A molecula de Deus

Different Splicing Mechanisms Can Remove Introns
Since the original discovery of introns, the investigations of many
research groups have shown that most structural genes in complex
eukaryotes contain one or more introns. Less commonly,
introns can occur within tRNA and rRNA genes. At the molecular
level, different RNA splicing mechanisms have been identified.
In the three examples shown in Figure 12.20 , splicing leads
to the removal of the intron RNA and the covalent connection of
the exon RNA.
The splicing among group I and group II introns occurs
via self-splicing—splicing that does not require the aid of other
catalysts. Instead, the RNA functions as its own ribozyme. Group
I and II differ in the ways that the introns are removed and
the exons are connected. Group I introns that occur within the
rRNA of Tetrahymena (a protozoan) have been studied extensively
by Thomas Cech and colleagues. In this organism, the
splicing process involves the binding of a single guanosine to a
guanosine-binding site within the intron (Figure 12.20a). This
guanosine breaks the bond between the first exon and the intron
and becomes attached to the 5ʹ end of the intron. The 3ʹ—OH
group of exon 1 then breaks the bond next to a different nucleotide
(in this example, a G) that lies at the boundary between
the end of the intron and exon 2; exon 1 forms a phosphoester
bond with the 5ʹ end of exon 2. The intron RNA is subsequently
degraded. In this example, the RNA molecule functions as its
own ribozyme, because it splices itself without the aid of a catalytic
protein.

Mecanismos diferentes de splicing  podem remover Introns

Desde a descoberta original da introns,  investigações de muitos grupos de investigação científica descobriram  e demonstraram que a maioria dos genes estruturais em células complexas eucariotas conterm um ou mais introns. Menos frequentemente, introns podem ocorrer dentro dos genes de tRNA e rRNA. No nível molecular, diferentes mecanismos de splicing de RNA foram identificados. Nos três exemplos mostrados na figura 5.20, splicing leva a remoção do RNA intron e a ligação covalente do RNA exon. O splicing entre os grupos de introns  I e II ocorre  por meio de auto-splicing. Splicing, que não requer a ajuda de outros catalisadores. Em vez disso, RNA funciona como o seu próprio ribozima. Grupo I e II diferem nas maneiras que os introns são removidos e os exons são ligados. Íntrons do Grupo I, que ocorrem dentro de rRNA Tetrahymena (um protozoário) têm sido extensivamente estudado por Thomas Cech e colegas. Neste organismo, o processo de splicing  envolve a ligação de uma única guanosina a um sitio  de ligação de guanosina dentro do intron (Figura 12.20a) . Esta
guanosina quebra a ligação entre o primeiro exon e do intron e se liga à extremidade 5' do intron. O grupo   3'-OH do exon 1 em seguida, quebra a ligação ao lado de um nucleótido diferente (Neste exemplo, um G), que se situa no limite entre o final do intron e exon 2; exon 1 forma uma ligação fosfoéster com a extremidade 5' do exão 2. O RNA intron é subsequentemente degradado. Neste exemplo, a molécula de RNA funciona como seu
próprio ribozima, porque emenda a si mesmo, sem a ajuda de um catalisador proteico.


In group II introns, a similar splicing mechanism occurs,
except the 2ʹ—OH group on ribose found in an adeninenucleotide already within the intron strand begins the catalytic
process (Figure 12.20b). Experimentally, group I and II selfsplicing
can occur in vitro without the addition of any proteins.
However, in a living cell, proteins known as maturases often
enhance the rate of splicing of group I and II introns.
In eukaryotes, the transcription of structural genes produces
a long transcript known as pre-mRNA, which is located
within the nucleus. This pre-mRNA is usually altered by splicing
and other modifications before it exits the nucleus. Unlike group I
and II introns, which may undergo self-splicing, pre-mRNA splicing
requires the aid of a multicomponent structure known as the
spliceosome. As discussed shortly, this is needed to recognize the
intron boundaries and to properly remove it.
Table 12.4 describes the occurrence of introns among the
genes of different species. The biological significance of group
I and II introns is not understood. By comparison, pre-mRNA
splicing is a widespread phenomenon among complex eukaryotes.
In mammals and flowering plants, most structural genes
have at least one intron that can be located anywhere within
the gene. For example, an average human gene has about eight
introns. In some cases, a single gene can have many introns. As
an extreme example, the human dystrophin gene, which, when
mutated, causes Duchenne muscular dystrophy, has 79 exons
punctuated by 78 introns.

