high affinity, which means they have a strong attraction for their substrates. Such enzymes bind their substrates even when the substrate concentration is relatively low. Other enzymes recognize their substrates with lower affinity; the enzyme-substrate complex is likely to form when the substrate concentration is higher. Let’s consider how biologists analyze the relationship between substrate concentration and enzyme function. In the experiment of Figure a below, tubes labeled A, B, C, and D each contained 1 μg of enzyme, but they varied in the amount of substrate that was added.



The relationship between velocity and substrate concentration in an enzyme-catalyzed reaction, and the effects of inhibitors. 
(a) In the absence of an inhibitor, the maximal velocity (Vmax) is achieved when the substrate concentration is high enough to be saturating. The KM value is the substrate concentration at which the
velocity is half the maximal velocity. 
(b) A competitive inhibitor binds to the active site of an enzyme and raises the KM for the substrate.
(c) A noncompetitive inhibitor binds to an allosteric site outside the active site and lowers the Vmax for the reaction.

This enzyme recognizes a single substrate and converts it to a product. The samples were incubated for 60 seconds, and then the amount of product in each tube was measured. The velocity or rate of the chemical reaction is expressed as the amount of product produced per second. As we see in Figure 6.7a, the velocity increases as the substrate concentration increases, but eventually reaches a plateau. Why does the plateau occur? At high substrate concentrations, nearly all of the active sites of the enzyme are occupied with substrate, so increasing the substrate concentration further has a negligible effect. At this point, the enzyme is saturated with substrate, and the velocity of the chemical reaction is near its maximal rate, called its Vmax. Figure a also helps us understand the relationship between substrate concentration and velocity. The KM is the substrate concentration at which the velocity is half its maximal value. The KM is also called the Michaelis constant in honor of the German biochemist Leonor Michaelis, who carried out pioneering work with the Canadian biochemist Maud Menten on the study of enzymes. The KM is a measure of the substrate concentration required for a chemical reaction to occur. An enzyme with a high KM requires a higher substrate concentration to achieve a particular reaction velocity compared to an enzyme with a lower KM.

If the second step—the rate of product formation—is much slower than the rate of substrate release, the KM is inversely related to the affinity between the enzyme and substrate. For example, let’s consider an enzyme that breaks down ATP into ADP and Pi. If the rate of formation of ADP and Pi is much slower than the rate of ATP release, the KM and affinity show an inverse relationship. Enzymes with a high KM have a low affinity for their substrates— they bind them more weakly. By comparison, enzymes with a low KM have a high affinity for their substrates—they bind them more strongly. Now that we understand the relationship between substrate concentration and the velocity of an enzyme-catalyzed reaction, we can explore how inhibitors may affect enzyme function. These can be categorized as reversible inhibitors that bind noncovalently to an enzyme or irreversible inhibitors that usually bind covalently to an enzyme and permanently inactivate its function.

Reversible Inhibitors Cells often use reversible inhibitors to modulate enzyme function. Competitive inhibitors are molecules that bind noncovalently to the active site of an enzyme and inhibit the ability of the substrate to bind. Such inhibitors compete with the substrate for the ability to bind to the enzyme. Competitive inhibitors usually have a structure or a portion of their structure that mimics the structure of the enzyme’s substrate. As seen in Figure b, when competitive inhibitors are present, the apparent KM for the substrate increases—a higher concentration of substrate is needed to achieve the same rate of the chemical reaction. In this case, the effects of the competitive inhibitor can be overcome by increasing the concentration of the substrate.

By comparison, Figure c illustrates the effects of a noncompetitive inhibitor. This type of inhibitor lowers the Vmax for the reaction without affecting the KM. A noncompetitive inhibitor binds noncovalently to an enzyme at a location outside the active site, called an allosteric site, and inhibits the enzyme’s function.

Irreversible Inhibitors Irreversible inhibitors usually bind covalently to an enzyme to inhibit its function. For example, some irreversible inhibitors bind covalently to an amino acid at the active site of an enzyme, thereby preventing it from catalyzing a chemical reaction. An example of an irreversible inhibitor is diisopropyl phosphorofluoridate (DIFP). DIFP is a type of nerve gas that was developed as a chemical weapon. This molecule covalently reacts with the enzyme acetylcholinesterase, which is important for the proper functioning of neurons. Irreversible inhibition is not a common way for cells to control enzyme function. Why do cells usually control enzymes via reversible inhibitors? The answer is that a reversible inhibitor allows an enzyme to be used again, when the inhibitor concentration becomes lowered. Being able to reuse an enzyme is energy efficient. In contrast, irreversible inhibitors permanently inactivate an enzyme, thereby preventing its further use.

Additional factors influence enzyme function
Enzymes, which are proteins, sometimes require nonprotein molecules or ions to carry out their functions.

- Prosthetic groups are small molecules that are permanently attached to the surface of an enzyme and aid in enzyme function.
- Cofactors are usually inorganic ions, such as Fe3+ or Zn2+, that temporarily bind to the surface of an enzyme and promote a chemical reaction.
- Some enzymes use coenzymes, organic molecules that temporarily bind to an enzyme and participate in the chemical reaction, but are left unchanged after the reaction is completed.

The ability of enzymes to increase the rate of a chemical reaction is also affected by their environment. In particular, the temperature, pH, and ionic conditions play an important role in the proper functioning of enzymes. Most enzymes function maximally in a narrow range of temperature and pH. For example, many human enzymes work best at 37°C (98.6°F), which is the normal body temperature. If the temperature is several degrees above or below an enzyme’s optimum temperature due to infection or environmental causes, the function of many enzymes is greatly inhibited (Figure below).


Effects of temperature on a typical human enzyme.
Most enzymes function optimally within a narrow range of temperature. Many human enzymes function best at 37oC, which is normal body temperature.

Very high temperatures may denature a protein, causing it to unfold and lose its three-dimensional shape, thereby inhibiting its function. Enzyme function is also sensitive to pH. Certain enzymes in the stomach function best at the acidic pH found in this organ. For example, pepsin is a protease—an enzyme that digests proteins into peptides—that is released into the stomach. The optimal pH for pepsin function is around pH 2.0, which is extremely acidic. By comparison, many cytosolic enzymes function optimally at a more neutral pH, such as pH 7.2, which is the pH normally found in the cytosol of human cells. If the pH was significantly above or below this value, enzyme function would be decreased for cytosolic enzymes.

Overview of Metabolism

In the previous sections, we examined the underlying factors that govern individual chemical reactions and explored the properties of enzymes and ribozymes. In living cells, chemical reactions are coordinated with each other and often occur in metabolic pathways, with each step catalyzed by a specific enzyme (Figure below).


A metabolic pathway.
In this metabolic pathway, a series of different enzymes catalyze the attachment of phosphate groups at several positions on a sugar molecule, beginning with a starting substrate and ending with a final product.

These pathways are categorized according to whether the reactions lead to the breakdown or synthesis of substances. Catabolic reactions result in the breakdown of larger molecules into smaller ones. Such reactions are often exergonic. By comparison, anabolic reactions involve the synthesis of larger molecules from smaller precursor molecules. These reactions usually are endergonic and, in living cells, must be coupled to an exergonic reaction. In this section, we will survey the general features of catabolic and anabolic reactions and explore the ways in which metabolic pathways are controlled.

Catabolic reactions recycle organic building blocks and produce energy intermediates such as ATP
Catabolic reactions result in the breakdown of larger molecules into smaller ones. Such catabolic reactions have two advantages.

Recycling of Organic Building Blocks One reason for the breakdown of macromolecules is to recycle their organic molecules, which are used as building blocks to construct new molecules and macromolecules. For example, polypeptides, which make up proteins, are composed of a linear sequence of amino acids. When a protein is improperly folded or is no longer needed by a cell, the peptide bonds between the amino acids in the protein are broken by enzymes called proteases. This generates amino acids that can be used in the construction of new proteins.

                         Proteases
Protein → → → → → → → → → → Many individual amino acids

Breakdown of Organic Molecules to Obtain Energy A second reason for the breakdown of macromolecules into smaller organic molecules is to obtain energy that is used to drive endergonic processes in the cell. Covalent bonds store a large amount of energy. However, when cells break covalent bonds in organic molecules such as glucose, they do not directly use the energy released in this process. Instead, the released energy is stored in energy intermediates, molecules such as ATP, which are directly used to drive endergonic reactions in cells. As an example, let’s consider the breakdown of glucose into two molecules of pyruvate. As discussed in Chapter 7, the breakdown of glucose to pyruvate involves a catabolic pathway called glycolysis. Some of the energy released during the breakage of covalent bonds in glucose is harnessed to synthesize ATP. Glycolysis involves a series of steps in which covalent bonds are broken and rearranged. This process produces molecules that readily donate a phosphate group to ADP, thereby producing ATP. For example, phosphoenolpyruvate has a phosphate group attached to pyruvate. Due to the arrangement of bonds in phosphoenolpyruvate, this phosphate bond is unstable and easily broken. Therefore, the phosphate can be readily transferred from phosphoenolpyruvate to ADP:



This is an exergonic reaction (DG  –7.5 kcal/mol) and therefore favors the formation of products. In this step of glycolysis, the breakdown of an organic molecule, namely phosphoenolpyruvate, results in the formation of pyruvate and the synthesis of an energy intermediate molecule, ATP, which can then be used by a cell to drive endergonic reactions. This way of synthesizing ATP, termed substrate-level phosphorylation, occurs when an enzyme directly transfers a phosphate from an organic molecule to ADP, thereby making ATP. Another way to make ATP is via chemiosmosis. In this process, energy stored in an ion electrochemical gradient is used to make ATP from ADP and Pi.

Redox reactions involve the transfer of electrons
During the breakdown of small organic molecules, oxidation—the removal of one or more electrons from an atom or molecule—may occur. This process is called oxidation because oxygen is frequently involved in chemical reactions that remove electrons from other molecules. By comparison, reduction is the addition of electrons to an atom or molecule. Reduction is so named because the addition of a negatively charged electron reduces the net charge of a molecule. Electrons do not exist freely in solution. When an atom or molecule is oxidized, the electron that is removed must be transferred to another atom or molecule, which becomes reduced. This type of reaction is termed a redox reaction, which is short for a reductionoxidation reaction. As a generalized equation, an electron may be transferred from molecule A to molecule B as follows:

Ae–   +   B   →   A   +   Be–
                   (oxidized) (reduced)

As shown on the right side of this reaction, A has been oxidized (that is, had an electron removed), and B has been reduced (that is, had an electron added). In general, a substance that has been oxidized has less energy, whereas a substance that has been reduced has more energy. During the oxidation of organic molecules such as glucose, the electrons may be used to produce energy intermediates such as NADH (Figure below).



The reduction of NAD1 to produce NADH. 
NAD+ is composed of two nucleotides, one with an adenine base and one with a nicotinamide base. The oxidation of organic molecules releases electrons that bind to NAD+ (and along with a hydrogen ion) result in the formation of NADH. The two electrons and H+ are incorporated into the nicotinamide ring. Note: The actual net charges of NAD+ and NADH are 1 and 2, respectively. They are designated NAD+ and NADH to emphasize the net charge of the nicotinamide ring, which is involved in reduction-oxidation reactions

In this process, an organic molecule has been oxidized, and NAD1 (nicotinamide adenine dinucleotide) has been reduced to NADH. Cells use NADH in two common ways. First, as we will see in Chapter 7, the oxidation of NADH is a highly exergonic reaction that can be used to make ATP. Second, NADH can donate electrons to other organic molecules and thereby energize them. Such energized molecules can more readily form covalent bonds. Therefore, as described next, NADH is often needed in reactions that involve the synthesis of larger molecules through the formation of covalent bonds between smaller molecules.

Anabolic reactions require an input of energy to make larger molecules
Anabolic reactions are also called biosynthetic reactions, because they are necessary to make larger molecules and macromolecules. Cells also need to synthesize small organic molecules, such as amino acids and fats, if they are not readily available from food sources. Such molecules are made by the formation of covalent linkages between precursor molecules. For example, glutamate (an amino acid) is made by the covalent linkage between α-ketoglutarate (a product of sugar metabolism) and ammonium (NH4 +).



In this reaction, an energy intermediate molecule, NADH, is needed to drive the reaction forward.

Metabolic pathways are regulated in three general ways
The regulation of metabolic pathways is important for a variety of reasons. Catabolic pathways are regulated so organic molecules are broken down only when they are no longer needed or when the cell requires energy. During anabolic reactions, regulation ensures that a cell synthesizes molecules only when they are needed. The regulation of catabolic and anabolic pathways occurs at the genetic, cellular, and biochemical levels.

Gene Regulation Enzymes are protein molecules that are encoded by genes. One way that cells control metabolic pathways is via gene regulation. For example, if a bacterial cell is not exposed to a particular sugar in its environment, it will turn off the genes that encode the enzymes that are needed to break down that sugar. Alternatively, if the sugar becomes available, the genes are switched on.

Cellular Regulation Metabolism is also coordinated at the cellular level. Cells integrate signals from their environment and adjust their metabolic pathways to adapt to those signals.  Cell-signaling pathways often lead to the activation of protein kinases—enzymes that covalently attach a phosphate group to target proteins. For example, when people are frightened, they secrete a hormone called epinephrine into their bloodstream. This hormone binds to the surface of muscle cells and stimulates an intracellular pathway that leads to the phosphorylation of specific enzymes involved in carbohydrate metabolism. These activated enzymes promote the breakdown of carbohydrates, an event that supplies the frightened individual with more energy. Epinephrine is sometimes called the “fight-or-flight” hormone because the added energy prepares an individual to either stay and fight or run away quickly. After a person is no longer frightened, hormone levels drop, and other enzymes called phosphatases remove the phosphate groups from enzymes, thereby restoring the original level of carbohydrate metabolism.

Biochemical Regulation A third and very prominent way that metabolic pathways are controlled is at the biochemical level. In this case, the noncovalent binding of a molecule to an enzyme directly regulates its function. As discussed earlier, one form of biochemical regulation involves the binding of molecules such as competitive or noncompetitive inhibitors. An example of noncompetitive inhibition is a type of regulation called feedback inhibition, in which the product of a metabolic pathway inhibits an enzyme that acts early in the pathway, thus preventing the overaccumulation of the product (Figure below).


Feedback inhibition.
In this process, the final product of a metabolic pathway inhibits an enzyme that functions in the pathway, thereby preventing the overaccumulation of the product.

Many metabolic pathways use feedback inhibition as a form of biochemical regulation. In such cases, the inhibited enzyme has two binding sites. One site is the active site, where the reactants are converted to products. In addition, enzymes controlled by feedback inhibition also have an allosteric site, where a molecule can bind noncovalently and affect the function of the active site. The binding of a molecule to an allosteric site causes a conformational change in the enzyme that inhibits its catalytic function. Allosteric sites are often found in the enzymes that catalyze the early steps in a metabolic pathway. Such allosteric sites typically bind molecules that are the products of the metabolic pathway. When the products bind to these sites, they inhibit the function of these enzymes, thereby preventing the formation of too much product.

Regulation of the Rate-Limiting Step Cellular regulation and biochemical regulation are important and rapid ways to control chemical reactions in a cell. For a metabolic pathway composed of several enzymes, which enzyme in a pathway should be controlled? In many cases, a metabolic pathway has a rate-limiting step, which is the slowest step in the pathway. If the rate-limiting step is inhibited or enhanced, such changes will have the greatest influence on the formation of the product of the metabolic pathway. Rather than affecting all of the enzymes in a metabolic pathway, cellular or biochemical regulation is often directed at the enzyme that catalyzes the rate-limiting step. This is an efficient and rapid way to control the amount of product of a pathway.

Recycling of organic molecules
Another important feature of metabolism is the recycling of organic molecules, such as amino acids, which are the building blocks of proteins. Except for DNA, which is stably maintained and inherited from cell to cell, other large molecules such as RNA, proteins, lipids, and polysaccharides typically exist for a relatively short period of time. Biologists often speak of the half-life of molecules, which is the time it takes for 50% of the molecules to be broken down and recycled. For example, a population of messenger RNA molecules in bacteria has an average half-life of about 5 minutes, whereas mRNAs in eukaryotes tend to exist for longer periods of time, on the order of 30 minutes to 24 hours or even several days Why is recycling important? To compete effectively in their native environments, all living organisms must efficiently use and recycle the organic molecules that are needed as building blocks to construct larger molecules and macromolecules. Otherwise, they would waste a great deal of energy making such building blocks from smaller molecules. For example, organisms conserve an enormous amount of energy by reusing the amino acids that are needed to construct proteins. In this section, we will explore how amino acids are recycled and consider a mechanism for the recycling of materials found in an entire organelle.

Proteins in eukaryotes and archaea are broken down in the proteasome
Cells continually degrade proteins that are faulty or no longer needed. To be degraded, proteins are recognized by proteases—enzymes that cleave the bonds between adjacent amino acids. The primary pathway for protein degradation in archaea and eukaryotic cells is via a protein complex called a proteasome. The core of the proteasome consists of four stacked rings, each composed of seven protein subunits (Figure a below ).


Protein degradation via the proteasome.

The proteasomes of eukaryotic cells also contain caps at each end that control the entry of proteins into the proteasome. Figure b describes the steps of protein degradation via eukaryotic proteasomes. A string of small proteins called ubiquitin is covalently attached to the target protein. This event directs the target protein to a proteasome cap, which has binding sites for ubiquitin. The cap also has enzymes that unfold the protein and inject it into the internal cavity of the proteasome core. The ubiquitins are removed during entry and released to the cytosol for reuse. Inside the proteasome, proteases degrade the target protein into small peptides and amino acids. The process is completed when the peptides and amino acids are recycled back into the cytosol. The amino acids are reused to make new proteins. Ubiquitin targeting has two functions.

- First, the enzymes that attach ubiquitins to its target recognize improperly folded proteins, allowing cells to identify and degrade nonfunctional proteins.
- Second, changes in cellular conditions may warrant the rapid breakdown of particular proteins. For example, cell division requires a series of stages called the cell cycle, which depends on the degradation of specific proteins. After these proteins perform their functions in the cycle, ubiquitin targeting directs them to the proteasome for degradation.

Autophagy recycles the contents of entire organelles

Lysosomes contain many different types of acid hydrolases that break down proteins, carbohydrates, nucleic acids, and lipids. This enzymatic function enables lysosomes to break down complex materials. One function of lysosomes involves the digestion of substances that are taken up from outside the cell. This process, called endocytosis, is described in Chapter 5. In addition, lysosomes help digest intracellular materials. In a process known as autophagy (from the Greek, meaning eating one’s self), cellular material, such as a worn-out organelle, becomes enclosed in a double membrane (Figure below).


Autophagy.

This double membrane is formed from a tubule that elongates and eventually wraps around the organelle to form an autophagosome. The autophagosome then fuses with one or more lysosomes, and the material inside the autophagosome is digested. The small molecules released from this digestion are recycled back into the cytosol.

Cellular respiration and fermentation

We will begin by surveying a group of chemical reactions that accomplish the breakdown of carbohydrates, namely, the sugar glucose. As you will learn, cells carry out an intricate series of reactions so that glucose can be “burned” in a very controlled fashion when oxygen is available. We will then examine how cells use organic molecules in the absence of oxygen via processes known as anaerobic respiration and fermentation

Overview of cellular respiration
Cellular respiration is a process by which living cells obtain energy from organic molecules and release waste products. A primary aim of cellular respiration is to make adenosine triphosphate, or ATP. When oxygen (O2) is used, this process is termed aerobic respiration. During aerobic respiration, O2 is consumed, and carbon dioxide (CO2) is released via the oxidation of organic molecules. When we breathe, we inhale the oxygen needed for aerobic respiration and exhale CO2, a by-product of the process. For this reason, the term respiration has a second meaning, which is the act of breathing. Different types of organic molecules, such as carbohydrates, proteins, and fats, are used as energy sources to drive aerobic respiration. In this chapter, we will largely focus on the use of glucose as an energy source for cellular respiration. We will focus on the breakdown of glucose in a eukaryotic cell
in the presence of oxygen. Certain covalent bonds within glucose store a large amount of chemical potential energy. When glucose is broken down via oxidation, ultimately to CO2 and water, a tremendous amount of free energy is released (-685 kcal/mol). Some of the energy is lost as heat, but much of it is used to make three energy intermediates: ATP, NADH, and FADH2. This process involves four metabolic pathways:

(1) glycolysis,
(2) the breakdown of pyruvate,
(3) the citric acid cycle, and
(4) oxidative phosphorylation


An overview of cellular respiration. 
The 30–34 ATP molecules produced via chemiosmosis is the maximum number possible. As described later in this chapter, mitochondria may use NADH, FADH2, and the H gradient for purposes other than ATP synthesis.

1. Glycolysis: In glycolysis, glucose (a compound with six carbon atoms) is broken down to two pyruvate molecules (with three carbons each), producing a net energy yield of two ATP molecules and two NADH molecules. The two ATP are synthesized via substrate-level phosphorylation, which occurs when an enzyme directly transfers a phosphate from an organic molecule to ADP. In eukaryotes, glycolysis occurs in the cytosol.

2. Breakdown of pyruvate: The two pyruvate molecules enter the mitochondrial matrix, where each one is broken down to an acetyl group (with two carbons each) and one CO2 molecule. For each pyruvate broken down via oxidation, one NADH molecule is made by the reduction of NAD+.

3. Citric acid cycle: Each acetyl group is incorporated into an organic molecule, which is later oxidized to liberate two CO2 molecules. One ATP, three NADH, and one FADH2 are made in this process. Because there are two acetyl groups (one from each pyruvate), the total yield is four CO2, two ATP via substrate-level phosphorylation, six NADH, and two FADH2. This process occurs in the mitochondrial matrix.

4. Oxidative phosphorylation: The NADH and FADH2 made in the three previous stages contain high-energy electrons that can be readily transferred in a redox reaction to other molecules. Once removed from NADH or FADH2, these
high-energy electrons release some energy, and through an electron transport chain, that energy is harnessed to produce an H+ electrochemical gradient. In chemiosmosis, energy stored in the H+ electrochemical gradient is used
to synthesize ATP from ADP and Pi. The overall process of electron transport and ATP synthesis is called oxidative phosphorylation because NADH or FADH2 have been oxidized and ADP has become phosphorylated to make ATP. Approximately 30–34 ATP molecules are made via oxidative phosphorylation.

In eukaryotes, oxidation phosphorylation occurs along the cristae, which are invaginations of the inner mitochondrial membrane. The invaginations greatly increase the surface area of the inner membrane and thereby increase the amount of ATP that can be made. In bacteria and archaea, oxidative phosphorylation occurs along the plasma membrane.

Glycolysis
Thus far, we have examined the general features of the four metabolic pathways that are involved in the breakdown of glucose. We will now turn our attention to a more detailed understanding of the pathways for glucose metabolism, beginning with glycolysis.

Glycolysis Is a metabolic pathway that breaks down glucose to pyruvate
Glycolysis (from the Greek glykos, meaning sweet, and lysis, meaning splitting) involves the breakdown of glucose, a simple sugar, into two molecules of a compound called pyruvate. This process can occur in the presence of oxygen, that is, under aerobic conditions, and it can also occur in the absence of oxygen. During the 1930s, the efforts of several German biochemists, including Gustav Embden, Otto Meyerhof, and Jacob Parnas, determined that glycolysis involves 10 steps, each one catalyzed by a different enzyme. The elucidation of these steps was a major achievement in the field of biochemistry—the study of the chemistry of living organisms. Researchers have since discovered that glycolysis is the common pathway for glucose breakdown in bacteria, archaea, and eukaryotes. Remarkably, the steps of glycolysis are virtually identical in nearly all living species, suggesting that glycolysis arose very early in the evolution of life on our planet. The 10 steps of glycolysis can be grouped into three phases (Figure below).


Overview of glycolysis.

- The first phase (steps 1–3) involves an energy investment. Two ATP molecules are hydrolyzed, and the phosphates from those ATP molecules are attached to glucose, which is converted to fructose- 1,6-bisphosphate. The energy investment phase raises the free energy of glucose, thereby allowing later reactions to be exergonic.
- The cleavage phase (steps 4–5) breaks this six-carbon molecule into two molecules of glyceraldehyde-3-phosphate.
- The energy liberation phase (steps 6–10) produces four ATP, two NADH, and two molecules of pyruvate. Because two molecules of ATP are used in the energy investment phase, the net yield is two molecules of ATP. Figure below describes the details of the 10 reactions of glycolysis.





Regulation of Glycolysis How do cells control glycolysis? The rate of glycolysis is regulated by the availability of substrates, such as glucose, and by feedback inhibition. A key control point involves the enzyme phosphofructokinase, which catalyzes the third step in glycolysis, the step believed to be the slowest, or rate-limiting, step. When a cell has a sufficient amount of ATP, feedback inhibition occurs. At high concentrations, ATP binds to an allosteric site in phosphofructokinase, causing a conformational change that renders the enzyme functionally inactive. This prevents the further breakdown of glucose and thereby inhibits the overproduction of ATP.

Breakdown of Pyruvate
In eukaryotes, glycolysis produces pyruvate in the cytosol, which is then transported into the mitochondria. Once in the mitochondrial matrix, pyruvate molecules are broken down (oxidized) by an enzyme complex called pyruvate dehydrogenase (Figure below).


Breakdown of pyruvate and the attachment of an acetyl group to CoA.

A molecule of CO2 is removed from pyruvate, and the remaining acetyl group is attached to an organic molecule called coenzyme A (CoA) to produce acetyl CoA. (In chemical equations, CoA is depicted as CoA—SH to emphasize how the SH group participates in the chemical reaction.) During this process, two high-energy electrons are removed from pyruvate and transferred to NAD and together with H produce a molecule of NADH. The acetyl group is attached to CoA via a covalent bond to a sulfur atom. The hydrolysis of this bond releases a large amount of free energy, making it possible for the acetyl group to be transferred to other organic molecules. As described next, the acetyl group is removed from CoA and enters the citric acid cycle.

Citric Acid Cycle
The third stage of glucose metabolism introduces a new concept, that of a metabolic cycle. During a metabolic cycle, particular molecules enter the cycle while others leave. The process is cyclical because it involves a series of organic molecules that are regenerated with each turn of the cycle. The idea of a metabolic cycle was first proposed in the early 1930s by the German biochemist Hans Krebs. While studying carbohydrate metabolism in England, he analyzed cell extracts from pigeon muscle and determined that citric acid and other organic molecules participated in a cycle that resulted in the breakdown of carbohydrates to carbon dioxide. This cycle is called the citric acid cycle, or the Krebs cycle, in honor of Krebs, who was awarded the Nobel Prize in Physiology or Medicine in 1953. An overview of the citric acid cycle is shown in Figure below.


Overview of the citric acid cycle.

In the first step of the cycle, the acetyl group (with two carbons) is removed from acetyl CoA and attached to oxaloacetate (with four carbons) to form citrate (with six carbons), also called citric acid. Then, in a series of several steps, two CO2 molecules are released. As this occurs, three molecules of NADH, one molecule of FADH2, and one molecule of guanine triphosphate (GTP) are made. The GTP, which is made via substrate-level phosphorylation, is used to make ATP. After a total of eight steps, oxaloacetate is regenerated so the cycle can begin again, provided acetyl CoA is available. Figure below shows a more detailed view of the citric acid cycle.


A detailed look at the steps of the citric acid cycle. 
The blue boxes indicate the location of the acetyl group, which is oxidized at step 6. (It is oxidized again in step 8.) The green boxes indicate the locations where CO2 molecules are removed.

Regulation of the Citric Acid Cycle How is the citric acid cycle controlled? The rate of the cycle is largely regulated by the availability of substrates, such as acetyl-CoA and NAD+, and by feedback inhibition. The three steps in the cycle that are highly exergonic are those catalyzed by citrate synthase, isocitrate dehydrogenase, and α-ketoglutarate dehydrogenase (see Figure above). Each of these steps is rate-limiting under certain circumstances, and the way that each enzyme is regulated varies among different species. Let’s consider an example. In mammals, NADH and ATP act as feedback inhibitors of isocitrate dehydrogenase, whereas NAD+ and ADP act as activators. In this way, the citric acid cycle is inhibited when NADH and ATP levels are high, but it is stimulated when NAD+  and ADP levels are high.

Overview of oxidative phosphorylation
During the first three stages of glucose metabolism, the oxidation of glucose yields 6 molecules of CO2, 4 molecules of ATP, 10 molecules of NADH, and 2 molecules of FADH2. Let’s now consider how high-energy electrons are removed from NADH and FADH2 to produce more ATP. This process is called oxidative phosphorylation. The term refers to the observation that electrons are removed from NADH and FADH2, that is, these molecules are oxidized, and ATP is made by the phosphorylation of ADP. The oxidative process involves the electron transport chain, whereas the phosphorylation of ADP occurs via ATP synthase.

The electron transport chain establishes an electrochemical gradient
The electron transport chain (ETC) consists of a group of protein complexes and small organic molecules embedded in the inner mitochondrial membrane. These components are referred to as an electron transport chain because electrons are passed from one component to the next in a series of redox reactions (Figure below).



Most members of the ETC are protein complexes (designated I–IV) that have prosthetic groups, which are small molecules permanently attached to the surface of proteins that aid in their function. For example, cytochrome oxidase contains two prosthetic groups, each with an iron atom. The iron in each prosthetic group can readily accept and release an electron. One member of the ETC, ubiquinone (Q), is not a protein. Rather, ubiquinone is a small organic molecule that can accept and release an electron. The red line in the Figure above shows the path of electron flow. The electrons, which are originally located on NADH or FADH2, are transferred to components of the ETC. The electron path is a series of redox reactions in which electrons are transferred to components with increasingly higher electronegativity. At the end of the chain is oxygen, which is the most electronegative component and the final electron acceptor. The ETC is also called the respiratory chain because the oxygen we breathe is used in this process. NADH and FADH2 donate their electrons at different points in the ETC. Two high-energy electrons from NADH are first transferred one at a time to NADH dehydrogenase (complex I). They are then transferred to ubiquinone (Q), cytochrome b-c1 (complex III), cytochrome c, and cytochrome oxidase (complex IV). The final electron acceptor is O2. By comparison, FADH2 transfers electrons to succinate reductase (complex II), then to ubiquinone, and the rest of the chain. As shown in the Figure above, some of the energy that is released during the movement of electrons is used to pump H across the inner mitochondrial membrane into the intermembrane space. This active transport establishes a large H1 electrochemical gradient, in which the concentration of H+ is higher outside of the matrix than inside and an excess of positive charge exists outside the matrix. Chemicals that inhibit the flow of electrons along the ETC can have lethal effects. For example, one component of the ETC, cytochrome oxidase (complex IV), is inhibited by cyanide. The deadly effects of cyanide ingestion occur because the ETC is shut down, preventing cells from making enough ATP for survival.

ATP Synthase makes ATP via chemiosmosis
The second event of oxidative phosphorylation is the synthesis of ATP by an enzyme called ATP synthase. The H+ electrochemical gradient across the inner mitochondrial membrane is a source of potential energy. How is this energy used? The passive flow of H+ back into the matrix is an exergonic process. The lipid bilayer is relatively impermeable to H+. However, H+ can pass through the membrane-embedded portion of ATP synthase. This enzyme harnesses some of the free energy that is released as the H+ ions flow through its membrane-embedded region to synthesize ATP from ADP and Pi (see bottom of the Figure above ). This is an example of an energy conversion: Energy in the form of an H+ gradient is converted to chemical potential energy in ATP. The synthesis of ATP that occurs as a result of pushing H+ across a membrane is called chemiosmosis (from the Greek osmos, meaning to push). The theory behind it was proposed by Peter Mitchell, a British biochemist who was awarded the Nobel Prize in Chemistry in 1978.

Regulation of Oxidative Phosphorylation
How is oxidative phosphorylation controlled? This process is regulated by a variety of factors, including the availability of ETC substrates, such as NADH and O2, and by the ATP/ADP ratio. When ATP levels are high, ATP binds to a subunit of cytochrome oxidase (complex IV), thereby inhibiting the ETC and oxidative phosphorylation. By comparison, when ADP levels are high, oxidative phosphorylation is stimulated for two reasons: (1) ADP stimulates cytochrome oxidase, and (2) ADP is a substrate that is used (with Pi) to make ATP.

NADH Oxidation makes a large proportion of a cell’s ATP
When we add up the maximal amount of ATP that can be made by oxidative phosphorylation, most researchers agree it is in the range of 30–34 ATP molecules for each glucose molecule that is broken down to CO2 and H2O. However, the maximum amount of ATP is rarely achieved, for two reasons.

- First, although 10 NADH and 2 FADH2 are available to make the H+ electrochemical gradient across the inner mitochondrial membrane, a cell uses some of these molecules for anabolic pathways. For example, NADH is used in the synthesis of organic molecules such as glycerol (a component of phospholipids).
- Second, the mitochondrion may use some of the H+ electrochemical gradient for other purposes. For example, the gradient is used for the uptake of pyruvate into the matrix via an H+/pyruvate symporter;

Therefore, the actual amount of ATP synthesis is usually a little less than the maximum number of 30 to 34. Even so, when we compare the amount of ATP that is made by glycolysis (2), the citric acid cycle (2), and oxidative phosphorylation (30–34), we see that oxidative phosphorylation provides a cell with a much greater capacity to make ATP.

Free-Energy Changes Drive Oxidative Phosphorylation and Other Stages of Glucose Breakdown
Thus far, we have considered (1) glycolysis, (2) the breakdown of pyruvate, (3) the citric acid cycle, and (4) oxidative phosphorylation. All four of these stages are ultimately driven by the oxidation of glucose, which is a highly exergonic process that releases free energy. However, the energy is not released in one big blast, as in an explosion, but rather in small step-wise increments. Releasing the energy in small increments allows cells to couple the breakdown of glucose with useful chemical processes. For example, as we saw earlier in this chapter, the breakdown of glucose to pyruvate is coupled to the synthesis of ATP. Figure below shows how free energy is released as electrons move along the electron transport chain.


The relationship between free energy and electron movement along the electron transport chain. 
As electrons hop from one site to another along the electron transport chain, they release energy. Some of this energy is harnessed to pump H across the inner mitochondrial membrane. The total energy released by a single electron is approximately -25 kcal/mol.

At particular points along the ETC, some of the energy is used to pump H+ across the inner mitochondrial membrane and establish an H+ electrochemical gradient. This gradient is then used to power ATP synthesis.

A closer look at ATP Synthase
The structure and function of ATP synthase are particularly intriguing and have received much attention over the past few decades. In this section, we will consider experiments that were aimed at elucidating this enzyme’s function and explore, in greater depth, how it is able to synthesize ATP.

ATP Synthase is a rotary machine that makes ATP as it spins
ATP synthase is a rotary machine (Figure below). The region embedded in the membrane is composed of three types of subunits called a, b, and c. Approximately 10–14 c subunits form a ring in the membrane. One a subunit is bound to this ring, and two b subunits are attached to the a subunit and protrude from the membrane. The nonmembrane-embedded subunits are designated with Greek letters. One ε and one γ subunit bind to the ring of c subunits. The γ subunit forms a long stalk that pokes into the center of another ring of three α and three β subunits. Each β subunit contains a catalytic site where ATP is made. Finally, the δ subunit forms a connection between the ring of α and β subunits and the two b subunits.


The subunit structure and function of ATP synthase.

When hydrogen ions pass through a narrow channel at the contact site between a c subunit and the a subunit, a conformational change causes the γ subunit to turn clockwise (when viewed from the intermembrane space). Each time the γ subunit turns 120°, it changes its contacts with the three β subunits, which, in turn, causes the β subunits to change their conformations. How do these conformational changes promote ATP synthesis? The answer is that the conformational changes occur in a way that favors ATP synthesis and release. As shown in Figure 7.12, the conformational changes in the β subunits
happen in the following order:

- Conformation 1: ADP and Pi bind with good affinity.
- Conformation 2: ADP and Pi bind so tightly that ATP is made.
- Conformation 3: ATP (and ADP and Pi) bind very weakly, and ATP is released.


Conformational changes that result in ATP synthesis. 
For simplicity, the α subunits are not shown. This drawing emphasizes the conformational changes in the β subunit shown at the top. The other two β subunits also make ATP. All three β subunits alternate between three conformational states due to their interactions with the γ subunit.

Each time the γ subunit turns 120°, it causes a β subunit to change to the next conformation. After conformation 3, a 120° turn by the γ subunit returns a β subunit back to conformation 1, and the cycle of ATP synthesis can begin again. Because ATP synthase has three β subunits, each subunit is in a different conformation at any given time. American biochemist Paul Boyer proposed the concept of a rotary machine in the late 1970s. In his model, the three β subunits alternate between three conformations, as described previously. Boyer’s original idea was met with great skepticism, because the concept that part of an enzyme could spin was very novel, to say the least. In 1994, British biochemist John Walker and his colleagues determined the three-dimensional structure of the nonmembrane-embedded portion of the ATP synthase. The structure revealed that each of the three β subunits had a different conformation—one with ADP bound, one with ATP bound, and one without any nucleotide bound. This result supported Boyer’s model. In 1997, Boyer and Walker shared the Nobel Prize in Chemistry for their work on ATP synthase. As described next in the Feature Investigation, other researchers subsequently visualized the rotation of the γ subunit.

Connections among carbohydrate, protein, and fat metabolism
When you eat a meal, it usually contains not only carbohydrates (including glucose) but also proteins and fats. These molecules are broken down by some of the same enzymes involved with glucose metabolism. By using the same pathways for the breakdown of sugars, amino acids, and fats, cellular metabolism is more efficient because the same enzymes are used for the breakdown of different starting molecules. As shown in Figure below, proteins and fats can enter into glycolysis or the citric acid cycle at different points.


Integration of carbohydrate, protein, and fat  metabolism. 
Breakdown products of proteins and fats are used as fuel for cellular respiration, entering the same pathways used to break down carbohydrates.

- Proteins are first acted on by enzymes, either in digestive juices or within cells, that cleave the bonds connecting individual amino acids. Because the 20 amino acids differ in their side chains, amino acids and their breakdown products can enter at different points in the pathway. Breakdown products of some amino acids can enter at later steps of glycolysis, or an acetyl group can be removed from certain amino acids and become attached to CoA and then enter the citric acid cycle (see Figure above). Other amino acids are modified and enter the citric acid cycle.
- Fats are typically broken down to glycerol and fatty acids. Glycerol can be modified to glyceraldehyde-3-phosphate and enter glycolysis. Lipid tails can have two carbon acetyl units removed, which bind to CoA and enter the citric acid cycle.

Anaerobic respiration and fermentation
Cells  commonly metabolize organic molecules in the absence of oxygen. The term anaerobic is used to describe an environment that lacks oxygen. Many bacteria and archaea and some fungi exist in anaerobic environments but still have to oxidize organic molecules to obtain sufficient amounts of energy. Examples include microbes living in your intestinal tract and those living deep in the soil. Similarly, when a person exercises strenuously, the rate of oxygen consumption by muscle cells may greatly exceed the rate of oxygen delivery—particularly at the start of strenuous exercise. Under these conditions, muscle cells become anaerobic and must obtain sufficient energy in the absence of oxygen to maintain their level of activity. Two different strategies may be used by cells to metabolize organic molecules in the absence of oxygen. One mechanism is to use a substance other than O2 as the final electron acceptor of an electron transport chain, a process called anaerobic respiration. A second approach is to produce ATP only via substrate-level phosphorylation without any net oxidation of organic molecules, a process called fermentation. In
this section, we will consider examples of both strategies.

Some microorganisms carry out anaerobic respiration
At the end of the ETC presented earlier in Figure 7.8, cytochrome oxidase recognizes O2 and catalyzes its reduction to H2O. The final electron acceptor of the chain is O2. Many species of bacteria that live under anaerobic conditions have evolved enzymes that function similarly to cytochrome oxidase but recognize molecules other than O2 and use them as the final electron acceptor. For example, under anaerobic conditions Escherichia coli, a bacterial species found in your intestinal tract, produces an enzyme called nitrate reductase. This enzyme uses nitrate (NO3–) as the final electron acceptor of an electron transport chain. Figure below shows a simplified ETC in E. coli in which nitrate is the final electron acceptor.


An example of anaerobic respiration in E. coli.
When oxygen is absent, E. coli can use nitrate instead of oxygen as the final electron acceptor of an electron transport chain. This generates an H+ electrochemical gradient that is used to make ATP via chemiosmosis. Note: As shown in this figure, ubiquinone (Q) picks up H+ on one side of the membrane and deposits it on the other side. A similar event happens during aerobic respiration in mitochondria, except that ubiquinone transfers H+ to cytochrome b-c1, which pumps it into the intermembrane space.

In E. coli and other bacterial species, the ETC is in the plasma membrane that surrounds the cytoplasm. Electrons travel from NADH to NADH dehydrogenase to ubiquinone (Q) to cytochrome b and then to nitrate reductase. At the end of the chain, NO3 – is converted to nitrite (NO2–). This process generates an H+ electrochemical gradient in three ways. First, NADH dehydrogenase pumps H+ out of the cytoplasm. Second, ubiquinone picks up H+ in the cytoplasm and carries it to the other side of the membrane. Third, the reduction of nitrate to nitrite consumes H+ in the cytoplasm. The generation of an H+ gradient via these three processes allows E. coli cells to make ATP via
chemiosmosis under anaerobic conditions.

Fermentation is the breakdown of organic molecules without net oxidation
Many organisms, including animals and yeast, use only O2 as the final electron acceptor of their ETCs. When confronted with anaerobic conditions, these organisms must have a different way of producing sufficient ATP. One strategy is to make ATP via glycolysis, which can occur under both anaerobic or aerobic conditions. Under anaerobic conditions, cells do not use the citric acid cycle or the ETC, but make ATP only via glycolysis. A key issue is that glycolysis requires NAD+ and generates NADH. Under aerobic conditions, NADH is oxidized to NAD+ to make more ATP. However, this cannot occur under anaerobic conditions in yeast and animals, and, as a result, NADH builds up and NAD+ decreases. This is a potential problem for two reasons:

- First, at high concentrations, NADH haphazardly donates its electrons to other molecules and promotes the formation of free radicals, highly reactive chemicals that damage DNA and cellular proteins. For this reason, yeast and animal cells exposed to anaerobic conditions must have a way to remove the excess NADH generated from the breakdown of glucose.
-  The second problem is the decrease in NAD+. Cells need to regenerate NAD+ to keep glycolysis running and make ATP via substrate-level phosphorylation.

Fermentation in Muscle Cells How do muscle cells cope with the buildup of NADH and decrease in NAD+? When a muscle is working strenuously and becomes anaerobic, as in high-intensity exercise, the pyruvate from glycolysis is reduced to make lactate. (The uncharged, or protonated, form is called lactic acid.) The electrons to reduce pyruvate are derived from NADH, which is oxidized to NAD+ (Figure a below).


Examples of fermentation. 
In these examples, NADH is produced by the oxidation of an organic molecule, and then the NADH is converted back to NAD+ when it donates electrons to a different organic molecule such as pyruvate (a) or acetaldehyde (b).

Therefore, this process decreases NADH and reduces its potentially harmful effects. It also increases the level of NAD+, thereby allowing glycolysis to continue. The lactate is secreted from muscle cells. Once sufficient oxygen is restored, the lactate produced during strenuous exercise can be taken up by cells, converted back to pyruvate, and used for energy, or this lactate may be used by the liver and other tissues to make glucose. Fermentation in Yeast Cells Yeast cells cope with anaerobic conditions differently. During wine making, a yeast cell metabolizes sugar under anaerobic conditions. The pyruvate is broken down to CO2 and a two-carbon molecule called acetaldehyde. The acetaldehyde is then reduced by NADH to make ethanol, while NADH is oxidized to NAD+ (Figure b above).  Similar to lactate production in muscle cells, this decreases NADH and increases NAD+, thereby preventing the harmful effects of NADH and allowing glycolysis to continue. 

The term fermentation is used to describe the breakdown of organic molecules to harness energy without any net oxidation (that is, without any removal of electrons). The pathways of breaking down glucose to lactate or ethanol are examples of fermentation. Although electrons are removed from an organic molecule such as glucose to make pyruvate and NADH, the electrons are donated back to an organic molecule in the production of lactate or ethanol. Therefore, there is no net removal of electrons from an organic molecule. Compared with oxidative phosphorylation, fermentation produces far less ATP, for two reasons. First, glucose is not oxidized completely to CO2 and H2O. Second, the NADH made during glycolysis cannot be used to make more ATP. Overall, the complete breakdown of glucose in the presence of oxygen yields 34–38 ATP molecules. By comparison, the anaerobic breakdown of glucose to lactate or ethanol yields only 2 ATP molecules.

Photosynthesis

Nearly all of the oxygen in every breath you take is made by the abundant plant life, algae, and cyanobacteria on Earth. More than 20% of the world’s oxygen is produced in the Amazon rain forest in South America alone. In rain forests and across all of the Earth, the most visible color on land is green. The green color of plants is due to a pigment called chlorophyll. This pigment provides the starting point for the process of photosynthesis, in which the energy from light is captured and used to synthesize glucose and other organic molecules. Nearly all living organisms ultimately rely on photosynthesis for their nourishment, either directly or indirectly. Photosynthesis is also responsible for producing the oxygen that makes up a large portion of the Earth’s atmosphere. Therefore, all aerobic organisms rely on photosynthesis for cellular respiration. We begin this chapter with an overview of photosynthesis as it occurs in green plants and algae. We will then explore the two stages of photosynthesis in more detail. In the first stage, called the light reactions, light energy is absorbed by chlorophyll and converted to chemical energy in the form of two energy intermediates: ATP and NADPH. During the second stage, known as the Calvin cycle, ATP and NADPH are used to drive the synthesis of carbohydrates. We will conclude with a consideration of the variations in photosynthesis that occur in plants existing in hot and dry conditions.

Overview of Photosynthesis
In the mid-1600s, a Flemish physician, Jan Baptista Van Helmont, conducted an experiment in which he transplanted the shoot of a young willow tree into a bucket of soil and allowed it to grow for 5 years. After this time, the willow tree had added 164 pounds to its original weight, but the soil had lost only 2 ounces. Van Helmont correctly concluded that the willow tree did not get most of its nutrients from the soil. He also hypothesized that the mass of the tree came from the water he had added over the 5 years. This hypothesis was partially correct, but we now know that CO2 from the air is also a major contributor to the growth and mass of plants. In the 1770s, Jan Ingenhousz, a Dutch physician, immersed green plants under water and discovered they released bubbles of oxygen. Ingenhousz determined that sunlight was necessary for oxygen production. During this same period, Jean Senebier, a Swiss botanist, found that CO2 is required for plant growth. With this accumulating information, Julius von Mayer, a German physicist, proposed in 1845 that plants convert light energy from the Sun into chemical energy. For the next several decades, plant biologists studied photosynthesis in plants, algae, and bacteria. Researchers discovered that some photosynthetic bacteria use hydrogen sulfide (H2S) instead of water (H2O) for photosynthesis, and these organisms release sulfur instead of oxygen. In the 1930s, based on this information, Dutch-American microbiologist Cornelis van Niel proposed a general equation for photosynthesis that applies to plants, algae, and photosynthetic bacteria alike.

Photosynthesis powers the biosphere
The term biosphere describes the regions on the surface of the Earth and in the atmosphere where living organisms exist. Organisms can be categorized as heterotrophs and autotrophs. Heterotrophs must consume food—organic molecules from their environment—to sustain life. Most species of bacteria and protists, as well as all species of fungi and animals, are heterotrophs. By comparison, autotrophs sustain themselves by producing organic molecules from inorganic sources such as CO2 and H2O. Photoautotrophs are autotrophs that use light as a source of energy to make organic molecules. These include green plants, algae, and some bacterial species such as cyanobacteria. Life in the biosphere is largely driven by the photosynthetic power of green plants, algae, and cyanobacteria. The existence of most species relies on a key energy cycle that involves the interplay between organic molecules (such as glucose) and inorganic molecules, namely, O2, CO2, and H2O (Figure below).


An important energy cycle between photosynthesis and cellular respiration. 
Photosynthesis uses light, CO2, and H2O to produce O2 and organic molecules. The organic molecules are broken down to CO2 and H2O via cellular respiration to supply energy in the form of ATP; O2 is reduced to H2O.

Photoautotrophs make a large proportion of the Earth’s organic molecules via photosynthesis, using light energy, CO2, and H2O. During this process, they also produce O2. To supply their energy needs, both photoautotrophs and heterotrophs metabolize organic molecules via cellular respiration. Cellular respiration generates CO2 and H2O and is used to make ATP. The CO2 is released into the atmosphere and can be reused by photoautotrophs to make more organic molecules such as glucose. In this way, an energy cycle between photosynthesis and cellular respiration sustains life on our planet.

In plants and algae, photosynthesis occurs in the chloroplast
Chloroplasts are organelles found in plant and algal cells that carry out photosynthesis. These organelles contain large quantities of chlorophyll, which is a pigment that gives plants their green color. All green parts of a plant contain chloroplasts and can perform photosynthesis, although the majority of photosynthesis occurs in the leaves (Figure below).


Leaf organization. Leaves are composed of layers of cells. 
The epidermal cells are on the outer surface, both top and bottom, with mesophyll cells sandwiched in the middle. The mesophyll cells contain chloroplasts and are the primary sites of photosynthesis in most plants.

The tissue in the internal part of the leaf, called the mesophyll, contains cells with chloroplasts. For photosynthesis to occur, the mesophyll cells must receive light, and also obtain water and carbon dioxide. The water is taken up by the roots of the plant and is transported to the leaves by small veins. Carbon dioxide gas enters the leaf, and oxygen exits, via pores called stomata (singular, stoma or stomate; from the Greek, meaning mouth). Like a mitochondrion, a chloroplast contains an outer and inner membrane, with an intermembrane space lying between the two. A third membrane, called the thylakoid membrane, contains pigment molecules, including chlorophyll. The thylakoid membrane forms many flattened, fluid-filled tubules called thylakoids, which enclose a single, convoluted compartment known as the thylakoid lumen. Thylakoids stack on top of each other to form a structure called a granum (plural, grana). The stroma is the fluid-filled region of the chloroplast between the thylakoid membrane and the inner membrane.

Photosynthesis occurs in two stages: light reactions and the calvin cycle
How does photosynthesis take place? As mentioned, the process of photosynthesis occurs in two stages called the light reactions and the Calvin cycle. The term photosynthesis is derived from the association between these two stages: Photo refers to the light reactions that capture the energy from sunlight needed for the synthesis of carbohydrates that occurs in the Calvin cycle. The light reactions take place at the thylakoid membrane, and the Calvin cycle occurs in the stroma (Figure below).


An overview of the two stages of photosynthesis: light reactions and the Calvin cycle. 
The light reactions, through which ATP, NADPH, and O2 are made, occur at the thylakoid membrane. The Calvin cycle, in which enzymes use ATP and NADPH to incorporate CO2 into carbohydrate, occurs in the stroma.

The light reactions involve an amazing series of energy conversions, starting with light energy and ending with chemical energy that is stored in the form of covalent bonds. The light reactions produce three chemical products: ATP, NADPH, and O2. ATP and NADPH are energy intermediates that provide the needed energy and electrons to drive the Calvin cycle. Like NADH, NADPH (nicotinamide adenine dinucleotide phosphate) is an electron carrier that can accept two electrons. Its structure differs from NADH by the presence of an additional phosphate group.

Reactions that harness light energy
According to the first law of thermodynamics discussed in Chapter 6, energy cannot be created or destroyed, but it can be transferred from one place to another and transformed from one form to another. During photosynthesis, energy in the form of light is transferred from the Sun, some 92 million miles away, to a pigment molecule in a photosynthetic organism such as a plant. What follows is an interesting series of energy transformations in which light energy is transformed into electrochemical energy and then into energy stored within chemical bonds. In this section, we will explore this series of transformations, collectively called the light reactions of photosynthesis. We begin by examining the properties of light and then consider the features of chloroplasts that allow them to capture light energy. The remainder of this section focuses on how the light reactions of photosynthesis generate three important products: ATP, NADPH, and O2.

Light energy is a form of electromagnetic radiation
Light is essential to support life on Earth. Light is a type of electromagnetic radiation, so named because it consists of energy in the form of electric and magnetic fields. Electromagnetic radiation travels as waves caused by the oscillation of the electric and magnetic fields. The wavelength is the distance between the peaks in a wave pattern. The electromagnetic spectrum encompasses all possible wavelengths of electromagnetic radiation, from relatively short wavelengths (gamma rays) to much longer wavelengths (radio waves) (Figure below).


The electromagnetic spectrum. 
The bottom portion of this figure emphasizes visible light—the wavelengths of electromagnetic radiation visible to the human eye. Light in the visible portion of the electromagnetic spectrum drives photosynthesis

Visible light is the range of wavelengths detected by the human eye, commonly between 380 and 740 nm. As discussed later, visible light provides the energy to drive photosynthesis. Physicists have also discovered that light has properties that are characteristic of particles. Albert Einstein formulated the photon theory of light in which he proposed that light is composed of discrete particles called photons—massless particles traveling in a wavelike pattern and moving at the speed of light (about 300 million m/sec). Each photon contains a specific amount of energy. An important difference between the various types of electromagnetic radiation, shown in Figure above, is the amount of energy found in the photons. Shorter wavelength radiation carries more energy per unit of time than longer wavelength radiation. For example, the photons of gamma rays carry more energy than those of radio waves. The Sun radiates the entire spectrum of electromagnetic radiation, but the atmosphere prevents much of this radiation from reaching the Earth’s surface. For example, the ozone layer forms a thin shield in the upper atmosphere, protecting life on Earth from much of the Sun’s ultraviolet (UV) radiation. Even so, a substantial amount of electromagnetic radiation does reach the Earth’s surface. The effect of light on living organisms is critically dependent on the energy of the photons that reach them. The photons found in gamma rays, X-rays, and UV radiation have very high energy. When molecules in cells absorb such energy, the effects can be devastating. Such radiation can cause mutations in DNA and even lead to cancer. By comparison, the energy of photons found in visible light is much milder. Molecules can absorb this energy in a way that does not cause damage. Next, we will consider how molecules in living cells absorb the energy within visible light.

Pigments absorb light energy
When light strikes an object, one of three things happens. First, light may simply pass through the object. Second, the object may change the path of light toward a different direction. A third possibility is that the object may absorb the light. The term pigment is used to describe a molecule that can absorb light energy. When light strikes a pigment, some of the wavelengths of light energy are absorbed, while others are reflected. For example, leaves look green to us because they reflect radiant energy of the green wavelength. Various pigments in the leaves absorb the energy of other wavelengths. At the extremes of color reflection are white and black. A white object reflects nearly all of the visible light energy falling on it, whereas a black object absorbs nearly all of the light energy. This is why it is coolest to wear white clothes on a sunny, hot day. What do we mean when we say that light energy is absorbed? In the visible spectrum, light energy may be absorbed by boosting electrons to higher energy levels (Figure below).


Absorption of light energy by an electron. 
When a photon of light of the correct amount of energy strikes an electron, the electron is boosted from the ground (unexcited) state to a higher energy level (an excited state). When this occurs, the electron occupies an orbital that is farther away from the nucleus of the atom. At this farther distance, the electron is held less firmly and is considered unstable.

Electrons are located around the nucleus of an atom. The region in which an electron is found is called its orbital. Electrons in different orbitals possess different amounts of energy. For an electron to absorb light energy and be boosted to an orbital with a higher energy, it must overcome the difference in energy between the orbital it is in and the orbital to which it is going. For this to happen, an electron must absorb a photon that contains precisely that amount of energy. Different pigment molecules contain a variety of electrons that can be shifted to different energy levels. Therefore, the wavelength of light that a pigment absorbs depends on the amount of energy needed to boost an electron to a higher orbital. After an electron absorbs energy, it is said to be in an excited state. Usually, this is an unstable condition. The electron may release the energy in different ways.

First, when an excited electron drops back down to a lower energy level, it may release heat. For example, on a sunny day, the sidewalk heats up because it absorbs light energy that is released as heat.
- A second way that an electron can release energy is in the form of light. Certain organisms, such as jellyfish, possess molecules that make them glow. This glow is due to the release of light when electrons drop down to lower energy levels, a phenomenon called fluorescence.
- In the case of photosynthetic pigments, however, a different event happens that is critical for the process of photosynthesis. Rather than releasing energy, an excited electron in a photosynthetic pigment is removed from that molecule and transferred to another molecule where the electron is more stable. When this occurs, the energy in the electron is said to be “captured,” because the electron does not readily drop down to a lower energy level and release heat or light.

Plants contain different types of photosynthetic pigments
In plants, different pigment molecules absorb the light energy used to drive photosynthesis. Two types of chlorophyll pigments, termed chlorophyll a and chlorophyll b, are found in green plants and green algae. Their structure was determined in the 1930s by German chemist Hans Fischer (Figure a below).