Em introns do grupo II, ocorre um mecanismo de splicing semelhante,
excepto o grupo 2'-OH em ribose encontrado em um nucleótido adenina já dentro do intrão cadeia começa a catalítica
processo (Figura 12.20b). Experimentalmente, o grupo I e II auto-splicing
pode ocorrer in vitro, sem a adição de quaisquer proteínas.
No entanto, em uma célula viva, proteínas conhecidas como maturases frequentemente
aumentar a taxa de splicing de intrões do grupo I e II.
Em eucariotas, a transcrição de genes estruturais produz
um longo transcrição conhecido como pré-ARNm, que está localizado
no interior do núcleo. Esta pré-mRNA é geralmente alterado por splicing
e outras modificações antes que ele saia do núcleo. Ao contrário do grupo I
intrões e II, os quais podem ser submetidos a auto-processamento, pré-mRNA splicing
requer a ajuda de uma estrutura conhecida como o multicomponente
spliceosome. Tal como discutido brevemente, este é necessária para reconhecer o
íntron e para removê-lo corretamente.
Tabela 12.4 descreve a ocorrência de intrões entre o
genes de espécies diferentes. O significado biológico do grupo
I e II intrões não é compreendido. Em comparação, a pré-ARNm
splicing é um fenómeno generalizado entre os eucariotos complexos.
Nos mamíferos e plantas com flores, a maioria dos genes estruturais
ter pelo menos um intrão que pode estar localizado em qualquer lugar dentro
do gene. Por exemplo, um gene humano médio tem cerca de oito
íntrons. Em alguns casos, um único gene pode ter diversos intrões. Como
um exemplo extremo, o gene da distrofina humana, que, quando
mutado, causa distrofia muscular de Duchenne, possui 79 exons
pontuada por 78 íntrons.

Pre-mRNA Splicing Occurs
by the Action of a Spliceosome
As noted previously, the spliceosome is a large complex that
splices pre-mRNA in eukaryotes. It is composed of several
subunits known as snRNPs (pronounced “snurps”). Each snRNP
contains small nuclear RNA and a set of proteins. During splicing,
the subunits of a spliceosome carry out several functions.
First, spliceosome subunits bind to an intron sequence and precisely
recognize the intron-exon boundaries. In addition, the
spliceosome must hold the pre-mRNA in the correct configuration
to ensure the splicing together of the exons. And finally,
the spliceosome catalyzes the chemical reactions that cause the
introns to be removed and the exons to be covalently linked.
Intron RNA is defined by particular sequences within
the intron and at the intron-exon boundaries. The consensus
sequences for the splicing of mammalian pre-mRNA are shown
in Figure 12.21 . These sequences serve as recognition sites for
the binding of the spliceosome. The bases most commonly found
at these sites—those that are highly conserved evolutionarily—
are shown in bold. The 5ʹ and 3ʹ splice sites occur at the ends of
the intron, whereas the branch site is somewhere in the middle.
These sites are recognized by components of the spliceosome. b
The molecular mechanism of pre-mRNA splicing is
depicted in Figure 12.22 . The snRNP designated U1 binds to the
5. splice site, and U2 binds to the branch site. This is followed
by the binding of a trimer of three snRNPs: a U4/U6 dimer plus
U5. The intron loops outward, and the two exons are brought
closer together. The 5. splice site is then cut, and the 5. end of
the intron becomes covalently attached to the 2.—OH group of
a specific adenine nucleotide in the branch site. U1 and U4 are
released. In the final step, the 3. splice site is cut, and then the
exons are covalently attached to each other. The three snRNPs—
U2, U5, and U6—remain attached to the intron, which is in a
lariat configuration. Eventually, the intron is degraded, and the
snRNPs are used again to splice other pre-mRNAs.