Structures of pigment molecules. 
(a) The structure of chlorophylls a and b. As indicated, chlorophylls a and b differ only at a single site, at which chlorophyll a has a —CH3 group and chlorophyll b has a —CHO group. (b) The structure of β-carotene, an example of a carotenoid. The dark green and light green areas in parts (a) and (b) are the regions where a delocalized electron can hop from one atom to another.

In the chloroplast, both chlorophylls a and b are bound to integral membrane proteins in the thylakoid membrane. The chlorophylls contain a porphyrin ring and a phytol tail. A magnesium ion (Mg21) is bound to the porphyrin ring. An electron in the porphyrin ring follows a path in which it spends some of its time around several different atoms. Because this electron isn’t restricted to a single atom, it is called a delocalized electron. The delocalized electron can absorb light energy. The phytol tail in chlorophyll is a long hydrocarbon chain that is hydrophobic. Its function is to anchor the pigment to the surface of hydrophobic proteins within the thylakoid membrane of chloroplasts. Carotenoids are another type of pigment found in chloroplasts (Figure b above). These pigments impart a color that ranges from yellow to orange to red. Carotenoids are often the major pigments in flowers and fruits. In leaves, the more abundant chlorophylls usually mask the colors of carotenoids. In temperate climates where the leaves change colors, the quantity of chlorophyll in the leaf declines during autumn. The carotenoids become readily visible and produce the yellows and oranges of autumn foliage. An absorption spectrum is a graph that plots a pigment’s light absorption as a function of wavelength. Each of the photosynthetic pigments shown in Figure a below absorbs light in different regions of the visible spectrum.


Properties of pigment function: absorption and action spectra. 
(a) These absorption spectra show the absorption of light by chlorophyll a, chlorophyll b, and β-carotene. 
(b) An action spectrum of photosynthesis depicting the relative rate of photosynthesis in green plants at different wavelengths of light.

The absorption spectra of chlorophylls a and b are slightly different, though both chlorophylls absorb light most strongly in the red and violet parts of the visible spectrum and absorb green light poorly. Green light is reflected, which is why leaves appear green during the growing season. Carotenoids absorb light in the blue and blue-green regions of the visible spectrum, reflecting yellow and red. Why do plants have different pigments? Having different pigments allows plants to absorb light at many different wavelengths. In this way, plants are more efficient at capturing the energy in sunlight. This phenomenon is highlighted in an action spectrum, which plots the rate of photosynthesis as a function of wavelength (Figure b above). The highest rates of photosynthesis in green plants correlate with the wavelengths that are strongly absorbed by the chlorophylls and carotenoids. Photosynthesis is poor in the green region of the spectrum, because these pigments do not readily absorb this wavelength of light.

Photosystems II and I work together to produce ATP and NADPH
A key feature of photosynthesis is the ability of pigments to capture light energy and transfer it to other molecules that can hold on to the energy in a stable fashion and ultimately produce energy-intermediate molecules that can do cellular work. Let’s now consider how chloroplasts capture light energy. The thylakoid membranes of the chloroplast contain two distinct complexes of proteins and pigment molecules called photosystem I (PSI) and photosystem II (PSII) (Figure below).


The synthesis of ATP, NADPH, and O2 by the concerted actions of photosystems II and I. 
The movement of electrons from photosystem II to photosystem I to NADPH is called linear electron flow.

Photosystem I was discovered before photosystem II, but photosystem II is the initial step in photosynthesis. We will consider the structure and function of PSII in greater detail later in this chapter. As described in steps 1 and 2 of Figure above, light excites electrons in pigment molecules, such as chlorophylls, which are located in regions of PSII and PSI called light-harvesting complexes. Rather than releasing their energy in the form of heat, the excited electrons follow a path shown by the red arrow. The combined action of photosystem II and photosystem I is termed linear electron flow because the electrons move linearly from PSII to PSI and ultimately reduce NADP+ to NADPH. Let's consider the main events of the light reactions.

Events within Photosystem II 
Initially, the excited electrons move from a pigment molecule called P680 in PSII to other electron carriers called pheophytin (Pp), QA, and QB. The excited electrons are moved out of PSII by QB. PSII also oxidizes water, which generates O2 and adds H1 into the thylakoid lumen. The electrons released from the oxidized water molecules are used to replenish the electrons that leave PSII via QB.

Electron Transport Chain 
After a pair of electrons reaches QB, each one enters an electron transport chain (ETC)—a series of electron carriers—located in the thylakoid membrane. This ETC functions similarly to the one found in mitochondria. From QB, an electron goes to a cytochrome complex; then to plastocyanin (Pc), a small protein; and then to photosystem I. Along its journey from photosystem II to photosystem I, the electron releases some of its energy at particular steps and is transferred to the next component that has a higher electronegativity. The energy released is harnessed to pump H+ into the thylakoid lumen.

Photosystem I and NADPH Synthesis 
A key role of photosystem I is to make NADPH (see Figure 8.8, step 3). When light strikes the light-harvesting complex of photosystem I, this energy is also transferred to a reaction center, where a high-energy electron is removed from a pigment molecule, designated P700, and transferred to a primary electron acceptor. A protein called ferredoxin (Fd) can accept two high-energy electrons, one at a time, from the primary electron acceptor. Fd then transfers the two electrons to the enzyme NADP+ reductase. This enzyme transfers the two electrons to NADP+ and together with an H+ produces NADPH. The formation of NADPH results in fewer H+ in the stroma. A key difference between PSII and PSI lies in the source of the electrons received by their respective pigment molecules. An oxidized pigment in PSII called P680 receives an electron from water. By comparison, an oxidized pigment in PSI called P700 receives an electron from Pc. Therefore, PSI does not need to split water to reduce this pigment and does not generate oxygen.

Synthesis of ATP 
The synthesis of ATP in chloroplasts is achieved by a chemiosmotic mechanism called photophosphorylation, which is similar to that used to make ATP in mitochondria. In chloroplasts, ATP synthesis is driven by the flow of H+ from the thylakoid lumen into the stroma via ATP synthase (Figure 8.8, step 4). An H+ electrochemical gradient is generated via three events: (1) the splitting of water, which places H+ in the thylakoid lumen; (2) the movement of high-energy electrons along the ETC from photosystem II to photosystem I, which pumps H+ into the thylakoid lumen; and (3) the formation of NADPH, which consumes H+ in the stroma.

Products of Photosynthesis
In summary, the steps of the light reactions of photosynthesis produce three chemical products: O2, NADPH, and ATP:

1. O2 is produced in the thylakoid lumen by the oxidation of water by photosystem II. Two electrons are removed from water, which produces 2 H1 and 1/2 O2. The two electrons are transferred to P680 molecules.
2. NADPH is produced in the stroma using high-energy electrons that start in photosystem II and are boosted a second time in photosystem I. Two high-energy electrons and one H+ are transferred to NADP+ to produce NADPH.
3. ATP is produced in the stroma via ATP synthase that uses an H+ electrochemical gradient.

Cyclic electron flow produces only ATP
The mechanism of harvesting light energy described in Figure 8.8 is called linear electron flow because it is a linear process. This electron flow produces ATP and NADPH in roughly equal amounts. However, as we will see later, the Calvin cycle uses more ATP than NADPH. How can plant cells avoid making too much NADPH and not enough ATP? In 1959, Daniel Arnon discovered a pattern of electron flow that is cyclic and generates only ATP (Figure below).


Cyclic photophosphorylation. 
In this process, electrons follow a cyclic path that is powered by photosystem I (PSI). This contributes to the formation of an H+ electrochemical gradient, which is then used to make ATP by ATP synthase.

Arnon termed the process cyclic photophosphorylation because (1) the path of electrons is cyclic, (2) light energizes the electrons, and (3) ATP is made via the phosphorylation of ADP. Due to the path of electrons, the mechanism is also called cyclic electron flow. When light strikes photosystem I, high-energy electrons are sent to the primary electron acceptor and then to ferredoxin (Fd). The key difference in cyclic photophosphorylation is that the high-energy electrons are transferred from Fd to QB. From QB, the electrons then go to the cytochrome complex, then to plastocyanin (Pc), and back to photosystem I. As the electrons travel along this cyclic route, they release energy, and some of this energy is used to transport H+ into the thylakoid lumen. The resulting H1 gradient drives the synthesis of ATP via ATP synthase. Cyclic electron flow is favored when the level of NADP+ is low and NADPH is high. Under these conditions, there is sufficient NADPH to run the Calvin cycle, which is described later. Alternatively,
when NADP+ is high and NADPH is low, linear electron flow is favored, so more NADPH can be made. Cyclic electron flow is also favored when ATP levels are low.

Molecular features of photosystems
The previous section provided an overview of how chloroplasts absorb light energy and produce ATP, NADPH, and O2. As you have learned, two photosystems—PSI and PSII—play critical roles in two aspects of photosynthesis. First, both PSI and PSII absorb light energy and capture that energy in the form of excited electrons. Second, PSII oxidizes water, thereby producing O2. In this section, we will take a
closer look at how these events occur at the molecular level.

The cytochrome complexes of mitochondria and chloroplasts contain  related proteins
A recurring theme in cell biology is that evolution has resulted in groups of genes that encode proteins that play similar but specialized ,roles in cells—an example of descent with modification. When two or more genes are similar because they are derived from the same ancestral gene, they are called homologous genes. Homologous genes encode proteins that have similar amino acid sequences and often perform similar functions. A comparison of the electron transport chains of mitochondria and chloroplasts reveals homologous genes. In particular, let’s consider the cytochrome complex found in the thylakoid membrane of plants and algae, called cytochrome b6-f (Figure a below), and cytochrome b-c1, which is found in the ETC of mitochondria (Figure b). Both cytochrome complexes b6-f and b-c1 are composed of several proteins. One of them is called cytochrome b6 in cytochrome b6-f and cytochrome b in cytochrome b-c1. By analyzing the sequences of the genes that encode these proteins, researchers discovered that cytochrome b6 and cytochrome b are homologous proteins. These proteins carry out similar functions: Both of them accept electrons from a quinone (QB or ubiquinone), and both donate an electron to another protein within their respective complexes (cytochrome f or cytochrome c1). Likewise, both proteins function as H1 pumps that capture some of the energy that is released from electrons to transport H1 across the membrane. In this way, there is a family of cytochrome b-type proteins that play similar but specialized roles.


Homologous proteins in the electron transport chains of chloroplasts and mitochondria. 
(a) Cytochrome b6-f is a complex of proteins involved in electron and H+ transport in chloroplasts, and 
(b) cytochrome b-c1 is a complex of proteins involved in electron and H+ transport in mitochondria. These complexes contain homologous proteins designated cytochrome b6 in chloroplasts and cytochrome b in mitochondria. The inset shows the three-dimensional structure of cytochrome b, which was determined by X-ray crystallography. It is an integral membrane protein with several transmembrane helices and two heme groups, which are prosthetic groups involved in electron transfer. The structure of cytochrome b6 has also been determined and found to be very similar.

Photosystem II captures light energy and produces O2
PSI and PSII have two main components: a light-harvesting complex and a reaction center. Figure below shows how these components function in PSII.


A closer look at how photosystem II harvests light energy and oxidizes water. 
Note: Two electrons are released during the oxidation of water, but they are transferred one at a time to P680+.

Absorption of Energy by the Light-Harvesting Complex and its Transfer to P680 via Resonance Energy Transfer
In 1932, American biologist Robert Emerson and an undergraduate student, William Arnold, originally discovered the light-harvesting complex in the thylakoid membrane. It is composed of several dozen pigment molecules that are anchored to transmembrane proteins. The role of the complex is to directly absorb photons of light. When a pigment molecule absorbs a photon, an electron is boosted to a higher energylevel. As shown in Figure above, the energy (not the electron itself) is transferred to adjacent pigment molecules by a process called resonance energy transfer. The energy may be transferred among multiple pigment molecules until it is eventually transferred to a
special pigment molecule designated P680, which is located within the reaction center of PSII. The P680 pigment is so named because it can directly absorb light at a wavelength of 680 nm. However, P680 is more commonly excited by resonance energy transfer from another chlorophyll pigment. In either case, when an electron in P680 is excited, the molecule is designated P680*. The light-harvesting complex is also called the antenna complex because it acts like an antenna that absorbs energy from light and funnels that energy to P680 in the reaction center.

Rapid transfer of a high-energy electron from P680* to the Primary Electron Acceptor 
A high-energy (photoexcited) electron in a pigment molecule is relatively unstable. It may abruptly release its
energy by giving off heat or light. Unlike the pigments in the lightharvesting complex that undergo resonance energy transfer, P680* can actually release its high-energy electron and become P680+. The role of the reaction center is to quickly remove the highenergy electron from P680* and transfer it to another molecule, where the electron is more stable. This molecule is called the primary electron acceptor (see Figure above). The transfer of the electron from P680* to the primary electron acceptor is remarkably fast. It occurs in less than a few picoseconds! (One picosecond equals one-trillionth of a second, also written 10–12 sec.) Because this occurs so quickly, the excited electron does not have much time to release its energy in the form of heat or light. After the primary electron acceptor (pheophytin) has received this high-energy electron, the light energy has been captured and can be used to perform cellular work. The work it performs is to synthesize the energy intermediates ATP and NADPH.

Transfer of a Low-Energy Electron from Water to P680+ 
Let’s now consider what happens to P680+, which has given up its highenergy electron. After P680+ is formed, it is necessary to replace the electron so that P680 can function again. Therefore, another role of the reaction center is to replace the electron that is removed when P680* becomes P680+. This missing electron of P680+ is replaced with a low-energy electron from water (see Figure above). The oxidation of water results in the formation of oxygen gas (O2), which is used by many organisms for cellular respiration. Photosystem II is the only known protein complex that can oxidize water, resulting in the release of O2 into the atmosphere.

Electrons vary in energy as they move from Photosystem II to Photosystem I to NADP+
In 1960, Robin Hill and Fay Bendal proposed that the light reactions of photosynthesis involve two photoactivation events. According to their model, known as the Z scheme, an electron proceeds through a series of energy changes during photosynthesis (Figure below).


The Z scheme, showing the energy of an electron moving from photosystem II to NADP+. 
The oxidation of water releases two electrons that travel one at a time from photosystem II to NADP+. As seen here, the input of light boosts the energy of the electron twice. At the end of the pathway, two electrons are used to make NADPH.

The Z refers to the zigzag shape of this energy curve. Based on our modern understanding of photosynthesis, we now know these events involve increases and decreases in the energy of an electron as it moves from photosystem II through photosystem I to NADP+ during linear electron flow.

- An electron on a nonexcited pigment molecule in photosystem II has the lowest energy.
- In photosystem II, light boosts an electron to a much higher energy level.
- As the electron travels from photosystem II to photosystem I, some of the energy is released.
- The input of light in photosystem I boosts the electron to an even higher energy than it attained in photosystem II.
- The electron releases a little energy before it is eventually transferred to NADP1.

Synthesizing carbohydrates via the Calvin Cycle
In the previous sections, we learned how the light reactions of photosynthesis produce ATP, NADPH, and O2. We will now turn our attention to the second phase of photosynthesis, the Calvin cycle, in which ATP and NADPH are used to make carbohydrates. The Calvin cycle consists of a series of steps that occur in a metabolic cycle. In plants and algae, it occurs in the stroma of chloroplasts. In cyanobacteria, the Calvin cycle occurs in the cytoplasm of the bacterial cells. The Calvin cycle takes CO2 from the atmosphere and incorporates the carbon into organic molecules, namely, carbohydrates. Carbohydrates are critical for two reasons. First, they provide the precursors to make the organic molecules and macromolecules of nearly all living cells. The second key reason is the storage of energy. The Calvin cycle produces carbohydrates, which store energy. These carbohydrates are accumulated inside plant cells. When a plant is in the dark and not carrying out photosynthesis, the stored carbohydrates are used as a source of energy. Similarly, when an animal consumes a plant, it uses the carbohydrates as an energy source. In this section, we will examine the three phases of the Calvin cycle. 

The Calvin Cycle incorporates CO2 into carbohydrate
The Calvin cycle, also called the Calvin-Benson cycle, was determined by chemists Melvin Calvin and Andrew Adam Benson and their colleagues in the 1940s and 1950s. This cycle requires a massive input of energy. For every 6 carbon dioxide molecules that are incorporated into a carbohydrate such as glucose (C6H12O6), 18 ATP molecules are hydrolyzed and 12 NADPH molecules are oxidized. Although biologists commonly describe glucose as a product
of photosynthesis, glucose is not directly made by the Calvin cycle. Instead, molecules of glyceraldehyde-3-phosphate, which are products of the Calvin cycle, are used as starting materials for the synthesis of glucose and other molecules, including sucrose. After glucose molecules are made, they may be linked together to form a polymer of glucose called starch, which is stored in the chloroplast for later use. Alternatively, the disaccharide sucrose may be made and transported out of the leaf to other parts of the plant. The Calvin cycle can be divided into three phases: carbon fixation, reduction and carbohydrate production, and regeneration of ribulose bisphosphate (RuBP) (Figure below).


The Calvin cycle. 
This cycle has three phases: (1) carbon fixation, (2) reduction and carbohydrate production, and (3) regeneration of RuBP.

Carbon Fixation (Phase 1)
During carbon fixation, CO2 is incorporated into RuBP, a five-carbon sugar. The term fixation means that the carbon has been removed from the atmosphere and fixed into an organic molecule that is not a gas. More specifically, the product of the reaction is a six-carbon intermediate that immediately splits in half to form two molecules of 3-phosphoglycerate (3PG). The enzyme that catalyzes this step is named RuBP carboxylase/oxygenase, or rubisco. It is the most abundant protein in chloroplasts and perhaps the most abundant protein on Earth! This observation underscores the massive amount of carbon fixation that happens in the biosphere.

Reduction and Carbohydrate Production (Phase 2) 
In the second phase, ATP is used to convert 3PG to 1,3-bisphosphoglycerate (1,3-BPG). Next, electrons from NADPH reduce 1,3-BPG to glyceraldehyde- 3-phosphate (G3P). G3P is a carbohydrate with three carbon atoms. The key difference between 3PG and G3P is that 3PG has a C—O bond, whereas the analogous carbon in G3P has a C—H bond (see Figure above ). The C—H bond occurs because the G3P molecule has been reduced by the addition of two electrons from NADPH. Compared with 3PG, the bonds in G3P store more energy and enable G3P to readily form larger organic molecules such as glucose. As shown in Figure 8.13, only some of the G3P molecules are used to make glucose or other carbohydrates. Phase 1 begins with 6 RuBP molecules and 6 CO2 molecules. Twelve G3P molecules are made at the end of phase 2, and only 2 of these G3P molecules are used in carbohydrate production. As described next, the other 10 G3P molecules are needed to keep the Calvin cycle turning by regenerating RuBP.

Regeneration of RuBP (Phase 3)
In the last phase of the Calvin cycle, a series of enzymatic steps converts the 10 G3P molecules into 6 RuBP molecules, using 6 molecules of ATP. After the RuBP molecules are regenerated, they serve as acceptors for CO2, thereby
allowing the cycle to continue. As we have just seen, the Calvin cycle begins by using carbon from an inorganic source, that is, CO2, and ends with organic molecules that will be used by the plant to make other molecules. You may be wondering why CO2 molecules cannot be directly linked to form these larger molecules. The answer lies in the number of electrons that are around the carbon atoms. In CO2, the carbon atom is considered electron poor. Oxygen is a very electronegative atom that monopolizes the electrons it shares with other atoms. In a covalent bond between carbon and oxygen, the shared electrons are closer to the oxygen atom. By comparison, in an organic molecule, the carbon atom is electron rich. During the Calvin cycle, ATP provides energy and NADPH donates high-energy electrons, so the carbon originally in CO2 has been reduced. The Calvin cycle combines less electronegative atoms with carbon atoms so that C—H and C—C bonds are formed. This allows the eventual synthesis of larger organic molecules, including glucose, amino acids, and so on. In addition, the covalent bonds within these molecules are capable of storing large amounts of energy.

Cell Communication

Over 2 billion cells will die in your body during the next hour. In an adult human body, approximately 50–70 billion cells die each day due to programmed cell death—the process in which a cell breaks apart into small fragments. In a year, your body produces and purposely destroys a mass of cells that is equal to your own body’s weight! Though this may seem like a scary process, it’s actually keeping you healthy. Programmed cell death, also called apoptosis, ensures that your body maintains a proper number of cells. It also eliminates cells that are worn out or potentially harmful, such as cancer cells. Programmed cell death can occur via signals that intentionally cause particular cells to die, or it can result from a failure of proper cell communication. It may also happen when environmental agents cause damage to a cell. Programmed cell death is one example of a response that involves cell communication—the process through which cells can detect, interpret, and respond to signals in their environment.

A signal is an agent that can influence the properties of cells. Cells detect environmental signals and they also  produce signals that enable them to communicate with other cells. Communication at the cellular level involves not only receiving and sending signals but also their interpretation. For this to occur, a signal must be recognized by a cellular protein called a receptor. When a signal and a receptor interact, the receptor changes shape, or conformation, thereby changing the way the receptor interacts with cellular factors. These interactions eventually lead to some type of response in the cell. Cell communication involves an amazing diversity of signaling molecules and cellular proteins that are devoted to this process.

General Features of Cell Communication
All living cells, including bacteria, archaea, protists, fungi, and plant and animal cells, conduct and require cell communication to survive. Cell communication, also known as cell signaling, involves both incoming and outgoing signals. For example, on ,a sunny day, cells can sense their exposure to ultraviolet (UV) light—a physical signal—and respond accordingly. In humans, UV light acts as an incoming signal to promote the synthesis of melanin, a protective pigment that helps to prevent the harmful effects of UV radiation. In addition, cells produce outgoing signals that influence the behavior of neighboring cells. Plant cells, for example, produce hormones that influence the pattern of cell elongation so the plant grows toward light. Cells of all living organisms both respond to incoming signals and produce outgoing signals. Cell communication is a two-way street.

Cells detect and respond to signals from their environment and from other cells
Before getting into the details of cell communication, let’s take a general look at why cell communication is necessary.

Responding to Changes in the Environment 
The first reason is that cells need to respond to a changing environment. Changes in the environment are a persistent feature of life, and living cells are continually faced with alterations in temperature and availability of nutrients, water, and light. A cell may even be exposed to a toxic chemical in its environment. Being able to respond to change at the cellular level is called a cellular response. As an example, let’s consider the response of a yeast cell to glucose in its environment (Figure below).


Response of a yeast cell to glucose. 
When glucose is absent from the extracellular environment, the cell is not well prepared to take up and metabolize this sugar. However, when glucose is present, some of that glucose binds to receptors in the membrane, which leads to changes in the amounts and properties of intracellular and membrane proteins so the cell can readily use glucose.

Some of the glucose acts as a signaling molecule that binds to a receptor and causes a cellular response. In this case, the cell responds by increasing the number of glucose transporters needed to take glucose into the cell and also by increasing the number of metabolic enzymes required to utilize glucose once it is inside. The cellular response allows the cell to use glucose efficiently.

Cell-to-Cell Communication
A second reason for cell signaling is the need for cells to communicate with each other—a type of cell communication called cell-to-cell communication. In one of the earliest experiments demonstrating cell-to-cell communication, Charles Darwin and his son Francis Darwin studied phototropism, the phenomenon in which plants grow toward light (Figure below).


Phototropism in plants. 
This process involves cell-to-cell communication that leads to a shoot bending toward light just beneath its actively growing tip.

Darwins observed that the actual bending occurs in a zone below the growing shoot tip. They concluded that a signal must be transmitted from the growing tip to lower parts of the shoot. Later research revealed that the signal is a molecule called auxin, which is transmitted from cell to cell. A higher amount of auxin accumulates on the nonilluminated side of the shoot and promotes cell elongation on that side of the shoot only, thereby causing the shoot to bend toward the light source.

Cell-to-Cell communication can occur between adjacent cells and between cells that are long distances apart
Organisms have a variety of different mechanisms to achieve cell-tocell communication. The mode of communication depends, in part, on the distance between the cells that need to communicate with each other. Let’s first examine the various ways in which signals are transferred between cells. Later in this chapter, we will learn how such signals elicit a cellular response. One way to categorize cell signaling is by the manner in which the signal is transmitted from one cell to another. Signals are relayed between cells in five common ways, all of which involve a cell that produces a signal and a target cell that receives the signal (Figure below).


Types of cell-to-cell communication based on the distance between cells.

Direct Intercellular Signaling
In a multicellular organism, cells adjacent to each other may have contacts, called cell junctions, that enable them to pass ions, signaling molecules, and other materials between the cytosol of one cell and the cytosol of another(Figure a above). For example, cardiac muscle cells, which cause your heart to beat, have intercellular connections called gap junctions that allow the passage of ions needed for the coordinated contraction of cardiac muscle cells.

Contact-Dependent Signaling 
Not all signaling molecules diffuse from one cell to another. Some molecules are bound to the surface of cells and provide a signal to other cells that make contact with the surface of that cell (Figure b). In this case, one cell has amembrane-bound signaling molecule that is recognized by a receptor on the surface of another cell. This occurs, for example, when portions of neurons (nerve cells) grow and make contact with other neurons. This is important for the formation of the proper connections between neurons.

Autocrine Signaling
In autocrine signaling, a cell secretes signaling molecules that bind to receptors on its own cell surface and on neighboring cells of the same cell type, stimulating a response (Figure c). What is the purpose of autocrine signaling? It is often important for groups of cells to sense cell density. When cell density is high, the concentration of autocrine signals is also high. In some cases, such signals inhibit further cell growth, thereby limiting cell density.

Paracrine Signaling 
In paracrine signaling, a specific cell secretes a signaling molecule that does not affect the cell secreting the signal but instead influences the behavior of target cells in close proximity (Figure d). Paracrine signaling is typically of short duration. Usually, the signal is broken down too quickly to be carried to other parts of the body and affect distant cells. A specialized form of paracrine signaling occurs in the nervous systems of animals. Neurotransmitters—molecules made in neurons that transmit a signal to an adjacent cell—are released at the end of the neuron and traverse a narrow space called the synapse. The neurotransmitter then binds to a receptor in a target cell.

Endocrine Signaling
In contrast to the previous mechanisms of cell signaling, endocrine signaling occurs over relatively long distances (Figure e). In both animals and plants, molecules involved in long-distance signaling are called hormones. They usually last longer than signaling molecules involved in autocrine and paracrine signaling. In mammals, endocrine signaling involves the secretion of hormones into the bloodstream, which may affect virtually all cells of the body, including those that are far from the cells that secrete the signaling molecules. In flowering plants, hormones move through the plant vascular system and also move through adjacent cells. Some hormones are even gases that diffuse into the air. Ethylene, a gas given off by plants, plays a variety of roles, such as accelerating the ripening of fruit.

Cells usually respond to signals via a three-stage process
Signals influence the behavior of cells in close proximity or at long distances, interacting with receptors to elicit a cellular response. What events occur when a cell encounters a signal? In most cases, the binding of a signaling molecule to a receptor causes the receptor to activate a signal transduction pathway, which then leads to a cellular response. Figure below diagrams the three common stages of cell signaling: receptor activation, signal transduction, and a cellular response.


The three stages of cell signaling: receptor activation, signal transduction, and a cellular response.

Stage 1: Receptor Activation
In the initial stage, a signaling molecule binds to a receptor in the target cell, causing a conformational change in the receptor that activates its function. In most cases, the activated receptor initiates a response by causing changes in a series of proteins that collectively forms a signal transduction pathway, as described next.

Stage 2: Signal Transduction
During signal transduction, the initial signal is converted—or transduced—to a different signal inside the cell. This process is carried out by a group of proteins that form a signal transduction pathway. These proteins undergo a series of changes that may result in the production of an intracellular signaling molecule. However, some receptors are intracellular and do not activate a signal transduction pathway. Certain types of intracellular receptors directly cause a cellular response.

Stage 3: Cellular Response 
Cells respond to signals in several different ways. Figure above shows three common categories of proteins that are controlled by cell signaling: enzymes, structural proteins, and transcription factors. Many signaling molecules exert their effects by altering the activity of one or more enzymes. For example, certain hormones provide a signal that the body needs energy. These hormones activate enzymes that are required for the breakdown of molecules such as carbohydrates. Cells also respond to signals by altering the functions of structural proteins in the cell. For example, when animal cells move during embryonic development or when an amoeba moves toward food, signals play a role in the rearrangement of actin filaments, which are components of the cytoskeleton. The coordination of signaling and changes in the cytoskeleton enables a cell to move in the correct direction. Cells may also respond to signals by affecting the function of transcription factors—proteins that regulate the transcription of genes. Some transcription factors activate gene expression. For example, when cells are exposed to sex hormones, transcription factors activate genes that change the properties of cells, which can lead to changes in the sexual characteristics of entire organisms. Estrogens and androgens are responsible for the development of secondary sex characteristics in humans, including breast development in females and beard growth in males, respectively.

Cellular receptors and their activation
The ability of cells to respond to a signal usually requires precise recognition between a signal and its receptor. In many cases, the signal is a molecule, such as a steroid or a protein, that binds to the receptor. A signaling molecule binds to a receptor in much the same way that a substrate binds to the active site of an enzyme. The signaling molecule, which is called a ligand, binds noncovalently to the receptor with a high degree of specificity. The binding occurs when the ligand and receptor happen to collide in the correct orientation with enough energy to form a ligand - receptor complex. After a complex forms between the ligand and its receptor, the noncovalent interaction between ligand and receptor remains stable for a finite period of time. The term koff is the rate at which the ligand-receptor complex falls apart or dissociates. In general, the binding and release between a ligand and its receptor are relatively rapid, and therefore an equilibrium is reached when the rate of formation of new ligand-receptor complexes equals the rate at which existing ligand-receptor complexes dissociate.

Receptors undergo conformational changes
Unlike enzymes, which convert their substrates into products, receptors do not usually alter the structure of their ligands. Instead, the ligands alter the structure of their receptors, causing a conformational change (Figure below). In this case, the binding of the ligand to its receptor changes the receptor in a way that activates its ability to initiate a cellular response.


Receptor activation.

Because the binding of a ligand to its receptor is a reversible process, the ligand and receptor also dissociate. Once the ligand is released, the receptor is no longer activated.

Cells contain a variety of cell surface receptors that respond to extracellular signals
Most signaling molecules are either small hydrophilic molecules or large molecules that do not readily pass through the plasma membrane of cells. Such extracellular signals bind to cell surface receptors— receptors found in the plasma membrane. A typical cell is expected to contain dozens or even hundreds of different cell surface receptors that enable the cell to respond to different kinds of extracellular signaling molecules. By analyzing the functions of cell surface receptors from many different organisms, researchers have determined that most fall into one of three categories: 

enzyme-linked receptors,
G-protein-coupled receptors, 
ligand-gated ion channels, 

Enzyme-Linked Receptors 
Receptors known as enzyme-linked receptors are found in all living species. Many human hormones bind to this type of receptor. For example, when insulin binds to an enzyme-linked receptor in muscle cells, it enhances the ability of those cells to use glucose. Enzyme-linked receptors typically have two important domains: an extracellular domain, which binds a signaling molecule, and an intracellular domain, which has a catalytic function (Figure a below).


Enzyme-linked receptors.

When a signaling molecule binds to the extracellular domain, a conformational change is transmitted through the membrane-embedded portion of the protein and affects the conformation of the intracellular catalytic domain. In most cases, this conformational change causes the intracellular catalytic domain to become functionally active. Most types of enzyme-linked receptors function as protein kinases, enzymes that transfer a phosphate group from ATP to specific amino acids in a protein (Figure b). For example, tyrosine kinases attach phosphate to the amino acid tyrosine, whereas serine/threonine kinases attach phosphate to the amino acids serine and threonine. In the example shown in Figure b, the catalytic domain of the receptor remains inactive when no signaling molecule is present. However, when a signal binds to the extracellular domain, the catalytic domain is activated. Under these conditions, the receptor may phosphorylate itself, or it may phosphorylate intracellular proteins. The attachment of a negatively charged phosphate changes the structure of a protein and thereby alters its function. Later in this chapter, we will explore how this event leads to a cellular response, such as the activation of enzymes that affect cell function.

G-Protein-Coupled Receptors
Receptors called G-proteincoupled receptors (GPCRs) are found in the cells of all eukaryotic species and are particularly common in animals. GPCRs typically contain seven transmembrane segments that wind back and forth through the plasma membrane. The receptors interact with intracellular proteins called G proteins, which are so named because of their ability to bind guanosine triphosphate (GTP) and guanosine diphosphate (GDP). GTP is similar in structure to ATP except it has guanine as a base instead of adenine. In the 1970s, the existence of G proteins was first proposed by Martin Rodbell and colleagues, who found that GTP is needed for certain hormone receptors to cause an intracellular response. Later, Alfred Gilman and coworkers used genetic and biochemical techniques to identify and purify a G protein. In 1994, Rodbell and Gilman won the Nobel Prize in Physiology or Medicine for their pioneering work. Figure below shows how a GPCR and a G protein interact.


The activation of G-protein-coupled receptors (GPCRs) and G proteins. 
Note: All three receptors shown in this figure are meant to be the same receptor, but the one on the left is drawn with greater detail to emphasize that it has seven transmembrane segments.

At the cell surface, a signaling molecule binds to a GPCR, causing a conformational change that activates the receptor, enabling it to bind to a G protein. The G protein, which is a lipid-anchored protein, releases GDP and binds GTP instead. GTP binding changes the conformation of the G protein, causing it to dissociate into an α subunit and a β/γ dimer. Later in this chapter, we will examine how the α subunit interacts with other proteins in a signal transduction pathway to elicit a cellular response. The β/γ dimer also plays a role in signal transduction. For example, it can regulate the function of ion channels in the plasma membrane. When a signaling molecule and a GPCR dissociate, the GPCR is no longer activated, and the cellular response is reversed. For the G protein to return to the inactive state, the α subunit first hydrolyzes its bound GTP to GDP and Pi. After this occurs, the α and β/γ subunits reassociate with each other to form an inactive G protein.

Ligand-Gated Ion Channels
Ion channels are proteins that allow the diffusion of ions across cell membranes. Ligand-gated ion channels are a third type of cell surface receptor found in the plasma membrane of animal, plant, and fungal cells. When signaling molecules (ligands) bind to this type of receptor, the channel opens and allows the flow of ions through the membrane, changing the concentration of the ions in the cell (Figure below).


The function of a ligand-gated ion channel

In animals, ligand-gated ion channels are important in the transmission of signals between neurons and muscle cells and between two neurons. In addition, ligand-gated ion channels in the plasma membrane allow the influx of Ca2+ into the cytosol. Changes in the cytosolic concentration of Ca2+ often play a role in signal transduction.

Cells also have intracellular receptors activated by signaling molecules that pass through the plasma membrane
Although most receptors for signaling molecules are located in the plasma membrane, some are found inside the cell. In these cases, an extracellular signaling molecule must diffuse through the plasma membrane to gain access to its receptor. In vertebrates, receptors for steroid hormones are intracellular. Steroid hormones, such as estrogens and androgens, are secreted into the bloodstream from cells of endocrine glands. The behavior of estrogen is typical of many steroid hormones (Figure below).



Because estrogen is hydrophobic, it can diffuse through the plasma membrane of a target cell and bind to a receptor inside the cell. Some steroids bind to receptors in the cytosol, which then travel into the nucleus. Other steroid hormones, such as estrogen, bind to receptors in the nucleus. After binding, the estrogen•receptor complex undergoes a conformational change that enables it to form a dimer with another estrogen•receptor complex. The dimer then binds to the DNA and activates the transcription of specific genes. The estrogen receptor is an example of a transcription factor—a protein that regulates the transcription of genes. The expression of specific genes changes cell structure and function in a way that results in a cellular response.

Signal transduction and the cellular response
We now turn our attention to the intracellular events that enable a cell to respond to a signaling molecule that binds to a cell surface receptor: signal transduction and a cellular response. In most cases, the binding of a signaling molecule to its receptor stimulates a signal transduction pathway. We begin by examining a pathway that is controlled by an enzyme-linked receptor. We will then examine pathways and cellular responses that are controlled by G-protein-coupled receptors. As you will learn, these pathways sometimes involve the production of intracellular signals called second messengers.

Receptor tyrosine kinases activate signal transduction pathways involving a protein kinase cascade that alters gene transcription
Receptor tyrosine kinases are a category of enzyme-linked receptors that are found in all animals and also in choanoflagellates, which are the protists that are most closely related to animals. However, they are not found in bacteria, archaea, or other eukaryotic species. (Bacteria do have receptor histidine kinases, and all eukaryotes have receptor serine/threonine kinases.) The human genome contains about 60 different genes that encode receptor tyrosine kinases that recognize various types of signaling molecules such as hormones. Figure below describes a simplified signal transduction pathway for epidermal growth factor (EGF).


The epidermal growth factor (EGF) pathway that promotes cell division.

A growth factor
is a signaling molecule that promotes cell division. Multicellular organisms, such as plants and animals, produce a variety of different growth factors to coordinate cell division throughout the body. In vertebrate
animals, EGF is secreted from endocrine cells, travels through the bloodstream, and binds to a receptor tyrosine kinase, which is located on target cells and called the EGF receptor. EGF is responsible for stimulating epidermal cells, such as skin cells, to divide. Following receptor activation, the three general parts of the signal transduction pathway are (1) relay proteins activate a protein kinase cascade; (2) the protein kinase cascade phosphorylates proteins in the cell such as transcription factors; and (3) the phosphorylated transcription factors stimulate gene transcription. Next, we will consider the details of this pathway.

EGF Receptor Activation 
For receptor activation to occur, two EGF receptor subunits each bind a molecule of EGF. The binding of EGF causes the subunits to dimerize and phosphorylate each other on tyrosines within the receptors, which is why they are named receptor tyrosine kinases. Next comes the signal transduction pathway.

Relay Proteins
The phosphorylated form of the EGF receptor is first recognized by a relay protein of the signal transduction pathway called Grb. This interaction changes the conformation of Grb, causing it to bind another relay protein in the signal transduction pathway termed Sos, thereby changing the conformation of Sos. The activation of Sos causes a third relay protein called Ras to release GDP and bind GTP. The GTP form of Ras is the active form.

Protein Kinase Cascade
The function of the relay proteins is to activate a protein kinase cascade. This cascade involves the sequential activation of three protein kinases. Activated Ras binds to Raf, the first protein kinase in the cascade. Raf then phosphorylates Mek, which becomes active and, in turn, phosphorylates Erk.

Activation of Transcription Factors and the Cellular Response
The phosphorylated form of Erk enters the nucleus and phosphorylates transcription factors such as Myc and Fos. What is the cellular response? Once these transcription factors are phosphorylated, they stimulate the transcription of genes that encode proteins that promote cell division. After these proteins are made, the cell is stimulated to divide. Growth factors such as EGF cause a rapid increase in the expression of many genes in mammals, perhaps as many as 100.  Growth factor signaling pathways are often involved in cancer. Mutations that cause proteins in these pathways to become hyperactive result in cells that divide uncontrollably!


Second messengers such as cyclic AMP are key components of many signal transduction pathways
Let’s now turn to examples of signal transduction pathways and cellular responses that involve G-protein-coupled receptors (GPCRs). Extracellular signaling molecules that bind to cell surface receptors are sometimes referred to as first messengers. After first messengers bind to receptors such as GPCRs, many signal transduction pathways lead to the production of second messengers—small molecules or ions that relay signals inside the cell. The signals that result in second messenger production often act quickly, in a matter of seconds or
minutes, but their duration is usually short. Therefore, such signaling typically occurs when a cell needs a quick and short cellular response. 

Production of cAMP 
Mammalian and plant cells make several different types of G protein α subunits. One type of α subunit binds to adenylyl cyclase, an enzyme in the plasma membrane. This interaction stimulates adenylyl cyclase to synthesize cyclic adenosine monophosphate (cyclic AMP, or cAMP) from ATP (Figure below). cAMP is an example of a second messenger.


The synthesis and breakdown of cyclic AMP. 
Cyclic AMP (cAMP) is a second messenger formed from ATP by adenylyl cyclase, an enzyme in the plasma membrane. cAMP is inactivated by the action of an enzyme called phosphodiesterase, which converts cAMP to AMP.

Signal Transduction Pathway Involving cAMP
Let’s explore a signal transduction pathway in which the GPCR recognizes the hormone epinephrine (also called adrenaline). This hormone is sometimes called the fight-or-flight hormone. Epinephrine is produced when an individual is confronted with a stressful situation and helps the individual deal with a perceived threat or danger. First, epinephrine binds to its receptor and activates a G protein
(Figure below).


A signal transduction pathway involving cAMP. 
The pathway leading to the formation of cAMP and subsequent activation of protein kinase A (PKA), which is mediated by a G-protein-coupled receptor (GPCR).

The α subunit then activates adenylyl cyclase, which catalyzes the production of cAMP from ATP. One effect of cAMP is to activate protein kinase A (PKA), which is composed of four subunits: two catalytic subunits that phosphorylate specific cellular proteins, and two regulatory subunits that inhibit the catalytic subunits when they are bound to each other. cAMP binds to the regulatory subunits of PKA. The binding of cAMP separates the regulatory and catalytic subunits, which allows each catalytic subunit to be active.

Cellular Response via PKA
How does PKA activation lead to a cellular response? The catalytic subunit of PKA phosphorylates specific cellular proteins such as enzymes, structural proteins, and transcription factors. The phosphorylation of enzymes and structural proteins influences the structure and function of the cell. Likewise, the phosphorylation of transcription factors leads to the synthesis of new proteins that affect cell structure and function. As a specific example of a cellular response, Figure 9.13 shows how a skeletal muscle cell responds to elevated levels of epinephrine.


A cellular response of a skeletal muscle cell to epinephrine.

When PKA becomes active, it phosphorylates two enzymes—phosphorylase kinase and glycogen synthase. Both of these enzymes are involved with the metabolism of glycogen, which is a polymer of glucose used to store energy.

-When phosphorylase kinase is phosphorylated, it becomes activated. The function of phosphorylase kinase is to phosphorylate another enzyme in the cell called glycogen phosphorylase, which then becomes activated. This enzyme
causes glycogen breakdown by phosphorylating glucose units at the ends of a glycogen polymer, which releases individual glucose-phosphate molecules from glycogen
-When PKA phosphorylates glycogen synthase, the function of this enzyme is inhibited rather than activated (see Figure above). The function of glycogen synthase is to make glycogen. Therefore, the effect of cAMP is to prevent glycogen synthesis.

Taken together, the effects of epinephrine in skeletal muscle cells are to stimulate glycogen breakdown and inhibit glycogen synthesis. This provides these cells with more glucose molecules, which they can use for the energy needed for muscle contraction. In this way, the individual is better prepared to fight or flee.

Reversal of the Cellular Response
As mentioned, signaling that involves second messengers is typically of short duration. When the signaling molecule is no longer produced and its level falls, a larger percentage of the receptors are not bound by their ligands. When a ligand dissociates from the GPCR, the GPCR becomes deactivated. Intracellularly, the α subunit hydrolyzes its GTP to GDP, and the α subunit and β/γ dimer reassociate to form an inactive G protein  The level of cAMP decreases due to the action of an enzyme called phosphodiesterase, which converts cAMP to AMP:




As the cAMP level falls, the regulatory subunits of PKA release cAMP, and the regulatory and catalytic subunits reassociate, thereby inhibiting PKA. Finally, enzymes called protein phosphatases are responsible for removing phosphate groups from proteins, which reverses the effects of PKA:



The main advantages of second messengers are amplification and speed
In the 1950s, Earl Sutherland determined that many different hormones cause the formation of cAMP in a variety of cell types. This observation, for which he won the Nobel Prize in Physiology or Medicine in 1971, stimulated great interest in the study of signal transduction pathways. Since Sutherland’s discovery, the production of second messengers such as cAMP has been found to have two important advantages: amplification and speed. Signal Amplification Amplification of the signal involves the synthesis of many cAMP molecules, which, in turn, activate many PKA proteins (Figure below).


Signal amplification. 
An advantage of a signal transduction pathway is the amplification of a signal. In this case, a single signaling molecule leads to the phosphorylation of many, perhaps hundreds or thousands of, target proteins.

Likewise, each PKA protein phosphorylates many target proteins in the cell to promote a cellular response.

Speed
A second advantage of second messengers such as cAMP is speed. Because second messengers are relatively small and water-soluble, they can diffuse rapidly through the cytosol. For example, Brian Bacskai and colleagues studied the response of neurons to a signaling molecule called serotonin, which is a neurotransmitter that binds to a GPCR. In humans, low serotonin is believed to play a role in depression, anxiety, and other behavioral disorders. To monitor cAMP levels, neurons grown in a laboratory were injected with a fluorescent protein that changes its fluorescence when cAMP is made. As schematically shown in the right drawing in Figure below, such cells made a substantial amount of cAMP within 20 seconds after the addition of serotonin.


The rapid speed of cAMP production. 
The schematic drawing on the left shows a neuron prior to its exposure to serotonin, a signaling molecule; the drawing on the right shows the same cell 20 seconds after exposure. Blue indicates a low level of cAMP, yellow is an intermediate level, and purple is a high level.

Apoptosis: Programmed Cell Death
We will end our discussion of cell communication by considering one of the most dramatic responses that eukaryotic cells exhibit— apoptosis, or programmed cell death. During this process, a cell orchestrates its own destruction! The cell first shrinks and forms a rounder shape due to the internal destruction of its nucleus and cytoskeleton (Figure below).


Stages of apoptosis.

Signal transduction pathways lead to apoptosis
Apoptosis involves the activation of cell-signaling pathways. One pathway, called the extrinsic pathway, begins with the activation of death receptors on the cell surface. When death receptors bind to extracellular signaling molecules, a pathway is stimulated that leads to apoptosis. Figure below shows a simplified pathway for this process.


The extrinsic pathway for apoptosis in mammals. 
This simplified pathway leads to apoptosis when cells are exposed to an extracellular signal that causes cell death.

In this example, the signaling molecule is a protein composed of three identical subunits—a trimeric protein. Such trimeric signaling molecules are typically produced by cells of the immune system that recognize abnormal cells and target them for destruction. For example, when a cell is infected with a virus, cells of the immune system may target the infected cell for apoptosis. The signaling molecule binds to three death receptors, which causes them to aggregate into a trimer. This results in a conformational change that exposes a domain on the death receptors called the death domain. Once the death domain is exposed, it binds to adaptors, which then bind to an initiator procaspase. The complex between the death receptors, adaptors, and initiator procaspase is called the death-inducing signaling complex (DISC). Once the initiator procaspase, which is inactive, is part of the death-inducing signaling complex, it is converted by proteolytic cleavage to an initiator caspase, which is active. An active caspase functions as a protease—an enzyme that digests other proteins. After it is activated, the initiator caspase is then released from the DISC. This caspase is called an initiator caspase because it initiates the activation of many other caspases in the cell. These other caspases are called executioner, or effector, caspases because they are directly responsible for digesting intracellular proteins and causing the cell to die. The executioner caspases digest a variety of intracellular proteins, including the proteins that constitute the cytoskeleton and nuclear lamina as well as proteins involved with DNA replication and repair. In this way, the executioner caspases cause the cellular changes. The caspases also activate an enzyme called DNase that chops the DNA in the cell into small fragments. This event may be particularly important for eliminating virally infected cells because it also destroys viral genomes that are composed of DNA. Alternatively, another pathway of apoptosis, called the intrinsic or mitochondrial pathway, is stimulated by DNA damage that could cause cancer. Mitochondria release cytochrome c (a small mitochondrial protein) into the cytosol, which forms a complex with other proteins called an apoptosome. The apoptosome then initiates the activation of caspases.

Multicellularity

What is the largest living organism on Earth? The size of an organism can be defined by its volume, mass, height, length, or the area it occupies. A giant fungus (Armillaria ostoyae), growing in the soil in the Malheur National Forest in Oregon, spans 8.9 km2, or 2,200 acres, which makes it the largest known organism by area. Most of the organism lies below ground, so it is not visible from the surface. In the Mediterranean Sea, marine biologists discovered a giant aquatic plant (Posidonia oceanica) that is 8 km, or 4.3 miles, in length, making it the world’s longest known organism. With regard to mass, the largest organism is probably a tree named the General Sherman tree, which is 83.8 meters tall (275 feet), nearly the length of a football field. This giant sequoia tree (Sequoiadendron giganteum) is estimated to weigh nearly 2 million kg (over 2,000 tons)—equivalent to a herd of 400 elephants!

An organism composed of more than one cell is said to be multicellular. The preceding examples illustrate the amazing sizes that certain multicellular organisms have attained. Some species of protists are multicellular, as are most species of fungi. Plants and animals  are always multicellular organisms. The main benefit of multicellularity arises from the division of labor between different types of cells in an organism. For example, the intestinal cells of animals and the root cells of plants have become specialized for nutrient uptake. Other types of cells in a multicellular organism perform different roles, such as reproduction. In animals, most of the cells of the body—somatic cells—are devoted to the growth, development, and survival of the organism, whereas specialized cells—gametes—function in sexual reproduction. Multicellular species usually have much larger genomes than unicellular species. The increase in genome size is associated with an increase in proteome size—multicellular organisms produce a larger array of proteins than do unicellular species. The additional proteins play a role in three general phenomena.

- First, in a multicellular organism, cell communication is vital for the proper organization and functioning of cells. Many more proteins involved in cell communication are made in multicellular species.
- Second, both the arrangement of cells within the body and the attachment of cells to each other require a greater variety of proteins in multicellular species than in unicellular species.
- Finally, additional proteins play a role in cell specialization because proteins that are needed for the structure and function of one cell type may not be needed in a different cell type, and vice versa. Likewise, additional proteins are needed to regulate the expression of genes so these proteins are expressed in the proper cell types.

Extracellular matrix and cell walls
Organisms are not composed solely of cells. A large portion of an animal or plant consists of a network of material that is secreted from cells and forms a complex meshwork outside of cells. In animals, this is called the extracellular matrix (ECM), whereas plant cells are surrounded by a cell wall. The ECM and cell walls are a major component of certain parts of animals and plants, respectively. For example, bones and cartilage in animals are composed largely of ECM, and the woody portions of plants are composed mostly of cell walls. Although the cells within wood eventually die, the cell walls they have produced provide a rigid structure that supports the plant for years or even centuries. We begin by examining the structure and role of the ECM in animals, focusing on the functions of the major ECM components: proteins and polysaccharides. We will then explore the structure and functions of the cell wall of plant cells.

The extracellular matrix in animals supports and organizes cells and plays a role in cell signaling
Unlike the cells of bacteria, archaea, fungi, and plants, the cells of animals are not surrounded by a rigid cell wall that provides structure and support. However, animal cells secrete materials that form an ECM that provides support and helps to organize cells. Certain animal cells are completely embedded within an extensive ECM, whereas other cells may adhere to the ECM on only one side. Figure below illustrates the general features of the ECM and its relationship to cells.


The extracellular matrix (ECM) of animal cells. 
The micrograph (SEM) at the bottom left shows collagen fibers, a type of protein fiber found in the ECM. The micrograph (TEM) at the bottom right shows a proteoglycan, which consists of polysaccharides attached to a protein.

The major macromolecules of the ECM are proteins and polysaccharides. The most abundant proteins are those that form large fibers. The polysaccharides give the ECM a gel-like character. As we will see, the ECM found in animals performs many important roles, including strength, structural support, organization, and cell signaling.

- Strength: The ECM is the “tough stuff” of animals’ bodies. In the skin of mammals, the strength of the ECM prevents tearing. The ECM found in cartilage resists compression and provides protection to the joints. Similarly, the ECM protects the soft parts of the body, such as the internal organs.
- Structural support: The bones of many animals are composed primarily of ECM. Skeletons not only provide structural support but also facilitate movement via the functioning of attached muscles.
- Organization: The attachment of cells to the ECM plays a key role in the proper arrangement of cells throughout the body. In addition, the ECM binds many body parts together, such as tendons to bones.
- Cell signaling: A less obvious role of the ECM is cell signaling. One way that cells in multicellular organisms sense their environment is via changes in the ECM.

Adhesive and structural proteins are major components of the ECM of animals
In the 1850s, German biologist Rudolf Virchow suggested that all extracellular materials are made and secreted by cells. Around the same time, biologists realized that gelatin and glue, which are produced by the boiling of animal tissues, contain a common fibrous substance. This substance was named collagen (from the Greek, meaning glue-producing). Since that time, experimental techniques in chemistry, microscopy, and biophysics have enabled scientists to probe the structure of the ECM. We now understand that the ECM contains a mixture of several different components, including proteins such as collagen, which form fibers. The proteins found in the ECM are grouped into adhesive proteins, such as fibronectin and laminin, and structural proteins, such as collagen and elastin (Table below).



How do adhesive proteins work? Fibronectin and laminin have multiple binding sites that bind to other components in the ECM, such as protein fibers and polysaccharides. These same proteins also have binding sites for receptors on the surfaces of cells. Therefore, adhesive proteins are so named because they adhere ECM components together and to the cell surface. They provide organization to the ECM and facilitate the attachment of cells to the ECM. Structural proteins, such as collagen and elastin, form large fibers that give the ECM its strength and elasticity. A key function of collagen is to impart tensile strength, which is a measure of how much stretching force a material can bear without tearing apart. Collagen provides high tensile strength to many parts of an animal’s body. It is the main protein found in bones, cartilage, tendons, skin, and the lining of blood vessels and internal organs. In the bodies of mammals, more than 25% of the total protein mass consists of collagen, much more than any other protein. Approximately 75% of the protein in mammalian skin is composed of collagen. Leather is largely a pickled and tanned form of collagen. Proteins, such as collagen, that are secreted from eukaryotic cells are first directed from the cytosol to the endoplasmic reticulum (ER), then to the Golgi apparatus, and subsequently are secreted from the cell via vesicles that fuse with the plasma membrane. Figure below depicts the synthesis and assembly of collagen.


Formation of collagen fibers. 
Collagen is one type of structural protein found in the ECM of animal cells.

Individual procollagen polypeptides (called α chains) are synthesized into the lumen of the ER. Three procollagen polypeptides then associate with each other to form a procollagen triple helix. The amino acid sequences at both ends of the polypeptides, termed extension sequences, promote the formation of procollagen and prevent the formation of a larger fiber. After procollagen is secreted from the cell, extracellular enzymes remove the extension sequences. Once this occurs, the protein, now called collagen, can form larger structures. Collagen proteins assemble in a staggered way to form relatively thin collagen fibrils, which then align and produce large collagen fibers. The many layers of these proteins give collagen fibers their tensile strength. In addition to tensile strength, elasticity is needed in regions of the body such as the lungs and blood vessels, which regularly expand and return to their original shape. In these places, the ECM contains elastic fibers composed primarily of the protein elastin (Figure below).


Structure and function of elastic fibers. 
Elastic fibers are made of elastin, one type of structural protein found in the ECM surrounding animal cells.

Elastin proteins form many covalent crosslinks to make a fiber with remarkable elastic properties. In the absence of a stretching force, each protein tends to adopt a compact conformation. When subjected to a stretching force, however, the compact proteins become more linear, with the covalent crosslinks holding the fiber together. When the stretching force has ended, the proteins naturally return to their compact conformation. In this way, elastic fibers behave much like a rubber band, stretching under tension and snapping back when the tension is released. More flexible collagen fibers support the lining of your lungs and intestines. In addition, domains within the collagen polypeptide affect the spatial arrangement of collagen proteins. The collagen shown in Figure above forms fibers in which collagen proteins align themselves in parallel arrays. However, not all collagen proteins form long fibers. For example, type IV collagen proteins interact with each other in a meshwork pattern. This meshwork acts as a filter around capillaries. Gene regulation controls which types of collagens are made throughout the body and in what amounts they are made. Of the 27 types of collagens identified in humans, the Table below considers types I to IV, each of which varies as to where it is primarily synthesized and its structure and function.



In skin cells, for example, the genes that encode the polypeptides that make up collagen types I, III, and IV are turned on, but the synthesis of type II collagen is minimal. The regulation of collagen synthesis has received a great deal of attention due to the phenomenon of wrinkling. As we age, the amount of collagen that is synthesized in our skin significantly decreases. The underlying network of collagen fibers, which provides scaffolding for the surface of our skin, loosens and unravels. This is one factor that causes the skin of older people to sink, sag, and form wrinkles. Various therapeutic and cosmetic agents have been developed to prevent or reverse the appearance of wrinkles, most with limited benefits. For example, many face and skin creams contain collagen as an ingredient. Another approach is collagen injections, in which small amounts of collagen (from cows) are injected into areas where the body’s collagen has weakened, filling the depressions to the level of the surrounding skin. Because collagen is naturally broken down in the skin, the injections are not permanent and last only about 3 to 6 months.