Pré-mRNA emenda Ocorre
pela ação de um spliceosome
Como observado anteriormente, o spliceosome é um grande complexo, que
emendas de pré-ARNm em eucariotas. É composto por várias
subunidades conhecidas como snRNPs (pronuncia-se "snRNPs"). Cada snRNA
contém RNA nuclear pequeno e um conjunto de proteínas. Durante o splicing,
as subunidades de uma spliceosome realizar várias funções.
Em primeiro lugar, ligam-se a subunidades spliceosome uma sequência de intrão e precisamente
reconhecer as fronteiras intrão-exão. Além disso, o
spliceosome deve manter o pré-mRNA na configuração correta
para garantir a união em conjunto das exões. E finalmente,
spliceossoma catalisa as reacções químicas que causam a
intrões a ser removido e os exões de ser ligado de forma covalente.
Intron ARN é definido pelas sequências particulares dentro
o intrão e nos limites intrão-exão. O consenso
sequências para o splicing de mamífero pré-mRNA são mostrados
na Figura 12.21. Estas sequências de servir como locais de reconhecimento para
a ligação do spliceossoma. As bases mais comumente encontrados
nesses locais-aqueles que são altamente conservados evolutionarily-
são exibidas em negrito. Os locais de splicing 5 'e 3' ocorrem nas extremidades de
o intron, enquanto o site de filial está em algum lugar no meio.
Estes locais são reconhecidos pelos componentes do spliceossoma. b
O mecanismo molecular do pré-mRNA splicing é
representado na Figura 12.22. O U1 snRNP designado liga-se ao
5. local de união, e U2 se liga ao site da filial. Isto é seguido
através da ligação de um trímero de três snRNPs: um U4 / dímero U6 mais
U5. O intrão circula para fora, e os dois exões é apresentado
ainda mais juntos. 5. O sítio de splicing é então cortada, e a fim de 5.
o intrão fica covalentemente ligado ao grupo OH de 2.-
um nucleotídeo adenina específico no site da filial. U1 e U4 são
lançado. No passo final, o local de splice 3. é cortada, e então o
exões estão covalentemente ligados um ao outro. Os três snRNPs-
U2, U5, U6 e-permanecer solidários com a intron, que está em um
configuração lariat. Eventualmente, o intrão é degradado, e o
snRNPs são utilizados novamente para emendar outros pré-mRNAs.

The chemical reactions that occur during pre-mRNA splicing
are not completely understood. Though further research is
needed, evidence is accumulating that certain snRNA molecules
within the spliceosome may play a catalytic role in the removal
of introns and the connection of exons. In other words, snRNAs
may function as ribozymes that cleave the RNA at the exonintron
boundaries and connect the remaining exons. Researchers
have speculated that RNA molecules within U2 and U6 may have
this catalytic function.
Before ending our discussion of pre-mRNA splicing, let’s
consider why it may be an advantage for a species to have genes
that contain introns. One benefit is a phenomenon called alternative
splicing. When a pre-mRNA has multiple introns, variation
may occur in the pattern of splicing, so the resulting mRNAs
contain alternative combinations of exons. The variation in splicing
may happen in different cell types or during different stages
of development. The biological advantage of alternative splicing
is that two or more different proteins can be derived from a
single gene. This allows an organism to carry fewer genes in
its genome. The molecular mechanism of alternative splicing
is examined in Chapter 15 . It involves the actions of proteins
(not shown in Figure 12.22) that influence whether or not U1
and U2 can begin the splicing process.

As reacções químicas que ocorrem durante a pré-mRNA splicing
não estão completamente esclarecidos. Embora mais pesquisa é
necessário, evidência está acumulando que certas moléculas snRNA
dentro do spliceossoma pode desempenhar um papel de catalisador na remoção
de intrões e ligação de exões da. Em outras palavras, snRNPs
pode funcionar como ribozimas que clivam o ARN no intrão exão
limites e ligar os exons restantes. Pesquisadores
especularam que moléculas de RNA dentro U2 e U6 pode ter
Esta função catalítica.
Antes de terminar nossa discussão de pré-mRNA splicing, vamos
considera por isso que pode ser uma vantagem para uma espécie de ter genes
que contêm intrões. Um benefício é um fenômeno chamado alternativa
splicing. Quando um pré-ARNm tem vários intrões, variação
pode ocorrer no padrão de splicing, de modo que os mRNAs resultantes
contêm combinações alternativas de exões. A variação no splicing
pode ocorrer em diferentes tipos de células ou durante as diferentes fases
de desenvolvimento. A vantagem biológica de splicing alternativo
se que duas ou mais proteínas diferentes podem ser derivados a partir de um
gene único. Isso permite que um organismo para transportar menos em genes
seu genoma. O mecanismo molecular de splicing alternativo
é examinado no Capítulo 15. Trata-se as acções de proteínas
(não mostrado na figura 12.22) que influenciam se ou não U1
U2 e pode começar o processo de splicing.