Animal cells also secrete polysaccharides into the ECM
Polysaccharides are the second major component of the ECM of animals. Polysaccharides are polymers of sugars. Among vertebrates, the most abundant types of polysaccharides in the ECM are glycosaminoglycans (GAGs). These macromolecules are long, unbranched polysaccharides containing a repeating disaccharide unit (Figure a below ).


Structures of glycosaminoglycans and proteoglycans.
These macromolecules are found in the ECM, which is located outside of animal cells. (a) Glycosaminoglycans (GAGs) are composed of repeating disaccharide units. They range in length from several dozen to 25,000 disaccharide units. The GAG shown here is chondroitin sulfate, which is a component of cartilage. (b) Proteoglycans are composed of a long, linear core protein with many GAGs attached. Note that each GAG is typically 80 disaccharide units long but only a short chain of sugars is shown in this illustration.

GAGs are highly negatively charged molecules that tend to attract positively charged ions and water. The majority of GAGs in the ECM are linked to core proteins, forming proteoglycans (Figure b above)

Providing resistance to compression is the primary function of GAGs and proteoglycans. Once secreted from cells, these macromolecules form a gel-like component in the ECM. How is this gellike property important? Due to its high water content, the ECM is difficult to compress and thereby serves to protect cells. GAGs and proteoglycans are found abundantly in regions of the body that are subjected to harsh mechanical forces, such as the joints of the human body. Two examples of GAGs are chondroitin sulfate, which is a major component of cartilage, and hyaluronic acid, which is found in the skin, eyes, and joint fluid. Purified hyaluronic acid is also used to treat wrinkles and give skin fullness. Among many invertebrates, an important ECM component is chitin, a nitrogen-containing polysaccharide. Chitin forms the hard protective outer covering (called an exoskeleton) of insects, such as crickets and grasshoppers, and crustaceans, such as lobsters and shrimp. As these animals grow, they periodically shed this rigid outer layer and secrete a new, larger one—a process called molting.

The cell wall of plants provides strength and resistance to compression
Let’s now turn our attention to the cell walls of plants. Plant cells are surrounded by a cell wall, a protective layer that forms outside of the plasma membrane. Like animal cells, the cells of plants are surrounded by material that provides tensile strength and resistance to compression. The cell walls of plants, however, are usually thicker, stronger, and more rigid than the ECM found in animals. Plant cell walls provide rigidity for mechanical support and also play a role in the maintenance of cell shape and the direction of cell growth. The cell wall also prevents expansion when water enters the cell, thereby preventing osmotic lysis. The main macromolecule of the plant cell wall is cellulose, a polysaccharide made of repeating molecules of glucose attached end to end. These glucose polymers associate with each other via hydrogen bonding to form microfibrils that provide great tensile strength (Figure below).


Structure of cellulose, the main macromolecule of the primary cell wall. 
Cellulose is made of repeating glucose units linked end to end that hydrogen-bond to each other to form microfibrils (SEM).

Cellulose was discovered in 1838 by French chemist Anselme Payen, who was the first scientist to attempt to separate wood into its component parts. After treating different types of wood with nitric acid, Payen obtained a fibrous substance that was also found in cotton and other plants. His chemical analysis revealed that the fibers were made of the carbohydrate glucose. Payen called this substance cellulose (from the Latin, meaning consisting of cells). Cellulose is probably the single most abundant organic molecule on Earth. Wood consists mostly of cellulose, and cotton and paper are almost pure cellulose.

Plant cell walls consist of primary and secondary walls
The cell walls of plants are composed of a primary cell wall and a secondary cell wall (Figure below). These walls are named based on the timing of their synthesis—the primary cell wall is made before the secondary cell wall.


Structure of the cell wall of plant cells. 
The primary cell wall is relatively thin and flexible. It contains cellulose (tan), hemicellulose (red), crosslinking glycans (blue), and pectin (green). The secondary cell wall, which is produced only by certain plant cells, is made after the primary cell wall and is synthesized in successive layers.

Primary Cell
Wall During cell division, the primary cell wall develops between two newly formed daughter cells. It is usually very flexible and allows the new cells to increase in size. The main constituent of the primary cell wall is cellulose. In addition to cellulose, other components found in the primary cell wall include hemicellulose, glycans, and pectins (see Figure above). Hemicellulose is another linear polysaccharide, with a structure similar to that of cellulose, but it contains sugars other than glucose in its structure and usually forms thinner microfibrils. Glycans, polysaccharides with branching structures, are also important in cell wall structure. The crosslinking glycans bind to cellulose and provide organization to the  cellulose microfibrils. Pectins, which are highly negatively charged polysaccharides, attract water and have a gel-like character that provides the cell wall with the ability to resist compression.

Secondary Cell Wall 
The secondary cell wall is synthesized and deposited between the plasma membrane and the primary cell wall (see Figure above) after a plant cell matures and has stopped increasing in size. It is made in layers by the successive deposition of cellulose microfibrils and other components. Whereas the primary wall structure is relatively similar in nearly all cell types and species, the structure of the secondary cell wall is more variable. Some plant cells have no secondary cell wall; for example, leaf cells that are involved in photosynthesis lack a secondary wall, allowing light to enter the cells more readily. The secondary cell wall often contains components in addition to those found in the primary cell wall. For example, phenolic compounds called lignins, which are found in the woody parts of plants, are very hard and impart considerable strength to the secondary wall structure.

Cell Junctions
Thus far, we have learned that the cells of animals and plants produce an ECM or cell wall that provides strength, support, and organization. To become a multicellular organism, cells within the body must also be linked to each other. In animals and plants, this is accomplished by specialized structures called cell junctions (Table below).



Animal cells, which lack the structural support provided by the cell wall, have a more varied group of cell junctions than plant cells. In animals, three types of junctions are found between cells: anchoring junctions play a role in anchoring cells to each other or to the ECM; tight junctions seal cells together to prevent small molecules from leaking across a layer of cells; and gap junctions allow the passage of materials between adjacent cells. In plants, cellular organization is somewhat different because plant cells are surrounded by a rigid cell wall. Plant cells are connected to each other by a component called the middle lamella, which cements their cell walls together. They also have junctions termed plasmodesmata that allow the passage of materials between adjacent cells. In this section, we will examine these various types of junctions found between the cells of animals and plants.

Anchoring jJunctions link animal cells to each other and to the ECM
Electron microscopy allows researchers to explore the types of junctions that occur between cells and within the ECM. In the 1960s, Marilyn Farquhar, George Palade, and colleagues conducted several studies showing that various types of cell junctions connect cells to each other. Collectively called anchoring junctions, these junctions attach cells to each other and to the ECM. Anchoring junctions are common in parts of the body where the cells are tightly connected and form linings. An example is the layer of cells that line the small intestine. Anchoring junctions keep these intestinal cells tightly adhered to one another, thereby forming a strong barrier between the
lumen of the intestine and the blood. A key component of anchoring junctions that form the actual connections are integral membrane proteins called cell adhesion molecules (CAMs). Two types of CAMs are cadherins and integrins. Anchoring junctions are grouped into four main categories, according to their functional roles and their connections to cellular components. Figure below shows these junctions between cells of the mammalian small intestine.


Types of anchoring junctions. 
This figure shows these junctions in three adjacent intestinal cells. The tops of these cells face the lumen of the intestine, whereas the bottoms are adjacent to the ECM and a blood vessel.

1. Adherens junctions connect cells to each other via cadherins. In many cases, these junctions are organized into bands around cells. In the cytosol, adherens junctions bind to cytoskeletal filaments called actin filaments.
2. Desmosomes also connect cells to each other via cadherins. They are spotlike points of intercellular contact that rivet cells together. Desmosomes are connected to cytoskeletal filaments called intermediate filaments.
3. Hemidesmosomes connect cells to the extracellular matrix via integrins. Like desmosomes, they interact with intermediate filaments.
4. Focal adhesions also connect cells to the ECM via integrins. In the cytosol, focal adhesions bind to actin filaments.

Cell adhesion molecules (CAMs) form links between cells and to the ECM


Cadherins 
As mentioned, cadherins are CAMs that create cellto-cell junctions (Figure a).



Types of cell adhesion molecules (CAMs). 
Cadherins and integrins are CAMs that form connections in anchoring junctions.
(a) A cadherin in one cell binds to a cadherin of an identical type in an adjacent cell. This binding requires Ca2+. In the cytosol, cadherins bind to actin or intermediate filaments of the cytoskeleton via linker proteins. 
(b) Integrins link cells to the ECM and form intracellular connections to actin or intermediate filaments. Each integrin protein is composed of two nonidentical subunits, a heterodimer.

The extracellular domains of two cadherin proteins, each in adjacent cells, bind to each other to promote cell-to-cell adhesion. This binding requires the presence of calcium ions (Ca2+), which change the conformation of the cadherin protein such that cadherins in adjacent cells bind to each other. (This calcium dependence is where cadherin gets its name—Ca2+-dependent adhering molecule.) On the interior of the cell, linker proteins connect cadherins to actin or intermediate filaments of the cytoskeleton. This promotes a more stable interaction between two cells because their strong cytoskeletons are connected to each other. The genomes of vertebrates and invertebrates contain multiple cadherin genes, which encode slightly different cadherin proteins. The expression of cadherins in particular cell types allows cells to recognize each other. Dimer formation follows a homophilic, or like-to-like, binding mechanism. To understand the concept of homophilic binding, let’s consider an example. One type of cadherin is called E-cadherin, and another is N-cadherin. E-cadherin in one cell binds to E-cadherin in an adjacent cell to form a homodimer. However, E-cadherin in one cell does not bind to N-cadherin in an adjacent cell to form a heterodimer. Similarly, N-cadherin binds to N-cadherin but not to E-cadherin in an adjacent cell. Why is such homophilic binding important? By expressing only certain types of cadherins, each cell binds only to other cells that express the same cadherin types. This phenomenon plays a key role in the proper arrangement of cells throughout the body, particularly during embryonic development.

Integrins 
Another type of CAMs are proteins called integrins, which form connections between cells and the ECM. Integrins do not require Ca2+ to function. Each integrin protein is composed of two nonidentical subunits. In the example shown in Figure above, an integrin is bound to fibronectin, an adhesive protein in the ECM that binds to other ECM components such as collagen fibers. Like cadherins, integrins also bind to actin or intermediate filaments in the cytosol of the cell, via linker proteins, to promote a strong association between the cytoskeleton and the ECM. Thus, integrins have an extracellular domain for the binding of ECM components and an intracellular domain for the binding of cytosolic proteins. When CAMs were first discovered, researchers imagined that cadherins and integrins played only a mechanical role. In other words, their functions were described as holding cells together or to the ECM. More recently, however, experiments have shown that cadherins and integrins are important in cell communication. The formation or breaking of cell-to-cell and cell-to-ECM anchoring junctions affects signal transduction pathways within the cell. Similarly, intracellular signal transduction pathways affect cadherins and integrins in ways that alter intercellular junctions and the binding of cells to ECM components. Abnormalities in CAMs such as integrins are associated with the ability of cancer cells to metastasize, that is, to move to other parts of the body. CAMs are critical for keeping cells in their correct locations. When they become defective due to cancer-causing mutations, cells lose their proper connections with the ECM and adjacent cells and may move to other parts of the body.

Tight junctions prevent the leakage of materials across animal cell layers
In animals, tight junctions are a second type of junction, one that forms a tight seal between adjacent cells, thereby preventing material from leaking between cells. As an example, let’s consider the intestine. The cells that line the intestine form a sheet that is one cell thick. One side of each cell faces the intestinal lumen, and the other faces the ECM and a blood vessel (Figure below). Tight junctions are formed between these cells.


Tight junctions between adjacent intestinal cells. 
In this example, tight junctions form a seal between cells of the intestinal lining. The inset shows the interconnected network of occludin and claudin that forms the tight junction

Tight junctions are made by membrane proteins, called occludin and claudin, that form interlaced strands in the plasma membrane (see inset in Figure above). These strands of proteins, each in adjacent cells, bind to each other, thereby forming a tight seal between cells. Tight junctions are not mechanically strong like anchoring junctions, because they do not have strong connections with the cytoskeleton. Therefore, adjacent cells that have tight junctions also have anchoring junctions to hold the cells in place.

Tight junctions perform several important roles. Let’s consider a few examples.
-Tight junctions between intestinal cells prevent leakage of materials between the lumen of the intestine and the blood.
-Tight junctions help maintain the polarity of intestinal cells by preventing the lateral diffusion of integral membrane proteins between the apical side (which faces the lumen of the intestine) and the basolateral side (which faces a blood vessel). For example, proteins involved with receptor-mediated endocytosis are restricted to the apical side, and proteins involved with exocytosis are located at the basolateral side. Thus, intestinal cells are able to take up nutrients from the intestinal lumen and export them into the bloodstream, a phenomenon called transepithelial transport.
- Tight junctions prevent microbes from entering the body. In mammals, the skin on the exterior of the body and the lining of the digestive tract are formed from interconnected cells that have tight junctions. Some pathogenic microorganisms, such as those that cause certain forms of diarrhea, are able to cause infection by disrupting tight junctions.

The amazing ability of tight junctions to prevent the leakage of material across cell layers has been demonstrated by dye-injection studies. In 1972, Daniel Friend and Norton Gilula injected lanthanum into the bloodstream of a rat. Lanthanum is an electron-dense element that can be visualized using electron microscopy. A few minutes later, a sample of a cell layer in the digestive tract was removed and observed under an electron microscope. As seen in the micrograph in Figure below, lanthanum diffused into the region between the cells that faces the blood, but it could not move past the tight junction to the side of the cell layer facing the lumen of the digestive tract.


An experiment demonstrating the function of a tight junction. 
When lanthanum was injected into the bloodstream of a rat, it diffused between the cells in the region up to a tight junction but could not diffuse past the junction to the other side of the cell layer.

Gap Junctions between animal cells provide passageways for intercellular transport
A third type of junction found between animal cells is called a gap junction, because a small gap occurs between the plasma membranes of cells connected by these junctions (Figure below).


Gap junctions between adjacent cells. 
Gap junctions form intercellular channels that allow the passage of small solutes with masses less than 1,000 Da. A connexon consists of six proteins called connexins. Two connexons align to form an intercellular channel. The micrograph shows a gap junction, which is composed of many connexons, between intestinal cells.

Gap junctions are abundant in tissues and organs where the cells need to communicate with each other. For example, cardiac muscle cells, which cause your heart to beat, are interconnected by many gap junctions. Because gap junctions allow the passage of ions, electrical changes in one cardiac muscle cell are easily transmitted to an adjacent cell that is connected via gap junctions. This is needed for the coordinated contraction of cardiac muscle cells. In vertebrates, gap junctions are composed of an integral membrane protein called connexin. Invertebrates have a structurally similar protein called innexin. Six connexin proteins in one vertebrate cell form a channel called a connexon. A connexon in one cell aligns with a connexon in an adjacent cell to form an intercellular channel (see middle drawing in Figure above). The term gap junction refers to a cluster of many connexons that are close to each other in the plasma membrane and form many intercellular channels. Connexons allow the passage of ions and small molecules, including amino acids, sugars, and signaling molecules such as Ca2+ and cAMP, between cells. In this way, gap junctions allow adjacent cells to share metabolites and directly signal each other. However, gap junction channels are too small to allow the passage of RNA, proteins, or polysaccharides. Therefore, cells that communicate via gap junctions still maintain their own distinctive sets of macromolecules.

The middle lamella cements adjacent plant cell walls together
In animals, cell-to-cell contact via anchoring junctions, tight junctions, and gap junctions involves interactions between membrane proteins in adjacent cells. In plants, cell junctions are biochemically different. Rather than using membrane proteins to form cell-to-cell connections, plant cells make an additional component called the middle lamella (plural, lamellae), which is found between most adjacent plant cells (Figure below).


Plant cell-to-cell junctions known as middle lamellae.

When plant cells are dividing, the middle lamella is the first layer formed. The primary cell wall is then made. The middle lamella is rich in pectins, negatively charged polysaccharides that are also found in the primary cell wall. Pectins attract water and make a hydrated gel. Ca2+ and Mg2+ interact with the negative charges in the pectins and cement the cell walls of adjacent cells together. The process of fruit ripening illustrates the importance of pectins in holding plant cells together. An unripened fruit, such as a green tomato, is very firm because the rigid cell walls of adjacent cells are firmly attached to each other. During ripening, the cells secrete a group of enzymes called pectinases, which digest pectins in the middle lamella as well as those in the primary cell wall. As this process continues, the attachments between cells are broken, and the cell walls become less rigid. For this reason, a red ripe tomato is much less firm than an unripe tomato.

Plasmodesmata are channels connecting the cytoplasm of adjacent plant cells
In 1879, Eduard Tangl, a Russian botanist, observed intercellular connections in the seeds of the strychnine tree and hypothesized that the cytoplasm of adjacent cells is connected by ducts in the cell walls. He was the first to propose that direct cell-to-cell communication integrates the functioning of plant cells. The ducts or intercellular channels that Tangl observed are now known as plasmodesmata (singular, plasmodesma). Plasmodesmata are functionally similar to gap junctions in animal cells because they are open pores that allow the passage of ions and molecules between the cytosol of adjacent plant cells. However, the structure of plasmodesmata is quite different from that of gap junctions. As shown in Figure below, the plasma membrane of one cell is continuous with the plasma membrane of the adjacent cell, which permits the diffusion of molecules from the cytosol of one cell to the cytosol of the other. In addition to a cytosolic connection, plasmodesmata also have a central tubule, called a desmotubule, connecting the smooth ER membranes of adjacent cells.


Structure of plasmodesmata. 
Plasmodesmata are cell junctions connecting the cytosol of adjacent plant cells, allowing water, ions, and molecules to pass from cell to cell. At these pores, the plasma membrane of one cell is continuous with the plasma
membrane of an adjacent cell. In addition, the smooth ER from one cell is connected to that of the adjacent cell via a desmotubule.

Plasmodesmata can change the size of their opening among closed, open, and dilated states. In the open state, they allow the passage of ions and small molecules, such as sugars and cAMP. In this state, plasmodesmata play a similar role to gap junctions between animal cells. Plasmodesmata tend to close when a large pressure difference occurs between adjacent cells. Why does this happen? One reason is related to cell damage. When a plant is wounded, damaged cells lose their turgor pressure. The closure of plasmodesmata between adjacent cells helps to prevent the loss of water and nutrients from the wound site. Unlike gap junctions between animal cells, plasmodesmata can dilate to also allow the passage of macromolecules and even viruses between adjacent plant cells. Though the mechanism of dilation is not well understood, the wider opening of plasmodesmata is important for the passage of proteins and mRNA during plant development. It also provides a key mechanism whereby viruses can move from cell to cell.

Tissues
A tissue is a part of an animal or plant consisting of a group of cells having a similar structure and function. In this section, we will view tissues from the perspective of cell biology. Animals and plants contain many different types of cells. Humans, for example, have over 200 different cell types, each with a specific structure and function. Even so, these cells can be grouped into a few general categories. For example, muscle cells found in your heart (cardiac muscle cells), in your biceps (skeletal muscle cells), and around your arteries (smooth muscle cells) look somewhat different under the microscope and have unique roles in the body. Yet due to structural and functional
similarities, all three types are categorized as muscle tissue. In this section, we begin by surveying the basic processes that cells undergo to make tissues. Then, we will examine the main categories of animal and plant tissues.

Six different cell processes produce tissues and organs
A multicellular organism, such as a plant or animal, contains many cells. For example, an adult human has somewhere between 10 and 100 trillion cells in her or his body. Cells are organized into tissues, and tissues are organized into organs. An organ is a collection of two or more tissues that performs a specific function or set of functions. The heart is an organ found in the bodies of complex animals, and a leaf is an organ found in plants.  How are tissues and organs formed? To form tissues and organs, cells undergo six different processes that influence their morphology, arrangement, and number: cell division, cell growth, differentiation, migration, apoptosis, and the formation of cell connections.

1. Cell division: As discussed in Chapter 15, eukaryotic cells progress through a cell cycle that leads to cell division.
2. Cell growth: Following cell division, cells take up nutrients and usually expand in volume. Cell division and cell growth are the primary mechanisms for increasing the size of tissues, organs, and organisms.
3. Differentiation: Due to gene regulation, cells differentiate into specialized types of cells. 
4. Migration: During embryonic development in animals, cells migrate to their appropriate positions within the body. Also, adults have cells that can move into regions that have become damaged. Cell migration does not occur during plant development.
5. Apoptosis: Programmed cell death, also known as apoptosis, is necessary to produce certain morphological features of the body. For example, during development in mammals, the formation of individual fingers and toes requires the removal, by apoptosis, of the skin cells between them.
6. Cell connections: In the first section of this chapter, we learned that cells produce an extracellular matrix or cell wall that provides strength and support. In animals, the ECM serves to organize cells within tissues and organs. In plants, the connections and structures of cell walls are largely responsible for the shapes of plant tissues. Different types of cell junctions in both animal and plant cells enable cells to make physical contact and communicate with one another.

Animals are composed of epithelial, connective, nervous, and muscle tissues
The body of an animal contains four general types of tissue—epithelial, connective, nervous, and muscle—that serve very different purposes (Figure below).


Examples of the four general types of tissues— epithelial, connective, nervous, and muscle—found in animals.

Epithelial Tissue
Epithelial tissue is composed of cells that are joined together via tight junctions and form continuous sheets. Epithelial tissue covers or forms the lining of all internal and external body surfaces. For example, epithelial tissue lines organs such as the lungs and digestive tract. In addition, epithelial tissue forms the outer layer of the skin, a protective surface that shields the body from the outside environment. Connective Tissue Most connective tissue provides support to the body and/or helps to connect different tissues to each other. Connective tissue is rich in ECM. Examples of connective tissue include cartilage, tendons, bone, fat tissue, and the inner layers of the skin. Blood is also considered a form of connective tissue because it provides liquid connections to various regions of the body. Figure below shows a micrograph of cartilage, a connective tissue found in joints such as your knees.


An example of connective tissue in animals that is rich in extracellular matrix. 
This micrograph of cartilage shows chondrocytes in the ECM. The chondrocytes, which are responsible for making the components of cartilage, are found in cavities called lacunae.

The cells that synthesize cartilage, known as chondrocytes, actually represent a small proportion of the total volume of cartilage. The chondrocytes are found in small cavities within the cartilage called lacunae (singular, lacuna). In some types of cartilage, the chondrocytes represent only 1–2% of the total volume of the tissue! Chondrocytes are the only cells found in cartilage. They are solely responsible for the synthesis of protein fibers, such as collagen, as well as the glycosaminoglycans and proteoglycans that are found in cartilage. 

Nervous Tissue 
Nervous tissue receives, generates, and conducts electrical signals throughout the body. In vertebrates, these electrical signals are integrated by nervous tissue in the brain and transmitted down the spinal cord to the rest of the body.

Muscle Tissue 
Muscle tissue generates a force that facilitates movement. Muscle contraction is needed for bodily movements, such as walking and running, and also plays a role in the movement of materials throughout the body. For example, contraction of heart muscle propels blood through your body, and smooth muscle contractions move food through the digestive system

Plants contain dermal, ground, and vascular tissues
Plant biologists classify tissues as simple or complex. Simple tissues are composed of one or possibly two cell types. Complex tissues are composed of two or more cell types but lack an organization that would qualify them as organs. The bodies of most plants contain three general types of simple or complex tissues—dermal, ground, and vascular— each with a different structure suited to its functions (Figure below).


Locations of the three general types of tissues— dermal, ground, and vascular—found in plants.

Dermal Tissue
Dermal tissue is a complex tissue that forms a covering on various parts of the plant. The term epidermis refers to the newly made dermal tissue on the surfaces of leaves, stems, and roots. Plant epidermal cells have a thick primary cell wall and are tightly interlocked by their middle lamellae. As a consequence, these cells are held closely together, much like epithelial cell layers in animals. The epidermal cells of leaves usually secrete a waxy cuticle to prevent water loss. In addition, leaf epidermis often has hairs, or trichomes, which are specialized types of epidermal cells. Trichomes have diverse functions, including the secretion of oils and leaf protection. In leaves, epidermal cells called guard cells form pores known as stomata, which permit gas exchange. The function of the root epidermis is the absorption of water and nutrients. The root epidermis does not have a waxy cuticle because such a cuticle would inhibit water and nutrient absorption.

Ground Tissue 
Most of a plant’s body is made of ground tissue, which has a variety of functions, including photosynthesis, storage of carbohydrates, and support. Ground tissue is subdivided into three types of simple tissues: parenchyma, collenchyma, and sclerenchyma. Let’s look briefly at each of these types of ground tissue 

1. Parenchyma is very active metabolically. The mesophyll, the central part of the leaf that carries out the bulk of photosynthesis, is composed of parenchyma. Parenchyma also functions in the storage of carbohydrates. The cells of parenchyma usually lack a secondary cell wall.
2. Collenchyma provides structural support to the plant body, particularly to growing regions such as the periphery of the stems and leaves. Collenchyma cells tend to have thick, secondary cell walls but do not contain much lignin. Therefore, they provide support but are also able to stretch.
3. Sclerenchyma also provides structural support to the plant body, particularly to those parts that are no longer growing, such as the dense, woody parts of stems. The secondary cell walls of sclerenchyma cells tend to have large amounts of lignin, which provides rigid support. In many cases, sclerenchyma cells are dead at maturity, but their cell walls continue to provide structural support during the life of the plant.

Vascular Tissue 
Some types of modern plants, such as mosses, are nonvascular plants that lack conducting vessels. These plants tend to be small and live in damp, shady places. Most plants living today, however, are vascular plants. In these species, which include ferns and seed plants, the vascular tissue is a complex tissue composed of cells that are interconnected and form conducting vessels for water and nutrients. As described in greater detail in Chapter 38, the two types of vascular tissue are called xylem and phloem. The xylem transports water and mineral ions from the root to the rest of the plant, and the phloem distributes the products of photosynthesis and a variety of other nutrients throughout the plant.

Gene expression at the molecular level

Even before DNA was discovered to be the genetic material, scientists had asked, “How does the functioning of genes produce the traits of living organisms?” At the molecular level, a similar question can be asked: “How do genes affect the composition and/or function of molecules found within living cells?” An approach that was successful in answering these questions involved the study of mutations, which are changes in the genetic material that can be inherited. Mutations may affect the genetic blueprint by altering gene function. For this reason, research that focused on the effects of mutations proved instrumental in determining the molecular function of genes. The role of some genes is to carry the information to produce enzymes, which are a type of protein.

Molecular gene expression involves the processes of transcription and translation
Let’s now examine the general steps of gene expression at the molecular level. The first step, known as transcription, produces an RNA copy of a gene, also called an RNA transcript (Figure below).


The central dogma of gene expression at the molecular level. 
(a) In bacteria, transcription and translation occur in the cytoplasm. 
(b) In eukaryotes, transcription and RNA modification occur in the nucleus, whereas translation takes place in the cytosol.

The term transcription literally means the act of making a copy. Most genes, which are termed structural genes,* produce an RNA molecule that contains the information to specify a polypeptide with a particular amino acid sequence. This type of RNA is called messenger RNA (abbreviated mRNA), because its function is to carry information from the DNA to cellular components called ribosomes. As discussed later, ribosomes play a key role in the synthesis of polypeptides. The process of synthesizing a specific polypeptide on a ribosome is called translation. The term translation is used because a nucleotide sequence in mRNA is “translated” into an amino acid sequence of a polypeptide. Together, the transcription of DNA into mRNA and the translation of mRNA into a polypeptide constitute the central dogma of gene expression at the molecular level, which was first proposed by Francis Crick in 1958 (see Figure above). The central dogma applies equally to bacteria, archaea, and eukaryotes. However, in eukaryotes, an additional step occurs between transcription and translation.

During RNA modification,  the RNA transcript, termed pre-mRNA, is modified in ways that make it a functionally active mRNA (Figure b above). Another difference between bacteria and eukaryotes is the cellular location of transcription and translation. In bacteria, both events occur in the same location, namely, the cytoplasm. In eukaryotes, transcription occurs in the nucleus. The mRNA then exits the nucleus through a nuclear pore, and translation occurs in the cytosol. Though the direction of information flow, that is, from DNA to RNA to protein, is the most common pathway, exceptions do occur. For example, certain viruses use RNA as a template to synthesize DNA.

The protein products of genes largely determine an organism’s characteristics
The genes that constitute the genetic material provide a blueprint for the characteristics of every organism. They contain the information necessary to produce an organism and allow it to favorably interact with its environment. Each structural gene stores the information for the production of a polypeptide, which then becomes a unit within a functional protein. The activities of proteins determine the structure and function of cells. Furthermore, the characteristics of an organism are rooted in the activities of cellular proteins. The main purpose of the genetic material is to encode the production of proteins in the correct cell, at the proper time, and in suitable amounts. This is an intricate task, because living cells make thousands of different kinds of proteins. Genetic analyses have shown that a typical bacterium can make a few thousand different proteins, and estimates for eukaryotes range from several thousand in simpler eukaryotes to tens of thousands in more complex eukaryotes like humans.


At the molecular level, a gene is transcribed and produces a functional product
What is a gene? At the molecular level, a gene is defined in the following way:

A gene is an organized unit of DNA sequences that enables a segment of DNA to be transcribed into RNA and ultimately results in the formation of a functional product.


When a structural gene is transcribed, an mRNA is made that specifies the amino acid sequence of a polypeptide. After it is made, the polypeptide becomes a functional product. The mRNA is an intermediary in polypeptide synthesis. Among all species, most genes are structural genes. However, for some genes, the functional product is the RNA itself. The RNA from a nonstructural gene is never translated. Two important products of nonstructural genes are transfer RNA and ribosomal RNA. Transfer RNA (tRNA) translates the language of mRNA into that of amino acids. Ribosomal RNA (rRNA) forms part of ribosomes, which provide the site where translation occurs. . A gene is composed of specific base sequences organized in a way that allows the DNA to be transcribed into RNA. Figure below shows the general organization of sequences in a structural gene.


A structural gene as a transcriptional unit.

The promoter is a sequence of DNA that controls when and where transcription will begin. By comparison, the terminator specifies the end of transcription. Therefore, transcription occurs between these two boundaries. As shown in Figure above, the DNA is transcribed into mRNA from the end of the promoter through the coding sequence to the terminator. Within this transcribed region is the information that will specify the amino acid sequence of a polypeptide when the mRNA is translated. Other DNA sequences are involved in the regulation of transcription. When a regulatory protein binds to a regulatory sequence, the rate of transcription is affected. Some regulatory proteins enhance the rate of transcription, whereas others inhibit it.

During transcription, RNA Polymerase Uses a DNA template to make RNA
Transcription occurs in three stages, called initiation, elongation, and termination, during which various proteins interact with DNA sequences (Figure below).

Initiation 
The stage called initiation is a recognition step. In bacteria such as E. coli, a protein called sigma factor binds to RNA polymerase, the enzyme that synthesizes strands of RNA. Sigma factor also recognizes the base sequence of a promoter and binds there. An example of a promoter sequence is described in the legend to Figure below. 


Stages of transcription. 
Transcription can be divided into initiation, elongation, and termination. The inset emphasizes the direction of RNA synthesis and base pairing between the DNA template strand and RNA. An example of a promoter sequence in E. coli is:5′-TTGACATGATAGAAGCACTCTACTATATT-3′
    3′-AACTGTACTATCTTCGTGAGATGATATAA-5′
This region is 29 bp long, and it immediately precedes the site where transcription begins. The bases that are specifically recognized by sigma factor are shown in red. The sequences of promoters for different genes are fairly diverse, particularly in eukaryotic species.

The role of sigma factor is to cause RNA polymerase to bind to the promoter. The initiation stage is completed when the DNA strands are separated near the promoter to form an open complex that is approximately 10–15 bp long.

Elongation 
During elongation, RNA polymerase synthesizes the RNA transcript. For this to occur, sigma factor is released and RNA polymerase slides along the DNA in a way that maintains an open complex as it goes. The DNA strand that is used as a template for RNA synthesis is called the template strand. For structural genes, the opposite DNA strand is called the coding strand. The coding strand has the same sequence of bases as the resulting mRNA, except that the RNA has uracil instead of the thymine found in the DNA. The coding strand is so named because, like mRNA, it carries the information that codes for a polypeptide. During the elongation stage of transcription, nucleotides bind to the template strand and are covalently connected in the 5′ to 3′ direction (see inset of step 2, Figure above). The complementarity rule used in this process is similar to the AT/GC rule of DNA replication, except that uracil (U) in RNA substitutes for thymine (T) in DNA. For example, a DNA template with a sequence of 3′–TACAATGTAGCC–5′ will be transcribed into an RNA sequence reading 5′–AUGUUACAUCGG–3′. In bacteria, the rate of RNA synthesis is about 40 nucleotides per second! Behind the open complex, the DNA rewinds back into a double helix.

Termination 
Eventually, RNA polymerase reaches a terminator, which causes it and the newly made RNA transcript to dissociate from the DNA. This event constitutes the termination of transcription. When considering the transcription of multiple genes within a chromosome, the DNA strand that is used as the template strand varies among different genes. Figure below shows three genes adjacent to each other within a chromosome. Genes A and B are transcribed from left to right, using the bottom DNA strand as the template strand. By comparison, gene C is transcribed from right to left, using the top DNA strand as a template strand. In all three cases, however, the synthesis of the RNA transcript begins at a promoter and always occurs in a 5′ to 3′ direction. The template strand is read in the 3′ to 5′ direction.


The transcription of three different genes found in the same chromosome. 
RNA polymerase synthesizes each RNA transcript in a 5′ to 3′ direction, sliding along a DNA template strand in a 3′ to 5′ direction. However, the use of the template strand can vary from gene to
gene. For example, genes A and B use the bottom strand, while gene C uses the top strand.

Transcription in eukaryotes involves more proteins
The basic features of transcription are similar among all organisms. The genes of all species have promoters, and the transcription process occurs in the stages of initiation, elongation, and termination. However, the transcription of eukaryotic genes tends to involve a greater complexity of protein components than does the transcription of bacterial genes. For example, three forms of RNA polymerase, designated I, II, and III, are found in eukaryotes. RNA polymerase II is responsible for transcribing the mRNA from eukaryotic structural genes, whereas RNA polymerases I and III transcribe nonstructural genes such as the genes that encode tRNAs and rRNAs. By comparison, bacteria have a single type of RNA polymerase that transcribes all genes, though many bacterial species have more than one type of sigma factor that can recognize different promoters.

The initiation stage of transcription in eukaryotes is also more complex. Recall that in bacteria such as E. coli, sigma factor recognizes the promoter of genes. By comparison, RNA polymerase II of eukaryotes always requires five general transcription factors to initiate transcription. Transcription factors are proteins that influence the ability of RNA polymerase to transcribe genes. The binding of RNA polymerase II to the promoter is an assembly process in which RNA polymerase II and the five transcripiton factors form a preinitiation complex (Figure below). The complex then unwinds the DNA to initiate transcription.


The preinitiation complex. 
Transcription factors and RNA polymerase II assemble into the preinitiation complex at the promoter in eukaryotic structural genes.

RNA Modification in Eukaryotes
Eukaryotic mRNA transcripts undergo modifications to produce functional mRNA. Transcription initially produces a longer RNA, called pre-mRNA, which undergoes certain modifications before it exits the nucleus. The final product is called a mature mRNA, or simply mRNA (Figure below).


Modifications to eukaryotic pre-mRNA that are needed to produce a mature mRNA molecule. 
Note: Most RNA molecules are spliced after the pre-mRNA is completely synthesized. However, for some of them, splicing may begin before transcription of the pre-mRNA is completed.

In the late 1970s, when the experimental tools became available to study eukaryotic genes at the molecular level, the scientific community was astonished by the discovery that the coding sequences within many eukaryotic structural genes are separated by DNA sequences that are transcribed but not translated into protein. These intervening sequences that are not translated are called introns, whereas sequences contained in the mature mRNA are termed exons. Exons are expressed regions, whereas introns are intervening regions that are not expressed because they are removed from the pre-mRNA. To become a functional mRNA, the pre-mRNA undergoes a process known as RNA splicing, or simply splicing, in which introns are removed and the remaining exons are connected to each other (see Figure above). In addition to splicing, eukaryotic pre-mRNA transcripts are modified in other ways, including the addition of caps and tails to their ends. After these modifications have been completed, the mRNA leaves the nucleus and enters the cytosol, where translation occurs. In this section, we will examine the molecular mechanisms that account for RNA modifications and consider why they are functionally important.

RNA modification involves the addition of a 5′ Cap and a 3′ Poly A tail to eukaryotic mRNAs
Mature mRNAs of eukaryotes have a modified form of guanine covalently attached at the 5′ end, an event known as capping (Figure a below).


Modifications that occur at the ends of mRNA in eukaryotic cells. 
(a) A guanosine cap is attached to the 5′ end. This is a guanine base modified by the attachment of a methyl group. The linkage between the cap and the mRNA is a 5′ to 5′ linkage.
(b) A poly A tail is added to the 3′ end.

Capping occurs while a pre-mRNA is being made by RNA polymerase, usually when the transcript is only 20 to 25 nucleotides in length. What are the functions of the cap?

- The 7-methylguanosine structure, called a 5′ cap, is recognized by cap-binding proteins, which are needed for the proper exit of mRNAs from the nucleus.
- After an mRNA is in the cytosol, the cap structure helps to prevent its degradation and is recognized by other cap-binding proteins that enable the mRNA to bind to a ribosome for translation.

At the 3′ end, most mature eukaryotic mRNAs have a string of adenine nucleotides, typically 100 to 200 nucleotides in length, referred to as a poly A tail (Figure 12.9b). The poly A tail is not encoded in the gene sequence. Instead, the tail is added enzymatically after a pre-mRNA has been completely transcribed.

- A long poly A tail aids in the export of mRNA from the nucleus.
- It also causes a eukaryotic mRNA to be more stable and thereby exist for a longer period of time in the cytosol.

Interestingly, new research has shown that some bacterial mRNAs also have poly A tails attached to them. However, the poly A tail has an opposite effect in bacteria, where it causes the mRNA to be rapidly degraded. The importance of a poly A tail in bacterial mRNAs is not well understood.

Splicing involves the removal of introns and the linkage of exons
Introns are found in many but not all eukaryotic genes. Splicing is less frequent among unicellular eukaryotic species, such as yeast, but is a widespread phenomenon among more complex eukaryotes. In animals and flowering plants, most structural genes have one or more introns. For example, an average human gene has about nine introns. The sizes of introns vary from a few dozen nucleotides to over 100,000! A few bacterial genes have been found to have introns, but they are rare among bacterial and archaeal species. Introns are precisely removed from eukaryotic pre-mRNA by a large complex called a spliceosome that is composed of several different snRNPs (pronounced “snurps”); each snRNP contains small nuclear RNA and a set of proteins. This small nuclear RNA is the product of a nonstructural gene. Intron RNA is defined by a particular sequence within the intron termed the branch site and by two intron-exon boundaries, called the 5′ splice site and the 3′ splice site (Figure below).


The splicing of a eukaryotic pre-mRNA by a spliceosome.

Particular snRNPs bind to specific sequences at these three locations. This binding causes the intron to loop outward, which brings the two exons close together. The 5′ splice site is then cut, and the 5′ end of the intron becomes covalently attached to the branch site. In the final step, the 3′ splice site is cut, and the two exons are covalently attached to each other. The intron is released and eventually degraded. In some cases, the function of the spliceosome is regulated so the splicing of exons for a given mRNA can occur in two or more ways. This phenomenon, called alternative splicing, allows a single gene to encode two or more polypeptides with differences in their amino acid sequences. Alternative splicing allows complex eukaryotic species to use the same gene to make different proteins at different stages of development or in different cell types. This increases the size of the proteome while minimizing the size of the genome. Although primarily found in mRNAs, introns occasionally occur in rRNA and tRNA molecules of certain species. These introns, however, are not removed by the action of a spliceosome. Instead, such rRNAs and tRNAs are self-splicing, which means the RNA itself can catalyze the removal of its own intron. Portions of the RNA act like an enzyme to cleave the covalent bonds at the intron-exon boundaries and connect the exons together. An RNA molecule that catalyzes a chemical reaction is termed a ribozyme.

Gene Regulation

Gene expression is the process by which the information within a gene is made into a functional product, such as an RNA molecule or a protein. Most genes in all species are regulated so the proteins they specify are produced at appropriate times and in specific amounts. The term gene regulation refers to the ability of cells to control the expression of their genes. By comparison, some genes have relatively constant levels of expression in all conditions over time. These are called constitutive genes. In most cases, constitutive genes encode proteins that are constantly required for the survival of an organism, such as certain metabolic enzymes. The importance of gene regulation is underscored by the number of genes devoted to this process in an organism. For example, in Arabidopsis thaliana, a plant that is studied by many plant geneticists, over 5% of the genome is involved with regulating gene transcription. This species has more than 1,500 different genes that encode proteins that regulate the transcription of other genes.

Overview of Gene Regulation
How do living organisms benefit from gene regulation? One reason is that it conserves energy. Proteins that are encoded by genes are produced only when needed. In multicellular organisms, gene regulation also ensures that genes are expressed in the appropriate cell types and at the correct stage of development. In this section, we will examine a few examples that illustrate the important consequences of gene regulation. We will also survey the major points in the gene expression process at which genes are regulated in bacterial and eukaryotic cells

Bacteria regulate genes in response to changes in their environment
The bacterium Escherichia coli can use many types of sugars as food sources, thereby increasing its chances of survival. With regard to gene regulation, we will focus on how it uses lactose, which is a sugar found in milk. The genome of E. coli carries genes that code for proteins that enable it to take up lactose from the environment and metabolize it. Figure below illustrates the effects of lactose on the regulation of those genes.


Gene regulation of lactose utilization in E. coli.

In order to utilize lactose, an E. coli cell requires a transporter, called lactose permease, that facilitates the uptake of lactose into the cell, and an enzyme, called β-galactosidase, that catalyzes the breakdown of lactose. When lactose is not present in the environment, an E. coli cell makes very little of these proteins. However, when lactose becomes available, the bacterium produces many more copies of these proteins, enabling it to readily use lactose from its environment. Eventually, all of the lactose in the environment is used up. At this point, the genes encoding these proteins will be shut off, and most of the proteins will be degraded. Overall, gene regulation conserves energy because it ensures that the proteins needed for lactose utilization are made only when lactose is present in the environment.

Eukaryotic gene regulation produces different cell types in a single organism
One of the most amazing examples of gene regulation is the phenomenon of cell differentiation, the process by which cells become specialized into particular types. In humans, for example, cells may differentiate into muscle cells, neurons, skin cells, or other types. Figure below shows micrographs of three types of cells found in humans.


Examples of different cell types in humans. 
These cells have the same genetic composition. Their unique morphologies are due to differences in the proteins they make.

As seen here, their morphologies are strikingly different. Likewise, their functions within the body are also quite different. Muscle cells are important in body movements, neurons function in cell signaling, and skin cells form a protective outer surface to the body. Gene regulation is responsible for producing different types of cells within a multicellular organism. The three cell types shown in Figure above contain the same genome, meaning they carry the same set of genes. However, their proteomes—the collection of proteins they make—are quite different. Certain proteins are found in particular cell types but not in others. Alternatively, a protein may be present in all three cell types, but the relative amounts of the protein may be different. The amount of a given protein depends on many factors, including how strongly the corresponding gene is turned on and how much protein is synthesized from mRNA. Gene regulation plays a major role in determining the proteome of each cell type.

Eukaryotic gene regulation enables multicellular organisms to proceed through developmental stages
In multicellular organisms that progress through developmental stages, certain genes are expressed at particular stages of development but not others. Let’s consider an example of such gene regulation in mammals. Early stages of development occur in the uterus of female mammals. Following fertilization, an embryo develops inside the uterus. In humans, the embryonic stage lasts from fertilization to 8 weeks. During this stage, major developmental changes produce the various body parts. The fetal stage occurs from 8 weeks to birth (41 weeks). This stage is characterized by a continued refinement of body parts and a large increase in size. The oxygen demands of a rapidly growing embryo and fetus are quite different from the needs of the mother. Gene regulation plays a vital role in ensuring that an embryo and fetus get the proper amount of oxygen. Hemoglobin is a protein that delivers oxygen to the cells of a mammal’s body. A hemoglobin protein is composed of four globin polypeptides, two encoded by one globin gene and two encoded by another globin gene (Figure below).


Regulation of human globin genes at different stages of development.

The genomes of mammals carry several genes (designated with Greek letters) that encode slightly different globin polypeptides. During the embryonic stage of development, the ε-globin and ζ-globin (epsilon-globin and zetaglobin) genes are turned on. At the fetal stage, these genes are turned off, and the α-globin and γ-globin (alpha-globin and gamma-globin) genes are turned on. Finally, at birth, the γ-globin gene is turned off, and the beta β-globin (beta-globin) gene is turned on. How do the embryo and fetus acquire oxygen from their mother’s bloodstream? The hemoglobin produced during the embryonic and fetal stages has a higher binding affinity for oxygen than does the hemoglobin produced after birth. Therefore, the embryo and fetus can remove oxygen from the mother’s bloodstream and use that oxygen for their own needs. This occurs across the placenta, where the mother’s bloodstream is adjacent to the bloodstream of the embryo or fetus. In this way, gene regulation enables mammals to develop internally, even though the embryo and fetus are not breathing on their own. Gene regulation ensures that the correct hemoglobin protein is produced at the right time in development.

Gene regulation occurs at different points in the process from DNA to protein
Gene regulation has a dramatic influence on the ability of organisms to respond to environmental changes, produce different types of cells, and progress through developmental stages. For genes that encode proteins, the regulation of gene expression can occur at any of the steps that are needed to produce a functional protein. In bacteria, gene regulation most commonly occurs at the level of transcription, which means that bacteria regulate how much mRNA is made from genes (Figure a below).


Overview of gene regulation in (a) bacteria and (b) eukaryotes. 
The relative width of the red arrows indicates the prominence with which gene regulation is used to control the production of functional proteins.

In eukaryotes, gene regulation occurs at many levels, including transcription, RNA modification, translation, and after translation is completed (Figure b above). As in their bacterial counterparts, transcriptional regulation is a prominent form of gene regulation for eukaryotes. Eukaryotic genes are transcriptionally regulated in several different ways, some of which are not found in bacteria. Regulation of RNA modification  and of the rate of translation of mRNAs is also common. As in bacteria, eukaryotic proteins can be regulated in a variety of ways other than gene regulation, including cellular regulation and biochemical regulation (such as feedback inhibition).

Regulation of transcription in bacteria
When a bacterium is exposed to a particular nutrient in its environment, such as a sugar, the genes are expressed that encode proteins needed for the uptake and metabolism of that sugar. In addition, bacteria have genes that encode enzymes that synthesize molecules such as particular amino acids. In such cases, the control of gene expression often occurs at the level of transcription. We will examine the underlying molecular mechanisms that bring about transcriptional regulation in bacteria.

Transcriptional regulation involves regulatory transcription factors and small effector molecules
In most cases, regulation of transcription involves the actions of regulatory transcription factors—proteins that bind to regulatory sequences in the DNA in the vicinity of a promoter and affect the rate of transcription of one or more nearby genes. These transcription factors either decrease or increase the rate of transcription of a gene. Repressors are regulatory transcription factors that bind to the DNA and decrease the rate of transcription. This is a form of regulation called negative control. Activators bind to the DNA and increase the rate of transcription, a form of regulation termed positive control (Figure a below).


Actions of regulatory transcription factors and small effector molecules. 
(a) Regulatory transcription factors are proteins that exert negative or positive control. 
(b) One way that a small effector molecule may exert its effects is by preventing a repressor protein from binding to the DNA.

In conjunction with regulatory transcription factors, molecules called small effector molecules often play a critical role in transcriptional regulation. A small effector molecule exerts its effects by binding to a regulatory transcription factor and causing a conformational change in the protein. In many cases, the effect of the conformational change determines whether or not the protein can bind to the DNA. Figure b above illustrates an example involving a repressor. When the small effector molecule is not present in the cytoplasm, the repressor binds to the DNA and inhibits transcription. However, when the small effector molecule is subsequently found in the cytoplasm, it will bind to the repressor and cause a conformational change that inhibits the ability of the protein to bind to the DNA. Transcription can occur because the repressor is not able to bind to the DNA. Repressors and activators that respond to small effector molecules have two functional regions called domains. One domain is a site where the protein binds to the DNA, whereas the other is the binding site for the small effector molecule.

The lac operon contains genes that encode proteins involved in lactose metabolism
In bacteria, structural genes are sometimes clustered together and under the transcriptional control of a single promoter. This arrangement is known as an operon. The transcription of the genes occurs as a single unit and results in the production of a polycistronic mRNA, an mRNA that encodes more than one protein. What advantage does this arrangement provide? An operon organization allows a bacterium to coordinately regulate a group of genes that encode proteins whose functions are used in a common pathway. The genome of E. coli carries an operon, called the lac operon, that contains the genes for the proteins that allow it to metabolize lactose . Figure a below shows the organization of this operon as it is found in the E. coli chromosome, as well as the polycistronic mRNA that is transcribed from it. The lac operon contains a promoter, lacP, that is used to transcribe three structural genes: lacZ, lacY, and lacA.


The lac operon. 
(a) This diagram depicts a region of the E. coli chromosome that contains the lacI gene and the adjacent lac operon, as well as the polycistronic mRNA transcribed from the operon. The mRNA is translated into three proteins: lactose permease, β-galactosidase, and galactoside transacetylase. 
(b) Lactose permease cotransports H+ with lactose. Bacteria maintain an H+ gradient across their cytoplasmic membrane that drives the active transport of lactose into the cytoplasm. β-Galactosidase cleaves lactose into galactose and glucose. As a side reaction, it can also convert lactose into allolactose.

- LacZ encodes β-galactosidase, which is an enzyme that breaks down lactose (Figure b above). As a side reaction, β-galactosidase also converts a small percentage of lactose into allolactose, a structurally similar sugar, or lactose analogue. As described later, allolactose is important in the regulation of the lac operon.
- The lacY gene encodes lactose permease, which is a membrane protein required for the transport of lactose into the cytoplasm of the bacterium.
- The lacA gene encodes galactoside transacetylase, which covalently modifies lactose and lactose analogs by attaching an acetyl group (—COCH3). The attachment of acetyl groups to nonmetabolizable lactose analogs prevents their toxic buildup in the cytoplasm.

Near the lac promoter are two regulatory sequences designated the operator and the CAP site (see Figure a above). The operator (lacO) is a regulatory sequence in the DNA. The sequence of bases at the operator provides a binding site for a repressor protein. The CAP site is a regulatory sequence recognized by an activator protein Adjacent to the lac operon is the lacI gene, which encodes the lac repressor. This repressor protein is important for the regulation of the lac operon. The lacI gene, which is constitutively expressed at a fairly low level, has its own promoter called the i promoter. The lacI gene is not considered a part of the lac operon. Let’s now take a look at how the lac operon is regulated by the lac repressor.

The lac operon is under negative control by a repressor protein
In the late 1950s, the first researchers to investigate gene regulation were French biologists François Jacob and Jacques Monod at the Pasteur Institute in Paris, France. Their focus on gene regulation stemmed from an interest in the phenomenon known as enzyme adaptation, which had been identified early in the 20th century. Enzyme adaptation occurs when a particular enzyme appears within a living cell only after the cell has been exposed to the substrate for that enzyme. Jacob and Monod studied lactose metabolism in E. coli to investigate this phenomenon. When they exposed bacteria to lactose, the levels of lactose using enzymes in the cells increased by 1,000- to 10,000-fold. After lactose was removed, the synthesis of the enzymes abruptly stopped. The first mechanism of regulation that Jacob and Monod discovered involved the lac repressor, which binds to the sequence of nucleotides found at the lac operator site. Once bound, the lac repressor prevents RNA polymerase from transcribing the lacZ, lacY, and lacA genes (Figure a below).



Negative control of an inducible set of genes: function of the lac repressor in regulating the lac operon.

Whether or not the lac repressor binds to the operator site depends on allolactose, the previously mentioned side product of the β-galactosidase enzyme (see Figure 13.6b). How does allolactose control the lac repressor? Allolactose is an example of a small effector molecule. The lac repressor protein contains four identical subunits, each one recognizing a single allolactose molecule. When four allolactose molecules bind to the lac repressor, a conformational change occurs that prevents the repressor from binding to the operator. Under these conditions, RNA polymerase is free to transcribe the operon (Figure b above).

The regulation of the lac operon enables E. coli to conserve energy because lactose-utilizing proteins are made only when lactose is present in the environment. Allolactose is an inducer, a small effector molecule that increases the rate of transcription, and the lac operon is said to be an inducible operon. When the bacterium is not exposed to lactose, no allolactose is available to bind to the lac repressor. Therefore, the lac repressor binds to the operator site and inhibits transcription. In reality, the repressor does not completely inhibit transcription, so very small amounts of β-galactosidase, lactose permease, and galactoside transacetylase are made. Even so, the levels are far too low for the bacterium to readily use lactose. When the bacterium is exposed to lactose, a small amount can be transported into the cytoplasm via lactose permease, and β-galactosidase converts some of it to allolactose. The cytoplasmic level of allolactose gradually rises until allolactose binds to the lac repressor, which induces the lac operon and promotes a high rate of transcription of the lacZ, lacY, and lacA genes. Translation of the encoded polypeptides produces the proteins needed for lactose uptake and metabolism.

The lac operon is also under positive control by an activator protein
In addition to negative control by a repressor protein, the lac operon is also positively regulated by an activator called the catabolite activator protein (CAP). CAP is controlled by a small effector molecule, cyclic AMP (cAMP), which is produced from ATP via an enzyme known as adenylyl cyclase. Gene regulation involving CAP and cAMP is an example of positive control (Figure below).


Positive control of the lac operon by the catabolite activator protein (CAP). 
When cAMP is bound to CAP, CAP binds to the DNA and causes it to bend. This bend facilitates the binding of RNA polymerase.

When cAMP binds to CAP, the cAMP-CAP complex binds to the CAP site near the lac promoter. This causes a bend in the DNA that enhances the ability of RNA polymerase to bind to the promoter. In this way, the rate of transcription is increased. The key functional role of CAP is to allow E. coli to choose between different sources of sugar. In a process known as catabolite repression, the presence of a preferred energy source inhibits the use of other energy sources. In this case, transcription of the lac operon is inhibited by the presence of glucose, which is a catabolite (it is broken down—catabolized—inside the cell). This gene regulation allows E. coli to preferentially use glucose instead of other sugars, such as lactose. How does this occur? Glucose inhibits the production of cAMP, thereby preventing the binding of CAP to the DNA. In this way, glucose blocks the activation of the lac operon by inhibiting transcription. Though it may seem puzzling, the term catabolite repression was coined before the action of the cAMP-CAP complex was understood at the molecular level. Historically, the primary observation of researchers was that glucose (a catabolite) inhibited (repressed) lactose metabolism. Further experimentation revealed that CAP is actually an activator protein. Figure below considers the four possible environmental conditions that an E. coli bacterium might experience with regard to these two sugars.



Effects of lactose and glucose on the expression of the lac operon.

- When both lactose and glucose levels are high (Figure 13.11a), the rate of transcription of the lac operon is low, because CAP does not activate transcription. Under these conditions, the bacterium primarily uses glucose rather than lactose. Why is this a benefit to the bacterium? The bacterium conserves energy by using one type of sugar at a time.
-If the lactose level is high and the glucose level is low (Figure b above), the transcription rate of the lac operon is very high because CAP is bound to the CAP site and the lac repressor is not bound to the operator site. Under these conditions, the bacterium metabolizes lactose.
- When the lactose level is low, the lac repressor prevents transcription of the lac operon, whether the glucose level is high or low (Figure c,d).

The trp operon is under negative control by a repressor protein
Let’s now consider an example of an operon that encodes enzymes involved in biosynthesis rather than breakdown. Our example is the trp operon of E. coli, which encodes enzymes that are required to make the amino acid tryptophan, a building block of proteins. More specifically, the trpE, trpD, trpC, trpB, and trpA genes encode enzymes that are involved in a pathway that leads to tryptophan synthesis. The trp operon is regulated by a repressor protein that is encoded by the trpR gene. The binding of the repressor to the trp operator site inhibits transcription. The ability of the trp repressor to bind to the trp operator is controlled by tryptophan, which is the product of the metabolic pathway controlled by the enzymes that are encoded by the operon.

- When the tryptophan level within the cell is very low, the trp repressor cannot bind to the operator site. Under these conditions, RNA polymerase readily transcribes the operon (Figure a below). In this way, the cell expresses the genes that encode enzymes that result in the synthesis of tryptophan, which is in short supply.


Negative control of a repressible set of genes: function of the trp repressor and corepressor (tryptophan) in regulating the trp operon.