TFIIB acts as a bridge to bind
RNA polymerase II and TFIIF.

TFIID atua como uma ponte para ligar
RNA polimerase II e TFIID.

TFIIE and TFIIH bind to RNA
polymerase II to form a preinitiation
or closed complex.

TFIID e TFIIH se ligam á RNA polimerase II para formar um complexo de pré-iniciação ou complexo fechado.

TFIIH acts as a helicase to form an
open complex. TFIIH also phosphorylates
the CTD domain of RNA polymerase II.
CTD phosphorylation breaks the contact
between TFIIB and RNA polymerase II.
TFIIB, TFIIE, and TFIIH are released.

TFIIH atua como uma helicase para formar um complexo aberto. TFIIH também fosforila o domínio CTD da RNA polimerase II. Fosforilação de CTD  rompe o contato entre TFIIB e RNA polimerase II. TFIIB, TFIID e TFIIH são liberados.

CTD domain of RNA polymerase II

The Ends of Eukaryotic Pre-mRNAs
Have a 5ʹ Cap and a 3ʹ Tail
In addition to splicing, pre-mRNAs in eukaryotes are also subjected
to modifications at their 5ʹ and 3ʹ ends. At their 5ʹ end, most
mature mRNAs have a 7-methylguanosine covalently attached—an
event known as capping. Capping occurs while the pre-mRNA is
being made by RNA polymerase II, usually when the transcript is
only 20 to 25 nucleotides in length. As shown in Figure 12.23 , it
is a three-step process. The nucleotide at the 5ʹ end of the transcript
has three phosphate groups. First, an enzyme called RNA
5ʹ-triphosphatase removes one of the phosphates, and then a second
enzyme, guanylyltransferase, uses guanosine triphosphate (GTP) to
attach a guanosine monophosphate (GMP) to the 5ʹ end. Finally, a
methyltransferase attaches a methyl group to the guanine base.
What are the functions of the 7-methylguanosine cap?
The cap structure is recognized by cap-binding proteins, which
perform various roles. For example, cap-binding proteins are
required for the proper exit of most mRNAs from the nucleus.
Also, the cap structure is recognized by initiation factors that
are needed during the early stages of translation. Finally, the cap
structure may be important in the efficient splicing of introns,
particularly the first intron located nearest the 5ʹ end.
Let’s now turn our attention to the 3ʹ end of the RNA molecule.
Most mature mRNAs have a string of adenine nucleotides,
referred to as a polyA tail, which is important for mRNA stability
and in the synthesis of polypeptides. The polyA tail is not
encoded in the gene sequence. Instead, it is added enzymatically
after the pre-mRNA has been completely transcribed—a process
termed polyadenylation.

As extremidades dos Eukaryotic pré-mRNAs
Tenha um Cap 5'e uma cauda 3 '
Além de splicing, pré-ARNm em eucariotas também são submetidas
a modificações na sua extremidades 5'- e 3'-. Na sua extremidade 5 ', mais
mRNAs maduros têm um anexado à um 7-metilguanosina covalente
evento conhecido como nivelamento. Capping ocorre enquanto a pré-ARNm é
sendo feito pela RNA polimerase II, normalmente quando a transcrição é
somente 20 a 25 nucleótidos de comprimento. Como mostrado na Figura 12,23, ele
é um processo de três passos. O nucleótido na extremidade 5 'do transcrito
tem três grupos fosfato. Em primeiro lugar, uma enzima chamada ARN
5'-trifosfatase remove um dos fosfatos, e, em seguida, uma segunda
enzima, guanylyltransferase, utiliza trifosfato de guanosina (GTP) para
anexar um monofosfato de guanosina (GMP) para a extremidade 5 '. Finalmente, uma
metiltransferase anexa um grupo metilo, para a base de guanina.
Quais são as funções da tampa 7-metilguanosina?
A estrutura de cobertura é reconhecida por proteínas de ligação PAC, que
executar várias funções. Por exemplo, as proteínas de ligação são cap
necessária para a saída correcta da maioria dos ARNm a partir do núcleo.
Além disso, a estrutura de cobertura é reconhecido por factores de iniciação que
são necessários durante os primeiros estágios de tradução. Finalmente, a tampa
estrutura pode ser importante no splicing eficiente dos intrões,
particularmente o primeiro intrão localizado mais próximo da extremidade 5 '.
Vamos agora voltar nossa atenção para o final 3 'da molécula de RNA.
A maioria dos mRNAs maduros têm uma seqüência de nucleotídeos de adenina,
referido como uma cauda poliA, que é importante para a estabilidade do ARNm
e na síntese de polipéptidos. A cauda poli A não é
codificado na sequência do gene. Em vez disso, ele é adicionado enzymatically
Após a pré-ARNm foi transcrito completamente um processo-
poliadenilação denominadas.


The steps required to synthesize a polyA tail are shown in
Figure 12.24 . To acquire a polyA tail, the pre-mRNA contains a
polyadenylation signal sequence near its 3ʹ end. In mammals, the
consensus sequence is AAUAAA. This sequence is downstream
(toward the 3ʹ end) from the stop codon in the pre-mRNA. An
endonuclease recognizes the signal sequence and cleaves the
pre-mRNA at a location that is about 20 nucleotides beyond the
3ʹ end of the AAUAAA sequence. The fragment beyond the 3ʹ
cut is degraded. Next, an enzyme known as polyA-polymerase
attaches many adenine-containing nucleotides. The length of the
polyA tail varies among different mRNAs, from a few dozen to
several hundred adenine nucleotides. As discussed in Chapter 15 ,
a long polyA tail increases the stability of mRNA and plays a role
during translation.

The Nucleotide Sequence of RNA Can
Be Modified by RNA Editing

The term RNA editing refers to a change in the nucleotide
sequence of an RNA molecule that involves additions or deletions
of particular bases, or a conversion of one type of base to another,
such as a cytosine to a uracil. In the case of mRNAs, editing can
have various effects, such as generating start codons, generating
stop codons, and changing the coding sequence for a polypeptide.
The phenomenon of RNA editing was first discovered in trypanosomes,
the protists that cause sleeping sickness. As with the discovery of RNA splicing, the initial finding of RNA editing was
met with great skepticism. Since that time, however, RNA editing
has been shown to occur in various organisms and in a variety of
ways, although its functional significance is slowly emerging (Table
12.5 ). In the specific case of trypanosomes, the editing process
involves the addition or deletion of one or more uracil nucleotides .

Os passos necessários para sintetizar uma cauda poliA são mostrados na
Figura 12.24. Para adquirir uma cauda poliA, o pré-mRNA contém um
sequência de sinal de poliadenilação perto da sua extremidade 3 '. Nos mamíferos, o
sequência de consenso é AAUAAA. Esta sequência é a jusante
(para a extremidade 3 ') do codão de paragem no pré-ARNm. Um
endonuclease reconhece a sequência para se unir os sinais
pré-ARNm numa localização que é de cerca de 20 nucleótidos para além do
Extremidade 3 'da sequência AAUAAA. O fragmento além do 3'
corte é degradada. Em seguida, uma enzima conhecida como poli-polimerase
atribui muitos nucleótidos contendo adenina. O comprimento do
polyA cauda varia entre os diferentes mRNAs, a partir de algumas dezenas a
várias centenas de nucleótidos de adenina. Como discutido no Capítulo 15,
uma cauda poliA longa aumenta a estabilidade do ARNm e desempenha um papel
durante a tradução.