- When the tryptophan level within the cell is high, tryptophan turns off the trp operon. Tryptophan acts as a small effector molecule, or corepressor, by binding to the trp repressor protein. This causes a conformational change in
the repressor that allows it to bind to the trp operator site, inhibiting the ability of RNA polymerase to transcribe the operon (Figure b above). Therefore, the bacterium does not waste energy making tryptophan when it is abundant.

When comparing the lac and trp operons, the actions of their small effector molecules are quite different. The lac repressor binds to its operator in the absence of its small effector molecule, whereas the trp repressor binds to its operator only in the presence of its small effector molecule. The lac operon is categorized as an inducible operon because allolactose, its small effector molecule, induces transcription. By comparison, the trp operon is considered to be a repressible operon because its small effector molecule, namely tryptophan, represses transcription.

Regulation of transcription in eukaryotes: roles of transcription factors and mediator
Regulation of transcription in eukaryotes follows some of the same principles as those found in bacteria. For example, activator and repressor proteins are involved in regulating genes by influencing the ability of RNA polymerase to initiate transcription. In addition, many eukaryotic genes are regulated by small effector molecules. However, some important differences also occur. In eukaryotic species, genes are almost always organized individually, not in operons. In addition, eukaryotic gene regulation tends to be more intricate, because eukaryotes are faced with complexities that differ from their bacterial counterparts. For example, eukaryotes have more complicated cell structures that contain many more proteins and a variety of cell organelles. Many eukaryotes, such as animals and plants, are multicellular and contain different cell types. As discussed earlier in this chapter, animal cells may differentiate into neurons, muscle cells, and skin cells, and so on. Furthermore, animals and plants progress through developmental stages that require changes in gene expression. By studying transcriptional regulation, researchers have discovered that most eukaryotic genes, particularly those found in multicellular species, are regulated by many factors. This phenomenon is called combinatorial control because the combination of many factors determines the expression of any given gene. At the level of transcription, common factors that contribute to combinatorial control include the following:

1. One or more activators may stimulate the ability of RNA polymerase to initiate transcription.
2. One or more repressors may inhibit the ability of RNA polymerase to initiate transcription.
3. The function of activators and repressors may be modulated in several ways, which include the binding of small effector molecules, protein-protein interactions, and covalent modifications.
4. Activators are necessary to alter chromatin structure in the region where a gene is located, thereby making it easier for the gene to be recognized and transcribed by RNA polymerase.
5. DNA methylation usually inhibits transcription, either by preventing the binding of an activator or by recruiting proteins that inhibit transcription.

All five of these factors may contribute to the regulation of a single gene, or possibly only three or four will play a role. In most cases, transcriptional regulation is aimed at controlling the initiation of transcription at the promoter. In this section and the following section, we will survey these basic types of gene regulation in eukaryotic species.

Eukaryotic structural genes have a core promoter and regulatory elements
To understand gene regulation in eukaryotes, we first need to consider the DNA sequences that are needed to initiate transcription. For eukaryotic structural genes that encode proteins, three features are common among most promoters: regulatory elements, a TATA box, and a transcriptional start site (Figure below).


A common organization of sequences for the promoter of a eukaryotic structural gene. 
The core promoter has a TATA box and a transcriptional start site. The TATA box sequence is 5′–TATAAA–3′. However, not all structural genes in eukaryotes have a TATA box. The A highlighted in dark blue is the transcriptional start site. This A marks the site of the first adenine in the RNA transcript. The sequence that flanks the A of the transcriptional start site is two pyrimidines, then C, then five pyrimidines. Py refers to pyrimidine— cytosine or thymine. Regulatory elements, such as enhancers and silencers, are usually found upstream from the core promoter.

Eukaryotic structural genes have a core promoter and regulatory elements
To understand gene regulation in eukaryotes, we first need to consider the DNA sequences that are needed to initiate transcription. For eukaryotic structural genes that encode proteins, three features are common among most promoters: regulatory elements, a TATA box, and a transcriptional start site (Figure above). The TATA box and transcriptional start site form the core promoter. The transcriptional start site is the place in the DNA where transcription actually begins. The TATA box, which is a 5′–TATAAA–3′ sequence, is usually about 25 bp upstream from a transcriptional start site. The TATA box is important in determining the precise starting point for transcription. If it is missing from the core promoter, transcription may start at a variety of different locations. The core promoter, by itself, results in a low level of transcription that is termed basal transcription. Regulatory elements (or regulatory sequences) are DNA segments that regulate eukaryotic genes. As described later, regulatory elements are recognized by regulatory transcription factors that control the ability of RNA polymerase to initiate transcription at the core promoter. Some regulatory elements, known as enhancers, play a role in the ability of RNA polymerase to begin transcription, thereby enhancing the rate of transcription. When enhancers are not functioning, most eukaryotic genes have very low levels of transcription. Other regulatory elements, known as silencers, prevent transcription of a given gene when its expression is not needed. When these sequences function, the rate of transcription is decreased. A common location for regulatory elements is the region that is 50–100 bp upstream from the transcriptional start site (see Figure above). However, the locations of regulatory elements vary greatly among different eukaryotic genes. Regulatory elements can be quite distant from the promoter, even 100,000 bp away, yet exert strong effects on the ability of RNA polymerase to initiate transcription at the core promoter! Regulatory elements were first discovered by Japanese molecular biologist Susumu Tonegawa and coworkers in the 1980s. While studying genes that play a role in immunity, they identified a region that was far away from the core promoter but was needed for high levels of transcription to take place.

RNA Polymerase II, General Transcription Factors, and Mediator are needed to transcribe eukaryotic structural genes
Three forms of RNA polymerases, designated I, II, and III, are found in eukaryotes. RNA polymerase II transcribes structural genes that encode proteins. By studying transcription in a variety of eukaryotic species, researchers have identified three types of proteins that play a role in initiating transcription at the core promoter of structural genes. These are RNA polymerase II, five different proteins called general transcription factors (GTFs), and a large protein complex called mediator. RNA polymerase II and GTFs must come together at the TATA
box of the core promoter so transcription can be initiated. A series of interactions occurs between these proteins so RNA polymerase II can bind to the DNA. The completed assembly of RNA polymerase II and GTFs at the TATA box is known as the preinitiation complex (Figure below).


The preinitiation complex. 
General transcription factors (GTFs) and RNA polymerase II assemble into the preinitiation complex at the core promoter in eukaryotic structural genes.

Another component needed for transcription in eukaryotes is the mediator protein complex. Mediator is composed of many proteins that bind to each other to form an elliptically shaped complex that partially wraps around RNA polymerase II and the GTFs. Mediator derives its name from the observation that it mediates interactions between the preinitiation complex and regulatory transcription factors such as activators or repressors that bind to enhancers or silencers. The function of mediator is to control the rate at which RNA polymerase can begin to transcribe RNA at the transcriptional start site.

Activators and Repressors may influence the function of GTFs or Mediator
In eukaryotes, regulatory transcription factors called activators and repressors bind to enhancers or silencers, respectively, and regulate the rate of transcription of genes. Activators and repressors commonly regulate the function of RNA polymerase II by binding to GTFs or mediator.

Affecting the Function of GTFs As shown in Figure below, some activators bind to an enhancer and then influence the function of GTFs. For example, an activator may improve the ability of a GTF called transcription factor II D (TFIID) to initiate transcription. The function of TFIID is to recognize the TATA box and begin the assembly process. An activator may recruit TFIID to the TATA box, thereby promoting the assembly of GTFs and RNA polymerase II into the preinitiation complex. In contrast, repressors may bind to a silencer and inhibit the function of TFIID. Certain repressors exert their effects by preventing the binding of TFIID to the TATA box or by inhibiting the ability of TFIID to assemble other GTFs and RNA polymerase II at the core promoter.


Effect of an activator via TFIID, a general transcription factor.

Affecting the Function of Mediator In addition to affecting GTFs, a second way that regulatory transcription factors control RNA polymerase II is via mediator (Figure below).


Effect of an activator via mediator.

In this example, an activator also interacts with a coactivator—a protein that increases the rate of transcription but does not directly bind to the DNA itself. The activator- coactivator complex stimulates the function of mediator, thereby causing RNA polymerase II to proceed to the elongation phase of transcription more quickly. Alternatively, repressors have the opposite effect to those seen in Figure 13.16. When a repressor inhibits mediator, RNA polymerase II cannot progress to the elongation stage.

A third way that regulatory transcription factors influence transcription is by recruiting proteins that affect chromatin structure in the promoter region, as described next.

Regulation of transcription in eukaryotes: changes in chromatin structure and DNA methylation
In eukaryotes, DNA is associated with proteins to form a structure called chromatin—the complex of DNA and proteins that makes up eukaryotic chromosomes. How does the structure of chromatin affect gene transcription? Recall from Chapter 11 that nucleosomes are composed of DNA wrapped around an octamer of histone proteins. Depending on the locations and arrangements of nucleosomes, a region containing a gene may be in a closed conformation, and transcription may be difficult or impossible. Transcription requires changes in chromatin structure that allow transcription factors to gain access to and bind to the DNA in the promoter region. Such chromatin, said to be in an open conformation, is accessible to GTFs and RNA polymerase II, so transcription can take place. In this section, we will examine how chromatin is converted from a closed to an open conformation. We will also explore how DNA methylation—the attachment of methyl groups to the base cytosine—affects chromatin conformation and gene expression.

Transcription is controlled by changes in chromatin structure
In recent years, geneticists have been trying to identify the steps that promote the interconversion between the closed and open conformations of chromatin. One way to change chromatin structure is through ATP-dependent chromatin-remodeling complexes, which are a group of proteins that alter chromatin structure. Such complexes use energy from ATP hydrolysis to drive a change in the locations and/or compositions of nucleosomes, thereby making the DNA more or less amenable to transcription. Therefore, chromatin remodeling is important for both the activation and repression of transcription. How do ATP-dependent chromatin-remodeling complexes change chromatin structure? Three effects are possible.

-One result is that these complexes may bind to chromatin and change the locations of nucleosomes (Figure a below). This may involve a shift of the relative positions of a few nucleosomes or a change in the relative spacing of nucleosomes over a long stretch of DNA.
-A second effect is that remodeling complexes may evict histone octamers from the DNA, thereby creating gaps where nucleosomes are not found (Figure b).
-A third possibility is that chromatin-remodeling complexes may change the composition of nucleosomes by removing standard histone proteins from an octamer and replacing them with histone variants (Figure c). A histone variant is a histone protein that has a slightly different amino acid sequence from the standard histone proteinsd. Some histone variants promote gene transcription, whereas others inhibit it.



ATP-dependent chromatin remodeling. 
Chromatinremodeling complexes may 
(a) change the locations of nucleosomes,
(b) remove histones from the DNA, or 
(c) replace standard histones with variant histones. 
The chromatin-remodeling complex, which is composed of a group of proteins, is not shown in this figure.

Histone modifications affect gene transcription
In recent years, researchers have learned that the amino terminal tails of histone proteins are subject to several types of covalent modifications. For example, an enzyme called histone acetyltransferase attaches acetyl groups (—COCH3) to the amino terminal tails of histone proteins. When acetylated, histone proteins do not bind as tightly to the DNA, which aids in transcription. Over 50 different enzymes have been identified in mammals that selectively modify amino terminal tails. Figure below shows an example in the amino terminal tails of histone proteins H2A, H2B, H3, and H4 that can be modified by acetyl, methyl, and phosphate groups.


Examples of covalent modifications that occur to the amino terminal tails of histone proteins. 
The amino acids are numbered from the N-terminus, or amino end. The modifications shown here are m for methylation, p for phosphorylation, and ac for acetylation. Many more modifications can occur to the amino terminal
tails. These modifications are reversible.

What are the effects of covalent modifications of histones? First, modifications may directly influence interactions between DNA and histone proteins, and between adjacent nucleosomes. As mentioned, the acetylation of histones loosens their binding to DNA and aids in transcription. Second, histone modifications provide binding sites that are recognized by other proteins. According to the histone code hypothesis, proposed by American biologists Brian Strahl and David Allis in 2000, the pattern of histone modification is recognized by proteins much like a language or code. One pattern of histone modification may attract proteins that inhibit transcription. Alternatively, a different combination of histone modifications may attract proteins, such as ATP-dependent chromatin-remodeling complexes, that promote gene transcription. In this way, the histone code plays a key role in accessing the information within the genomes of eukaryotic species.

Eukaryotic genes Are flanked by nucleosome-free regions
Studies over the last 10 years or so have revealed that many eukaryotic genes show a common pattern of nucleosome organization (Figure below).

Nucleosome arrangements in the vicinity of a eukaryotic structural gene.

For active genes or those genes that can be activated, the core promoter is found at a nucleosome-free region (NFR), which is a site that is missing nucleosomes. The NFR is typically 150 bp in length. Although the NFR may be required for transcription, it is not, by itself, sufficient for gene activation. At any given time in the life of a eukaryotic cell, many genes that contain an NFR are not being actively transcribed. The NFR is flanked by two nucleosomes that are termed the –1 and +1 nucleosomes. These nucleosomes often contain histone variants that promote transcription. The end of many eukaryotic genes is followed by another NFR. This arrangement at the end of genes may be important for transcriptional termination.

Transcriptional activation involves changes in nucleosome locations, composition, and histone modifications
A key role of certain activators is to recruit ATP-dependent chromatin- remodeling complexes and histone-modifying enzymes to the promoter region of eukaryotic genes. Though the order of recruitment may differ among specific activators, this appears to be critical for transcriptional initiation and elongation. In the scenario shown in Figure below, an activator binds to an enhancer in the NFR.



A simplified model for the transcriptional activation of a eukaryotic structural gene.

The activator then recruits chromatin-remodeling complexes and histonemodifying enzymes to this region. The chromatin-remodeling complex may shift nucleosomes or temporarily evict nucleosomes from the promoter region. Nucleosomes containing certain histone variants are thought to be more easily removed from the DNA than those containing the standard histones. Histone-modifying enzymes, such as histone acetyltransferase, covalently modify histone proteins and may affect nucleosome contact with the DNA. The actions of chromatinremodeling complexes and histone-modifying enzymes facilitate the binding of general transcription factors and RNA polymerase II to the core promoter, thereby allowing the formation of a preinitiation complex (see Figure above, step 2). Further changes in chromatin structure are necessary for elongation to occur. RNA polymerase II cannot transcribe DNA that is tightly wrapped in nucleosomes. For transcription to occur, histones  are evicted, partially displaced, or destabilized so RNA polymerase II can pass. Evicted histones are then reassembled by chaperone proteins and placed back on the DNA behind the moving RNA polymerase II (see Figure above). These histones may be deacetylated—have their acetyl groups removed—so they bind more tightly to the DNA.

DNA methylation inhibits gene transcription
Let’s now turn our attention to a mechanism that usually silences gene expression. DNA structure can be modified by the covalent attachment of methyl groups (—CH3) by an enzyme called DNA methyltransferase. This modification, termed DNA methylation, is common in some eukaryotic species but not all. For example, yeast and Drosophila have little or no detectable methylation of their DNA, whereas DNA methylation in vertebrates and plants is relatively abundant. In mammals, approximately 5% of the DNA is methylated. Eukaryotic DNA methylation occurs on the cytosine base. The sequence that is methylated is shown here:


The term epigenetics was first coined by British biologist Conrad Waddington in 1941. (The prefix epi- means “over.”) In the past few decades, researchers have used this term to describe certain types of variation in gene expression that are not based on variation in DNA sequences. How do geneticists distinguish epigenetic events from other types of gene regulation? In epigenetic gene regulation, an initial event causes a change in gene expression. For example, DNA methylation may inhibit transcription. For such a change to be an epigenetic phenomenon, it must be passed from cell to cell and must not involve a change in the DNA sequence. Therefore, a key feature of epigenetic gene regulation is the long-term maintenance of a change in gene expression. However, epigenetic changes are also reversible from one generation to the next. For example, a gene that is silenced in an individual may be active in that individual’s offspring. Although researchers are still debating the proper definition, one way to define epigenetic gene regulation is as follows:

Epigenetic gene regulation involves changes in gene expression that can be passed from cell to cell and are reversible, but does not involve a change in the base sequence of DNA.

Some epigenetic changes are passed from parent to offspring. In multicellular species that reproduce via gametes (sperm and egg cells), the passing of an epigenetic change from parent to offspring is called epigenetic inheritance. Genomic imprinting is an epigenetic change that is passed from parent to offspring. However, not all epigenetic changes fall into this category. For example, an individual may be exposed to an environmental agent that causes an epigenetic change in a lung cell that is subsequently transmitted from cell to cell and promotes lung cancer. Such a change would not be transmitted to the individual’s offspring. In this section, we will begin by examining the molecular changes that cause epigenetic gene regulation. We will then consider how such changes may be programmed into an organism’s development or caused by environmental agents.

Different types of molecular changes underlie epigenetic gene regulation
The molecular mechanisms that promote epigenetic gene regulation in eukaryotes are the subject of a great deal of recent research. The most common types of molecular changes that underlie epigenetic gene regulation are DNA methylation, chromatin remodeling, covalent histone modification, and the localization of histone variants (Table below).


these types of changes can also be involved in transient (nonepigenetic) gene regulation. In some cases, epigenetic changes stimulate the transcription of a given gene, and in other cases, they repress gene transcription.

Epigenetic gene regulation may occur as a programmed developmental change
Many epigenetic modifications that regulate gene expression are programmed changes that occur at specific stages of development ( Table above ).

-As discussed in Chapter 17, genomic imprinting of the I g f 2 gene occurs during gametogenesis—the maternal allele is silenced whereas the paternal allele is active.
-X-chromosome inactivation occurs during embryogenesis in female mammals. In early embryonic cells, one of the X chromosomes of a female is inactivated and forms a Barr body, whereas the other remains active. This pattern is maintained as the cells divide and persists in the adult organism.
-Similarly, the differentiation of specific cell types, such as muscle cells and neurons, involves epigenetic modifications. During embryonic development, certain genes undergo epigenetic changes that affect their expression throughout the rest of development. For example, in an embryonic cell that is destined to divide and become a group of muscle cells, a large number of genes that should not be expressed in muscle cells undergo epigenetic modifications that prevent their expression; such changes persist through adulthood.

Epigenetic gene regulation may be caused by environmental agents
An exciting discovery in the field of epigenetics is that a wide range of environmental agents have epigenetic effects. Many recent studies have suggested that environmentally induced changes in an organism’s characteristics are sometimes rooted in epigenetic changes that alter gene regulation. A striking example is found in honeybees (Apis mellifora). Female honeybees are of two types: queen bees and worker bees (Figure below).


Epigenetics and the environment. 
Female honeybees that are fed royal jelly throughout the entire larval stage and into adulthood develop into queen bees. The larger queen bee is marked with a blue disk labeled 68. By comparison, larvae that do not continue to receive this diet become smaller worker bees. These differences in development may be caused by epigenetic changes that affect gene regulation.

Queens are larger, live for years, and produce up to 2,000 eggs each day. By comparison, the smaller worker bees are sterile, typically live a few weeks, and engage in specialized tasks, which include cleaning and constructing comb cells, nurturing larvae, guarding the hive entrance, and foraging for pollen and nectar. The striking differences between queen and worker bees are largely caused by differences in their diet. Certain worker bees, called nurse bees, produce royal jelly in glands in their mouths. All female larvae are initially fed royal jelly, but those that are bathed in royal jelly throughout their entire larval development and feed on it into adulthood become queens. In contrast, female larvae that are switched at an early stage of development to a diet of pollen and nectar become worker bees. In 2008, a study  indicated that DNA methylation may play a role in controlling the developmental pathways that result in queen and worker bee morphologies. Bee larvae were fed a diet that should produce worker bees. These larvae were injected with a substance that inhibits DNA methyltransferase, the enzyme that methylates DNA. The result was that most of them became queen bees with fully developed ovaries! Although other factors may contribute to the development of queens, these results are consistent with the hypothesis that royal jelly may contain a substance that inhibits DNA methylation. Such inhibition is thought to allow the expression of genes that contribute to the development of the traits observed in queen bees. Another topic of great interest to many geneticists is how environmental toxins can cause epigenetic changes. In humans, exposure to tobacco smoke has been shown to alter DNA methylation and the covalent histone modifications of specific genes in lung cells. These alterations are associated with changes in gene regulation that may cause normal cells to become cancerous.

Regulation of RNA modification and translation in eukaryotes
Eukaryotic gene expression is  commonly regulated at the levels of RNA modification and translation. These added levels of regulation provide important benefits to eukaryotic species. First, by regulating RNA modification, eukaryotes can produce more than one mRNA transcript from a single gene. This allows a gene to encode two or more polypeptides, thereby increasing the complexity of eukaryotic proteomes. A second issue is timing. Regulation
of transcription in eukaryotes takes a fair amount of time before its effects are observed at the cellular level. During transcription

(1) the chromatin must be converted to an open conformation,
(2) the gene must be transcribed,
(3) the RNA must be modified and exported from the nucleus, and
(4) the protein must be made via translation.

All four steps take time, on the order of several minutes. One way to achieve faster regulation is to control steps that occur after an RNA transcript is made. In eukaryotes, regulation of translation provides a faster way to regulate the levels of gene products, namely, proteins. A small RNA molecule or RNA-binding protein can bind to an mRNA and affect the ability of the mRNA to be translated into a polypeptide.

Alternative splicing of pre-mRNAs increases protein diversity
In eukaryotes, a pre-mRNA transcript is modified before it becomes a mature mRNA. When a pre-mRNA has multiple introns and exons, splicing may occur in more than one way, resulting in the production of two or more different polypeptides. Such alternative splicing is a form of gene regulation that allows an organism to use the same gene to make different proteins at different stages of development, in different cell types, and/or in response to a change in the environmental conditions. Alternative splicing is an important form of gene regulation in complex eukaryotes such as animals and plants. An advantage of alternative splicing is that two or more different polypeptides can be derived from a single gene, thereby increasing the size of the proteome while minimizing the size of the genome. Let’s consider an example of alternative splicing for a pre-mRNA that encodes a protein known as α-tropomyosin, which functions in the regulation of cell contraction in animals. It is located along the thin filaments found in smooth muscle cells, such as those in the uterus and small intestine, and in striated muscle cells that are found in cardiac and skeletal muscle. α-Tropomyosin is also synthesized in many types of nonmuscle cells but in lower amounts. Within a multicellular organism, different types of cells must regulate their contractibility in subtly different ways. One way this may be accomplished is by the production of different forms of α-tropomyosin. Figure below shows the intron-exon structure of the rat α- tropomyosin pre-mRNA and two alternative ways that the premRNA can be spliced.


Alternative splicing of the rat α-tropomyosin pre-mRNA. 
The top part of this figure depicts the structure of the rat α-tropomyosin pre-mRNA. Exons are red or green, and introns are yellow. The lower part of the figure describes the final mRNA products in smooth and striated
muscle cells after alternative splicing. Note: Exon 8 is found in the final mRNA of smooth and striated muscle cells, but not in the mRNA of some other cell types.

The pre-mRNA contains 14 exons, 6 of which are constitutive exons (shown in red), which are always found in the mature mRNA from all cell types. Presumably, constitutive exons encode polypeptide segments of the α-tropomyosin protein that are necessary for its general structure and function. By comparison, alternative exons (shown in green) are not always found in the mRNA after splicing has occurred. The polypeptide sequences encoded by alternative exons may subtly change the function of α-tropomyosin to meet the needs of the cell type in which it is found. For example, Figure above shows the predominant splicing products found in smooth muscle cells and striated muscle cells. Exon 2 encodes a segment of the α-tropomyosin protein that alters its function to make it suitable for smooth muscle cells. By comparison, the α-tropomyosin mRNA found in striated muscle cells does not include exon 2. Instead, this mRNA contains exon 3, which is more suitable for that cell type.

RNA interference blocks the expression of mRNA
Let’s now turn our attention to regulatory mechanisms that affect translation. MicroRNAs (miRNAs) and short-interfering RNAs (siRNAs) are RNA molecules that are processed to a small size, typically 22 nucleotides in length, and silence the expression of pre-existing mRNAs. The precursors of miRNAs are encoded by genes and usually form a hairpin structure. In most cases, miRNAs are partially complementary to certain cellular mRNAs and inhibit their translation. By comparison, short-interfering RNAs are derived from two RNA molecules that come together to form a double-stranded region. For example, a cellular RNA may bind to an RNA that is transcribed from a viral genome. siRNAs are often a very close match to specific mRNAs and cause those mRNAs to be degraded. Insight into the mechanism of miRNA inhibition came from the research of American biologists Andrew Fire and Craig Mello, who
discovered the mechanism of action of miRNA (Figure below).


Mechanism of action of microRNA (miRNA). 
Note: Pre-siRNAs are also acted upon by dicer, but siRNAs are derived from two RNA molecules that form a double-stranded region rather than one RNA molecule that forms a hairpin.

A pre-miRNA is first synthesized as a single-stranded molecule that folds back on itself to form a hairpin structure. (A pre-siRNA would be composed of two RNA molecules that come together to form a double-stranded region.) The double-stranded region is trimmed to a 22-bp sequence by an enzyme called dicer. The 22-bp sequence becomes part of a complex called the RNA-induced silencing complex (RISC), which also includes several proteins. One of the RNA strands is then degraded. The miRNA or siRNA in the complex binds to a target mRNA with a complementary sequence. Upon binding, two different things may happen. When the miRNA and mRNA are not a perfect match or are only partially complementary, translation is inhibited. Alternatively, when an siRNA and mRNA are a perfect match or highly complementary, the mRNA is cut into pieces and then degraded. Both miRNA and siRNA have the same effect—the expression of the mRNA is silenced. Fire and Mello called this RNA interference (RNAi), because the miRNA interferes with the proper expression of an mRNA. Since this study, researchers have discovered that genes encoding miRNAs are widely found in animals and plants. In humans, for example, researchers estimate that over 1,000 different genes encode miRNAs. RNAi represents an important mechanism of gene regulation that results in mRNA silencing. In 2006, Fire and Mello were awarded the Nobel Prize in Physiology or Medicine for their studies of RNAi.

The prevention of iron toxicity in mammals involves the regulation of translation
Another way to regulate translation involves RNA-binding proteins that directly affect the initiation of translation. The regulation of iron absorption provides a well-studied example. Although iron is a vital cofactor for many cellular enzymes, it is toxic at high levels. To prevent toxicity, mammalian cells synthesize a protein called ferritin, which forms a hollow, spherical complex that stores excess iron. The mRNA that encodes ferritin is controlled by an RNA-binding protein known as the iron regulatory protein (IRP). When the iron level in the cytosol is low and more ferritin is not needed, IRP binds to a regulatory element within the ferritin mRNA known as the iron regulatory element (IRE). The IRE is located between the 5′ cap, where the ribosome binds, and the start codon where translation begins. Due to base pairing, it forms a stem-loop structure. The binding of IRP to the IRE inhibits translation of the ferritin mRNA (Figure a below).


Translational regulation of ferritin mRNA by the iron regulatory protein (IRP).

However, when iron is abundant in the cytosol, the iron binds directly to IRP, which changes its conformation and prevents it from binding to the IRE. Under these conditions, the ferritin mRNA is translated to make more ferritin protein (Figure b above). Why is translational regulation of ferritin mRNA an advantage over transcriptional regulation of the ferritin gene? This mechanism of translational control allows cells to rapidly respond to changes in their environment. When cells are confronted with high levels of iron, they can quickly make more ferritin protein to prevent the toxic buildup of iron. This mechanism is faster than transcriptional regulation, which would require the activation of the ferritin gene and the transcription of ferritin mRNA prior to the synthesis of more ferritin protein.

The Eukaryotic Cell Cycle, Mitosis, and Meiosis

Over 10,000,000,000,000! Researchers estimate that the adult human body contains somewhere between 10 trillion and 50 trillion cells. It is an incomprehensible number. Even more amazing is the accuracy of the process that produces these cells. After a human sperm and egg unite, the fertilized egg goes through a long series of cell divisions to produce an adult with over 10 trillion cells. Let’s suppose you randomly removed a cell from your arm and compared it with a cell from your foot. If you examined the chromosomes found in both cells under the microscope, they would look identical. Likewise, the DNA sequences along those chromosomes would also be the same, barring rare mutations. Similar comparisons could be made among the trillions of cells in your body. When you consider how many cell divisions are needed to produce an adult human, the precision of cell division is truly remarkable. What accounts for this high level of accuracy? As we will examine in this chapter, cell division, the reproduction of cells, is a highly regulated process that distributes and monitors the integrity of the genetic material. The eukaryotic cell cycle is a series of phases needed for cell division. The cells of eukaryotic species follow one of two different sorting processes so that new daughter cells receive the correct number and types of chromosomes. The first sorting process we will explore, called mitosis, ensures that two daughter cells receive the same amount of genetic material as the mother cell that produced them. We will then examine another sorting process, called meiosis, which is needed for sexual reproduction. In meiosis, cells that have two sets of chromosomes produce daughter cells with a single set of chromosomes. Lastly, we will explore variation in the structure and number of chromosomes. As you will see, certain mechanisms that alter chromosome structure and number have important consequences for the organisms that carry them.

The Eukaryotic Cell Cycle
Life is a continuum in which new living cells are formed by the division of pre-existing cells. The Latin axiom Omnis cellula e cellula, meaning “Every cell originates from another cell,” was first proposed in 1858 by Rudolf Virchow, a German biologist. From an evolutionary perspective, cell division has a very ancient origin. All living organisms, from unicellular bacteria to multicellular plants and animals, have been produced by a series of repeated rounds of cell growth and division. A cell cycle is a series of events that leads to cell division. In all species, it is a highly regulated process so cell division occurs at the appropriate time. Bacterial cells produce more cells via binary fission. The cell cycle in eukaryotes is more complex, in part, because eukaryotic cells have sets of chromosomes that need to be sorted properly. In this section, we will examine the phases of the eukaryotic cell cycle and see how the cell cycle is controlled by proteins that carefully monitor the division process to ensure its accuracy. But first, we need to consider some general features of chromosomes in eukaryotic species.

Chromosomes are inherited in sets and occur in homologous pairs
To understand the chromosomal composition of cells and the behavior of chromosomes during cell division, scientists observe cells and chromosomes with the use of microscopes. Cytogenetics is the field of genetics that involves the microscopic examination of chromosomes. When a cell prepares to divide, the chromosomes become more tightly compacted, a process that decreases their apparent length and increases their diameter. A consequence of this compaction is that distinctive shapes and numbers of chromosomes become visible under a light microscope.

The cell cycle is a series of phases that lead to cell division
Eukaryotic cells that are destined to divide progress through the cell cycle, a series of changes that involves growth, replication, and division, and ultimately produces new cells. Figure below provides an overview of the cell cycle.


The eukaryotic cell cycle. 
Dividing cells progress through a series of phases denoted G1, S, G2, and M. This diagram shows the progression of a cell through the cell cycle to produce two daughter cells. The original diploid cell had three pairs of chromosomes, for a total of six individual chromosomes. During S phase, these have replicated to yield 12 chromatids. After mitosis is complete, two daughter cells each contain six individual chromosomes. The width of the phases shown in this figure is not meant to reflect their actual length. G1 is typically the longest phase of the cell cycle, whereas M phase is relatively short.

In this diagram, the mother cell has three pairs of chromosomes, for a total of six individual chromosomes. Such a cell is diploid (2n) and contains three chromosomes per set (n = 3). The paternal set is shown in blue, and the homologous maternal set is shown in red. The phases of the cell cycle are G1 (first gap), S (synthesis of DNA, the genetic material), G2 (second gap), and M phase (mitosis and cytokinesis). The G1 and G2 phases were originally described as gap phases to indicate the periods between DNA synthesis and mitosis. In actively dividing cells, the G1, S, and G2 phases are collectively known as interphase. During interphase, the cell grows and copies its
chromosomes in preparation for cell division. Alternatively, cells may exit the cell cycle and remain for long periods of time in a phase called G0 (G zero). The G0 phase is an alternative to proceeding through G1. A cell in the G0 phase has postponed making a decision to divide or, in the case of terminally differentiated cells (such as muscle cells in an adult animal), will never divide again. G0 is a nondividing phase. 

G1 Phase 
The G1 phase is a period in a cell’s life when it may become committed to divide. Depending on the environmental conditions and the presence of signaling molecules, a cell in the G1 phase may accumulate molecular changes that cause it to progress through the rest of the cell cycle. Cell growth typically occurs during the G1 phase. 

S Phase 
During the S phase, each chromosome is replicated to form a pair of sister chromatids (see Figure 15.1). When S phase is completed, a cell has twice as many chromatids as the number of chromosomes in the G1 phase. For example, a human cell in the G1 phase has 46 distinct chromosomes, whereas the same cell in G2 would have 46 pairs of sister chromatids, for a total of 92 chromatids.

G2 Phase 
During the G2 phase, a cell synthesizes the proteins necessary for chromosome sorting and cell division. Some cell growth may occur.

M Phase 
The first part of M phase is mitosis. The purpose of mitosis is to divide one cell nucleus into two nuclei, distributing the duplicated chromosomes so each daughter cell receives the same complement of chromosomes. As noted previously, a human cell in the G2 phase has 92 chromatids, which are found in 46 pairs. During mitosis, these pairs of chromatids are separated and sorted so each daughter cell receives 46 chromosomes. In most cases, mitosis is followed by cytokinesis, which is the division of the cytoplasm to produce two distinct daughter cells. The length of the cell cycle varies considerably among different cell types, ranging from several minutes in quickly growing embryos to several months in slow-growing adult cells. For fast-dividing mammalian cells in adults, such as skin cells, the length of the cycle is often in the range of 10 to 24 hours. The various phases within the cell cycle also vary in length. G1 is often the longest and also the most variable phase, and M phase is the shortest. For a cell that divides in 24 hours, the following lengths of time for each phase are typical:

-G1 phase: 11 hours
-S phase: 8 hours
-G2 phase: 4 hours
-M phase: 1 hour

What factors determine whether or not a cell will divide? First, cell division is controlled by external factors, such as environmental conditions and signaling molecules.. Second, internal factors affect cell division. These include cell cycle control molecules and checkpoints.

The cell cycle is controlled by checkpoint proteins
The progression through the cell cycle is a process that is highly regulated to ensure that the genome remains intact and that the conditions are appropriate for a cell to divide. This is necessary to minimize the occurrence of mutations, which could have harmful effects and potentially lead to cancer. Proteins called cyclins and cyclin-dependent kinases (cdks) are responsible for advancing a cell through the phases of the cell cycle. Cyclins are so
named because their amount varies throughout the cell cycle. To be active, the kinases controlling the cell cycle must bind to (are dependent on) cyclins. The number of different types of cyclins and cdks varies from species to species. Figure belowgives a simplified description of how cyclins and cdks work together to advance a cell through G1 and mitosis


Checkpoints in the cell cycle. 
This is a general diagram of the eukaryotic cell cycle. Progression through the cell cycle requires the formation of activated cyclin/cdk complexes. Cells make different types of cyclin proteins, which are typically degraded after the cell has progressed to the next phase. The formation of activated cyclin/cdk complexes is regulated by checkpoint proteins.

During G1, the amount of a particular cyclin termed G1 cyclin increases in response to sufficient nutrients and growth factors. The G1 cyclin binds to a cdk to form an activated G1 cyclin/cdk complex. Once activated, cdk functions as a protein kinase that phosphorylates other proteins needed to advance the cell to the next phase in the cell cycle. For example, certain proteins involved with DNA synthesis are phosphorylated and activated, thereby allowing the cell to replicate its DNA in S phase. After the cell passes into the S phase, G1 cyclin is degraded. Similar events advance the cell through other phases of the cell cycle. A different cyclin, called mitotic cyclin, accumulates late in G2. It binds to a cdk to form an activated mitotic cyclin/cdk complex. This complex phosphorylates proteins that are needed to advance the cell into M phase. Three critical regulatory points called checkpoints are found in the cell cycle of eukaryotic cells. At these checkpoints, a variety of proteins, referred to as checkpoint proteins, act as sensors to determine if a cell is in the proper condition to divide. The G1 checkpoint, also called the restriction point, determines if conditions are favorable for cell division. In addition, G1-checkpoint proteins sense if the DNA has incurred damage. What happens if DNA damage is detected? The checkpoint proteins prevent the formation of active cyclin/cdk complexes, thereby stopping the progression of the cell cycle. A second checkpoint exists in G2. This checkpoint also checks the DNA for damage and ensures that all of the DNA has been replicated. In addition, the G2 checkpoint monitors the levels of proteins that are needed to progress through M phase. A third checkpoint, called the metaphase checkpoint, senses the integrity of the spindle apparatus. As we will see later, the spindle apparatus is involved in chromosome sorting. Metaphase is a step in mitosis during which all of the chromosomes should be attached to the spindle apparatus. If a chromosome is not correctly attached, the metaphase checkpoint will stop the cell cycle. This checkpoint prevents cells from incorrectly sorting their chromosomes during division. Checkpoint proteins delay the cell cycle until problems are fixed or prevent cell division when problems cannot be fixed. A primary aim of checkpoint proteins is to prevent the division of a cell that has incurred DNA damage or harbors abnormalities in chromosome number. As discussed in Chapter 14, when the functions of checkpoint genes are lost due to mutation, the likelihood increases that undesirable genetic changes will occur that can cause additional mutations and cancerous growth.

Mitotic cell division
We now turn our attention to a mechanism of cell division and its relationship to chromosome replication and sorting. During the process of mitotic cell division, a cell divides to produce two new cells (the daughter cells) that are genetically identical to the original cell (the mother cell). Mitotic cell division involves mitosis—the division of one nucleus into two nuclei—and then cytokinesis in which the mother cell divides into two daughter cells. Why is mitotic cell division important? One purpose is asexual reproduction, a process in which genetically identical offspring are produced from a single parent. Certain unicellular eukaryotic organisms, such as baker’s yeast (Saccharomyces cerevisiae) and the amoeba, increase their numbers in this manner. A second important reason for mitotic cell division is the production and maintenance of multicellularity. Organisms such as plants, animals, and most fungi are derived from a single cell that subsequently undergoes repeated cellular divisions to become a multicellular organism. The process of mitotic cell division requires the replication, organization, and sorting of chromosomes. A single cell is separated into two daughter cells by cytokinesis.

In preparation for cell division, eukaryotic chromosomes are replicated and compacted to produce pairs called sister chromatids
We now turn our attention to how chromosomes are replicated and sorted during cell division. Figure below describes the process at the chromosomal level.


Replication and compaction of chromosomes into pairs of sister chromatids. 
(a) Chromosomal replication produces a pair of sister chromatids. While the chromosomes are elongated, they are replicated to produce two copies that are connected and lie parallel to each
other. This is a pair of sister chromatids. Later, when the cell is preparing to divide, the sister chromatids condense into more compact structures
that are easily seen with a light microscope. 
(b) A schematic drawing of a metaphase chromosome. This structure has two chromatids that lie sideby- side. The two chromatids are held together by cohesin proteins (not shown in this drawing). The kinetochore is a group of proteins that are attached to the centromere and play a role during chromosome sorting.

Prior to DNA replication, the DNA of each eukaryotic chromosome consists of a linear double helix that is found in the nucleus and is not highly compacted. When the DNA is replicated, two identical copies of the original double helix are produced. These copies, along with associated proteins, lie side-by-side and are termed sister chromatids. When a cell prepares to divide, the sister chromatids become highly compacted and readily visible under the microscope. The two sister chromatids are tightly associated at a region called the centromere. A protein called cohesin holds the sister chromatids together. In addition, the centromere serves as an attachment site for a group of proteins that form the kinetochore, a structure necessary for sorting each chromosome.

The mitotic spindle organizes and sorts chromosomes during cell division
What structure is responsible for organizing and sorting the chromosomes during cell division? The answer is the mitotic spindle (Figure below).



The structure of the mitotic spindle. 
The mitotic spindle in animal cells is formed by the centrosomes, which produce three types of microtubules. The astral microtubules emanate away from the region between the poles. The polar microtubules project
into the region between the two poles. The kinetochore microtubules are attached to the kinetochores of sister chromatids. Note: For simplicity, this diagram shows only one pair of homologous chromosomes. Eukaryotic species typically have multiple chromosomes per set.

It is composed of microtubules—protein fibers that are components of the cytoskeleton. In animal cells, microtubule growth and organization start at two centrosomes, regions that are also referred to as microtubule organizing centers (MTOCs). A single centrosome duplicates during interphase. When the cell enters mitosis, each centrosome defines a pole of the spindle apparatus, one within each of the future daughter cells. The centrosome in animal cells has a pair of centrioles. Each one is composed of nine sets of triplet microtubules. However, centrioles are not found in many other eukaryotic species, such as plants, and are not required for spindle formation. Each centrosome organizes the construction of the microtubules by rapidly polymerizing tubulin proteins. The three types of spindle microtubules are termed astral, polar, and kinetochore microtubules (see Figure above).

The transmission of chromosomes requires a sorting process known as mitosis
Mitosis is the sorting process for dividing one cell nucleus into two nuclei (Figure below).



The process of mitosis in an animal cell. 
The top panels are fluorescent micrographs of a newt cell progressing through mitosis. The drawings below emphasize the sorting of the chromosomes, in which the diploid mother cell had six chromosomes (three in each set). At the start of mitosis, these have already replicated into 12 chromatids. The final result is two daughter cells, each containing six chromosomes

The duplicated chromosomes are distributed so each daughter cell receives the same complement of chromosomes. Mitosis was first observed microscopically in the 1870s by a German biologist, Walther Flemming, who coined the term (from the Greek mitos, meaning thread). He studied the large, transparent skin cells of salamander larvae as they were dividing and noticed that chromosomes are constructed of “threads” that are doubled in appearance along their length. These double threads divided and moved apart, one going to each of the two daughter nuclei. By this mechanism, Flemming pointed out, the two daughter cells receive an identical group of threads, the same as the number of threads in the mother cell. Figure above depicts the process of mitosis in an animal cell, though the process is quite similar in a plant cell. Mitosis occurs as a continuum of phases known as prophase, prometaphase, metaphase, anaphase, and telophase. In the simplified diagrams shown along the bottom of Figure above, the original cell contains six chromosomes. One set of chromosomes is depicted in red, whereas the homologous set is blue. These different colors represent maternal and paternal chromosomes.

Interphase 
Prior to mitosis, the cells are in interphase, which consists of the G1, S, and G2 phases of the cell cycle. The chromosomes have replicated in S phase and are decondensed and found in the nucleus (Figure a above). The nucleolus, which is the site where the components of ribosomes assemble into ribosomal subunits, is visible during interphase.

Prophase 
At the start of mitosis, in prophase, the chromosomes have already replicated to produce 12 chromatids, joined as six pairs of sister chromatids that have condensed into highly compacted structures readily visible by light microscopy (Figure b above). As prophase proceeds, the nuclear envelope begins to dissociate into small vesicles. The nucleolus is no longer visible.

Prometaphase 
During prometaphase, the nuclear envelope completely fragments into small vesicles, and the mitotic spindle is fully formed (Figure c). As prometaphase progresses, the centrosomes move apart and demarcate the two poles. Once the nuclear envelope has dissociated, the spindle fibers can interact with the sister chromatids. How do the sister chromatids become attached to the spindle apparatus? Initially, microtubules are rapidly formed and can be seen under a microscope growing out from the two poles. As it grows, if a microtubule happens to make contact with a kinetochore, it is said to be captured and remains firmly attached to the kinetochore. Alternatively, if a microtubule does not collide with a kinetochore, the microtubule eventually depolymerizes and retracts to the centrosome. This random process is how sister chromatids become attached to kinetochore microtubules. As the end of prometaphase nears, the two kinetochores on each pair of sister chromatids are attached to kinetochore microtubules from opposite poles. As these events are occurring, the sister chromatids are seen under the microscope to undergo jerky movements as they are tugged, back and forth, between the two poles by the kinetochore microtubules.

Metaphase 
Eventually, the pairs of sister chromatids are aligned in a single row along the metaphase plate, a plane halfway between the poles. When this alignment is complete, the cell is in metaphase of mitosis (Figure d). The chromatids can then be equally distributed into two daughter cells.

Anaphase 
During anaphase, the connections between the pairs of sister chromatids are broken (Figure 15.8e). Each chromatid, now an individual chromosome, is linked to only one of the two poles by one or more kinetochore microtubules. As anaphase proceeds, the kinetochore microtubules shorten, pulling the chromosomes toward the pole to which they are attached. In addition, the two poles move farther away from each other. This occurs because the overlapping polar microtubules lengthen and push against each other, thereby pushing the poles farther apart.

Telophase 
During telophase, the chromosomes have reached their respective poles and decondense. The nuclear envelope now re-forms to produce two separate nuclei. In Figure f, two nuclei are being produced that contain six chromosomes each.

Cytokinesis 
In most cases, mitosis is quickly followed by cytokinesis, in which the two nuclei are segregated into separate daughter cells. Whereas the phases of mitosis are similar between plant and animal cells, the process of cytokinesis is quite different.

-In animal cells, cytokinesis involves the formation of a cleavage furrow, which constricts like a drawstring to separate the cells (Figure a below).
-In plants, vesicles from the Golgi apparatus move along microtubules to the center of the cell and coalesce to form a cell plate (Figure b), which then forms a cell wall between the two daughter cells.


Micrographs showing cytokinesis in animal and plant cells.

What are the results of mitosis and cytokinesis? These processes ultimately produce two daughter cells with the same number of chromosomes as the mother cell. Barring rare mutations, the two daughter cells are genetically identical to each other and to the mother cell from which they were derived. The critical consequence of this sorting process is ensuring genetic consistency from one cell to the next. The development of multicellularity relies on the repeated process of mitosis and cytokinesis.

Meiosis and sexual reproduction
In sexual reproduction,  two haploid gametes unite to form a diploid cell called a zygote. For multicellular species such as animals and plants, the zygote then grows and divides by mitotic cell divisions into a multicellular organism with many diploid cells. As discussed earlier, a diploid cell contains two homologous sets of chromosomes, whereas a haploid cell contains a single set. For example, a diploid human cell contains 46 chromosomes, but a human gamete—sperm or egg cell—is a haploid cell that contains only 23 chromosomes. Meiosis is the process by which haploid cells are produced from a cell that was originally diploid. The term meiosis, which means to make smaller, refers to the fewer chromosomes found in cells following this process. For this to occur, the chromosomes must be correctly sorted and distributed in a way that reduces the chromosome number to half its original diploid value. In the case of human gametes, for example, each gamete must receive one chromosome from each of the 23 pairs. For this to happen, two rounds of divisions are necessary, termed meiosis I and meiosis II (Figure below).


How the process of meiosis reduces chromosome number. 
This simplified diagram emphasizes the reduction in chromosome number as a diploid cell divides by meiosis to produce four haploid cells.

When a cell begins meiosis, it contains chromosomes that are found in homologous pairs. When meiosis is completed, a single diploid cell with homologous pairs of chromosomes has produced four haploid cells. The cellular events of meiosis  reduce the chromosome number from diploid to haploid. This process plays a role in the life cycles of animals, plants, fungi, and protists.

Bivalent formation and crossing over occur at the beginning of meiosis
Like mitosis, meiosis begins after a cell has progressed through the G1, S, and G2 phases of the cell cycle. However, two key events occur at the beginning of meiosis that do not occur in mitosis. First, homologous pairs of sister chromatids associate with each other, lying side by side to form a bivalent, also called a tetrad (Figure below).


Formation of a bivalent and crossing over during meiosis I. 
At the beginning of meiosis, homologous chromosomes pair with each other to form a bivalent, usually with a synaptonemal complex between them. Crossing over then occurs between homologous chromatids
within the bivalent. During this process, homologs exchange segments of chromosomes.

The process of forming a bivalent is termed synapsis. In most eukaryotic species, a protein structure called the synaptonemal complex connects homologous chromosomes during a portion of meiosis. However, the synaptonemal complex is not required for the pairing of homologous chromosomes because some species of fungi completely lack such a complex, yet their chromosomes associate with each other correctly. At present, the precise role of the synaptonemal complex is not clearly understood. The second event that occurs at the beginning of meiosis, but not usually during mitosis, is crossing over, which involves a physical exchange between chromosome segments of the bivalent. Crossing over increases the genetic variation of sexually reproducing species. After crossing over occurs, the arms of the chromosomes tend to separate but remain adhered at a crossover site. This connection is called a chiasma (plural, chiasmata), because the connected chromosomal arms resemble the Greek letter chi, χ. The number of crossovers is carefully controlled by cells and depends on the size of the chromosome and the species. The range of crossovers for eukaryotic chromosomes is typically one or two to a couple dozen. During the formation of sperm in humans, for example, an average chromosome undergoes slightly more than two crossovers, whereas chromosomes in certain plant species may undergo 20 or more.

Meiosis I separates homologous chromosomes
Now that we have an understanding of bivalent formation and crossing over, we are ready to consider the phases of meiosis (Figure below).





The phases of meiosis in an animal cell.

These simplified diagrams depict a diploid cell (2n) that contains a total of six chromosomes. Prior to meiosis, the chromosomes are replicated in S phase to produce pairs of sister chromatids. This single replication event is then followed by sequential divisions called meiosis I and II. Like mitosis, each of these is a continuous series of stages called prophase,
prometaphase, metaphase, anaphase, and telophase. The sorting that occurs during meiosis I separates homologous chromosomes from each other (Figure a–e above).

Prophase I
During prophase I, the replicated chromosomes condense, the homologous chromosomes form bivalents, and crossing over occurs. The nuclear envelope then starts to fragment into small vesicles.


Prometaphase I
In prometaphase I, the nuclear envelope is completely broken apart into vesicles, and the spindle apparatus is entirely formed. The sister chromatids become attached to kinetochore microtubules. However, a key difference exists between mitosis and meiosis I. In mitosis, each pair of sister chromatids is attached to both poles. In meiosis I, each pair of sister chromatids is attached to just one pole via kinetochore microtubules (Figure b above).

Metaphase I 
At metaphase I, the bivalents are organized along the metaphase plate. Notice how this pattern of alignment is strikingly different from that observed during mitosis. In particular, the sister chromatids are aligned in a double row rather than a single row (as in mitosis). Furthermore, the arrangement of sister chromatids within this double row is random with regard to the (red and blue) homologs. (Remember that these different colors represent maternal and paternal chromosomes.) In Figure c, above, one of the red homologs is to the left of the metaphase plate, and the other two are to the right, whereas two of the blue homologs are to the left of the metaphase plate and the other one is to the right. In other cells, homologs could be arranged differently along the metaphase plate (for example, three blues to the left and none to the right, or none to the left and three to the right). Because eukaryotic species typically have many chromosomes per set, maternal and paternal homologs can be randomly aligned along the metaphase plate in a variety of ways. The possible number of different, random alignments equals 2n, where n equals the number of chromosomes per set. The reason why the random alignments equals 2n is because each chromosome is found in a homologous pair and each member of the pair can align on either side of the metaphase plate. It is a matter of chance which daughter cell of meiosis I will get the maternal chromosome of a homologous pair, and which will get the paternal chromosome. In humans, who have 23 chromosomes per set, 2n equals 223, or over 8 million possibilities. Because the homologs are genetically similar but not identical, we see from this calculation that the random alignment of homologous chromosomes provides a mechanism to promote a vast amount of genetic diversity among the resulting haploid cells. When meiosis is complete, any two human gametes are extremely unlikely to have the same combination of homologous chromosomes. 

Anaphase I 
The segregation of homologs occurs during anaphase I (Figure d above). The connections between bivalents break, but not the connections that hold sister chromatids together. Each joined pair of chromatids migrates to one pole, and the homologous pair of chromatids moves to the opposite pole, both pulled by kinetochore microtubules.

Telophase I 
At telophase I, the sister chromatids have reached their respective poles and then decondense. The nuclear envelope now reforms to produce two separate nuclei.  If we consider the end result of meiosis I, we see that two nuclei are produced, each with three pairs of sister chromatids; this is called a reduction division. The original diploid cell had its chromosomes in homologous pairs, whereas the two cells produced as a result of meiosis I and cytokinesis are considered haploid—they do not have pairs of homologous chromosomes.

Meiosis II separates sister chromatids
Meiosis I is followed by cytokinesis and then meiosis II (see Figure f–j above). DNA replication does not occur between meiosis I and meiosis II. The sorting events of meiosis II are similar to those of mitosis, but the starting point is different. For a diploid cell with six chromosomes, mitosis begins with 12 chromatids that are joined as six pairs of sister chromatids. By comparison, the two cells that begin meiosis II each have six chromatids that are joined as three pairs of sister chromatids. Otherwise, the steps that occur during prophase, prometaphase, metaphase, anaphase, and telophase of meiosis II are analogous to a mitotic division. Sister chromatids are separated during anaphase II.

Mitosis and meiosis differ in a few key steps
How are the outcomes of mitosis and meiosis different? Mitosis produces two diploid daughter cells that are genetically identical. The starting cell had six chromosomes (three homologous pairs of chromosomes), and both daughter
cells received copies of the same six chromosomes. By comparison, meiosis reduces the number of sets of chromosomes. The daughter cells do not contain a random mix of three chromosomes. Each haploid daughter cell contains one complete set of chromosomes, whereas the original diploid mother cell had two complete sets. How do we explain the different outcomes of mitosis and meiosis? Table below emphasizes the differences between certain key steps in mitosis and meiosis that account for the different outcomes of these two processes.



DNA replication occurs prior to mitosis and meiosis I, but not between meiosis I and II. During prophase of meiosis I, the homologs synapse to form bivalents. This explains why crossing over occurs commonly during meiosis, but rarely during mitosis. During prometaphase of mitosis and meiosis II, pairs of sister chromatids are attached to both poles. In contrast, during meiosis I, each pair of sister chromatids (within a bivalent) is attached to a single pole. Bivalents align along the metaphase plate during metaphase of meiosis I, whereas sister chromatids align along the metaphase plate during metaphase of mitosis and meiosis II. At anaphase of meiosis I, the homologous chromosomes separate, but the sister chromatids remain together. In contrast, sister chromatid separation occurs during anaphase of mitosis and meiosis II. Taken together, the steps of mitosis produce two diploid cells that are genetically identical, whereas the steps of meiosis involve two sequential cell divisions that produce four haploid cells that may not be genetically identical.

Sexually reproducing species produce haploid and diploid cells at different times in their life cycles
Let’s now turn our attention to the relationship between mitosis, meiosis, and sexual reproduction in animals, plants, fungi, and protists. For any given species, the sequence of events that produces another generation of organisms is known as a life cycle. For sexually reproducing organisms, this usually involves an alternation between haploid cells or organisms and diploid cells or organisms (Figure below).


A comparison of three types of sexual life cycles.

Diploid-Dominant Species
Most species of animals are diploid, and their haploid gametes are considered to be a specialized type of cell. For this reason, animals are viewed as diploid-dominant species (Figure a above). Certain diploid cells in the testes or ovaries undergo meiosis to produce haploid sperm or eggs, respectively. During fertilization, sperm and egg unite to form a diploid zygote, which then undergoes repeated mitotic cell divisions to produce a diploid multicellular
organism.

Haploid-Dominant Species
By comparison, most fungi and some protists are just the opposite; they are haploid-dominant species (Figure b above). In fungi, the multicellular organism is haploid (1n); only the zygote is diploid. Haploid fungal cells are most commonly produced by mitosis. During sexual reproduction, haploid cells unite to form a diploid zygote, which then immediately proceeds through meiosis to produce four haploid cells called spores. Each spore goes through
mitotic cellular divisions to produce a haploid multicellular organism.

Alternation of Generations
Plants and some algae have life cycles that are intermediate between diploid or haploid dominance. Such species exhibit an alternation of generations (Figure c). The species alternate between diploid multicellular organisms
called sporophytes, and haploid multicellular organisms called gametophytes. Meiosis in certain cells within the sporophyte produces haploid spores, which divide by mitosis to produce the gametophyte. Particular cells within the gametophyte differentiate into haploid gametes. Fertilization occurs between two gametes, producing a diploid zygote that then undergoes repeated mitotic cell divisions to produce a sporophyte. Among different plant species, the relative sizes of the haploid and diploid organisms vary greatly. In mosses, the haploid gametophyte is a visible multicellular organism, whereas the diploid sporophyte is smaller and remains attached to the haploid organism. In
other plants, such as ferns (Figure c above), both the diploid sporophyte and haploid gametophyte grow independently. The sporophyte is considerably larger and is the organism we commonly think of as a fern. In seed-bearing plants, such as roses and oak trees, the diploid sporophyte is the large multicellular plant, whereas the gametophyte is composed of only a few cells and is formed within the sporophyte. When comparing animals, plants, and fungi, it’s interesting to consider how gametes are made. Animals produce gametes by meiosis. In contrast, plants and fungi produce reproductive cells by mitosis. The gametophyte of plants is a haploid multicellular organism that is created by mitotic cellular divisions of a haploid spore. Within the multicellular gametophyte, certain cells become specialized as gametes.