A sequência de nucleótidos do ARN pode
Ser modificada editando RNA

A edição de ARN termo refere-se a uma mudança no nucleótido
sequência de uma molécula de ARN que envolve adições ou deleções
de bases particulares, ou a conversão de um tipo de base para outra,
tal como uma citosina a um uracilo. No caso de ARNm, a edição pode
tem vários efeitos, como a geração de códons de iniciação, gerando
os codões de paragem, e alterar a sequência de codificação para um polipéptido.
O fenômeno da edição de RNA foi descoberto pela primeira vez em tripanossomas,
os protistas que causam doença do sono. Tal como acontece com a descoberta de splicing de ARN, o achado inicial foi de edição de ARN
reuniu-se com grande ceticismo. Desde essa altura, no entanto, a edição de RNA
Foi demonstrado que ocorrem em vários organismos e numa variedade de
maneiras, embora o seu significado funcional está emergindo lentamente (Tabela
12,5). No caso específico de tripanossomas, o processo de edição
envolve a adição ou supressão de um ou mais nucleótidos de uracilo.

A more widespread mechanism for RNA editing involves
changes of one type of base to another. In this form of editing,
a base in the RNA is deaminated—an amino group is removed
from the base. When cytosine is deaminated, uracil is formed,
and when adenine is deaminated, inosine is formed (Figure
12.25 ). Inosine is recognized as guanine during translation.
An example of RNA editing occurs in mammals involving an
mRNA that encodes a protein called apolipoprotein B. In the liver,
the RNA editing process produces apolipoprotein B-100, a protein
that is essential for the transport of cholesterol in the blood.
In intestinal cells, the mRNA may be edited so that a single C is
changed to a U. What is the significance of this base substitution?
This change converts a glutamine codon (CAA) to a stop codon
(UAA) and thereby results in a shorter apolipoprotein. In this case,
RNA editing produces an apolipoprotein B with an altered structure.
Therefore, RNA editing can produce two proteins from the
same gene, much like the phenomenon of alternative splicing.
How widespread is RNA editing that involves C to U and A
to I substitutions? In invertebrates such as Drosophila, researchers
estimate that 50 to 100 RNAs are edited for the purpose of
changing the RNA coding sequence. In mammals, the RNAs
from less than 25 genes are known to be edited.

Um mecanismo mais generalizado para a edição de ARN envolve
mudanças de um tipo de base para outra. Nesta forma de edição,
uma base em que o ARN é desaminado-um grupo amino é removido
a partir da base. Quando é desaminado citosina, uracilo é formado,
e quando é desaminado adenina, inosina é formada (figura
12,25). Inosina guanina é reconhecida como durante a tradução.
Um exemplo da edição de ARN ocorre em mamíferos envolvendo um
ARNm que codifica para uma proteína chamada apolipoproteína B. No fígado,
o processo de edição de ARN produz apolipoproteína B-100, uma proteína
que é essencial para o transporte de colesterol no sangue.
Em células intestinais, o ARNm pode ser editada de modo a que um único C é
alterado para um U. Qual é o significado desta substituição de base?
Esta alteração converte um codão de glutamina (CAA) para um codão de paragem
(UAA), e, assim, resulta em um apolipoproteína mais curto. Nesse caso,
Edição de ARN produz uma apolipoproteína B com uma estrutura alterada.
Portanto, a edição de ARN pode produzir duas proteínas a partir da
mesmo gene, bem como o fenómeno da splicing alternativo.
Qual a extensão edição RNA que envolve C para L e A
a I substituições? Em invertebrados, como Drosophila, pesquisadores
estima-se que 50 a 100 RNAs são editados com o propósito de
alterando a sequência de codificação do ARN. Nos mamíferos, os RNAs
são conhecidos a partir de menos de 25 genes a ser editado.

TRANSLATION OF mRNA

The synthesis of cellular proteins occurs via the translation of the
sequence of codons within mRNA into a sequence of amino acids
that constitute a polypeptide. The general steps that occur in this
process were already outlined in Chapter 1 . In this chapter, we
will explore the current state of knowledge regarding translation,
with an eye toward the specific molecular interactions responsible
for this process. During the past few decades, the concerted
efforts of geneticists, cell biologists, and biochemists have profoundly
advanced our understanding of translation. Even so,
many questions remain unanswered, and this topic continues to
be an exciting area of investigation.
We will begin by considering classic experiments that
revealed the purpose of some genes is to encode proteins that
function as enzymes. Next, we examine how the genetic code
is used to decipher the information within mRNA to produce
a polypeptide with a specific amino acid sequence. The rest of
this chapter is devoted to an understanding of translation at the
molecular level as it occurs in living cells. This will involve an
examination of the cellular components—including many different
proteins, RNAs, and small molecules—needed for the translation
process. We will consider the structure and function of tRNA
molecules, which act as the translators of the genetic information
within mRNA, and then examine the composition of ribosomes.
Finally, we will explore the differences between translation in
bacterial cells and eukaryotic cells.

TRADUÇÃO DE mRNA

A síntese de proteínas celulares ocorre através da tradução do
sequência de codões dentro do mRNA em uma sequência de aminoácidos
que constituem um polipéptido. Os passos gerais que ocorrem neste
processo já foram descritos no Capítulo 1. Neste capítulo,
irá explorar o estado atual do conhecimento sobre a tradução,
com um olho para as interações moleculares específicos responsáveis
para este processo. Durante as últimas décadas, a concertada
esforços dos geneticistas, biólogos e bioquímicos celulares, têm profundamente
avanço do entendimento de tradução. Mesmo assim,
muitas questões permanecem sem resposta, e este assunto continua a
ser uma área excitante de investigação.
Vamos começar por considerar experimentos clássicos que
revelou o fim de alguns genes é para codificar proteínas que
função como enzimas. Em seguida, vamos examinar como o código genético
é utilizada para decifrar a informação dentro de ARNm para produzir
um polipéptido com uma sequência de aminoácidos específica. O resto de
este capítulo é dedicado a uma compreensão da tradução no
nível molecular, uma vez que ocorre em células vivas. Isso implicará uma
exame dos componentes celulares, incluindo muitos diferente
necessária moléculas de proteínas, RNAs e pequenos para a tradução
processo. Vamos considerar a estrutura e função do tRNA
moléculas, que agem como os tradutores da informação genética
dentro de mRNA, e, em seguida, examinar a composição dos ribossomos.
Finalmente, vamos explorar as diferenças entre a tradução em
células bacterianas e células eucarióticas.

13.1 THE GENETIC BASIS
FOR PROTEIN SYNTHESIS

Proteins are critically important as active participants in cell
structure and function. The primary role of DNA is to store
the information needed for the synthesis of all the proteins that
an organism makes. As we discussed in Chapter 12 , genes that
encode an amino acid sequence are known as structural genes .
The RNA transcribed from structural genes is called messenger
RNA (mRNA) . The main function of the genetic material is to
encode the production of cellular proteins in the correct cell, at
the proper time, and in suitable amounts. This is an extremely
complicated task because living cells make thousands of different
proteins. Genetic analyses have shown that a typical bacterium
can make a few thousand different proteins, and estimates
for eukaryotes range from several thousand in simple eukaryotic
organisms, such as yeast, to tens of thousands in plants and
animals.
In this section, we will begin by considering early experiments
that showed the role of genes is to encode proteins. We
then examine the general features of the genetic code—the
sequence of bases in a codon that specifies an amino acid—and
explore the experiments through which the code was deciphered,
or “cracked.” Finally, we will look at the biochemistry of polypeptide
synthesis to see how this determines the structure and
function of proteins, which are ultimately responsible for the
characteristics of living cells and an organism’s traits.

13.1 A base genética
SÍNTESE DE PROTEÍNA

As proteínas são criticamente importantes como participantes ativos no celular
estrutura e função. O principal papel do DNA é armazenar
a informação necessária para a síntese de todas as proteínas que
um organismo faz. Como discutimos no Capítulo 12, genes que
codificar uma sequência de aminoácidos são conhecidos como genes estruturais.
O ARN transcrito a partir de genes estruturais é chamado mensageiro
ARN (ARNm). A principal função do material genético é a
codificar a produção de proteínas celulares na célula correcta, em
o tempo adequado, e em quantidades adequadas. Isto é extremamente
tarefa complicada porque as células vivas fazer milhares de diferente
proteínas. A análise genética têm demonstrado que uma bactéria típica
pode fazer alguns milhares de proteínas diferentes, e as estimativas
para eucariotas variam de alguns milhares em eucariota simples
organismos, tais como leveduras, a dezenas de milhares de plantas e
animais.
Nesta seção, vamos começar considerando primeiras experiências
que mostrou o papel dos genes é para codificar proteínas. Nós
em seguida, analisar as características gerais do código genético-o
sequência de bases de um codão que especifica um amino ácido e-
explorar as experiências através do qual o código foi decifrado,
ou "cracking". Finalmente, vamos olhar para a bioquímica do polipeptídeo
síntese para ver como isto determina a estrutura e
função de proteínas, que são, em última instância responsável pela
características de células vivas e traços de um organismo.

Archibald Garrod Proposed That Some Genes Code
for the Production of a Single Enzyme
The idea that a relationship exists between genes and the production
of proteins was first suggested at the beginning of the
twentieth century by Archibald Garrod, a British physician. Prior
to Garrod’s studies, biochemists had studied many metabolic
pathways within living cells. These pathways consist of a series of
metabolic conversions of one molecule to another, each step catalyzed
by a specific enzyme. Each enzyme is a distinctly different
protein that catalyzes a particular chemical reaction. Figure 13.1
illustrates part of the metabolic pathway for the degradation of
phenylalanine, an amino acid commonly found in human diets.
The enzyme phenylalanine hydroxylase catalyzes the conversion
of phenylalanine to tyrosine, and a different enzyme, tyrosine
aminotransferase, converts tyrosine into p-hydroxyphenylpyruvic
acid, and so on. In all of the steps shown in Figure 13.1, a specific
enzyme catalyzes a single type of chemical reaction.
Garrod studied patients who had defects in their ability to
metabolize certain compounds. He was particularly interested in
the inherited disease known as alkaptonuria. In this disorder,
the patient’s body accumulates abnormal levels of homogentisic
acid (also called alkapton), which is excreted in the urine, causing
it to appear black on exposure to air. In addition, the disease
is characterized by bluish black discoloration of cartilage
and skin (ochronosis). Garrod proposed that the accumulation of
homogentisic acid in these patients is due to a missing enzyme,
namely, homogentisic acid oxidase (see Figure 13.1).

Archibald Garrod propôs que alguns genes Código
para a produção de uma única enzima
A idéia de que existe uma relação entre genes ea produção
de proteínas foi primeiro sugerida no início do
século XX por Archibald Garrod, um médico britânico. priori
para estudos de Garrod, bioquímicos tinha estudado muitos metabólica
percursos dentro de células vivas. Estas vias consistem de uma série de
conversões metabólicas de uma molécula para outra, cada passo catalisado
por uma enzima específica. Cada enzima é uma distintamente diferente
proteína que catalisa uma reacção química particular. Figura 13.1
ilustra a parte da via metabólica para a degradação de
fenilalanina, um aminoácido comumente encontrados em dietas humanas.
A enzima fenilalanina hidroxilase catalisa a conversão
de fenilalanina em tirosina, e uma enzima diferente, tirosina
aminotransferase, converte a tirosina em p-hydroxyphenylpyruvic
ácido, e assim por diante. Em todos os passos mostrados na Figura 13.1, um específico
enzima catalisa um único tipo de reacção química.
Garrod estudou pacientes que tiveram defeitos em sua capacidade de
metabolizar certos compostos. Ele estava particularmente interessado em
a doença hereditária conhecida como Alcaptonúria. Neste distúrbio,
corpo do paciente acumula níveis anormais de homogentísico
ácido (também chamado alkapton), que é excretado na urina, causando
ele apareça preto quando exposto ao ar. Além disso, a doença
é caracterizada por descoloração preta azulada de cartilagem
e pele (ocronose). Garrod propôs que a acumulação de
ácido homogentísico nestes pacientes é devido a uma enzima em falta,
ou seja, oxidase ácido homogentísico (veja a Figura 13.1).

How did Garrod realize that certain genes encode enzymes?
He already knew that alkaptonuria is an inherited trait
that follows an autosomal recessive pattern of inheritance. Therefore,
an individual with alkaptonuria must have inherited the
mutant (defective) gene that causes this disorder from both parents.
From these observations, Garrod proposed that a relationship
exists between the inheritance of the trait and the inheritance
of a defective enzyme. Namely, if an individual inherited
the mutant gene (which causes a loss of enzyme function), she or
he would not produce any normal enzyme and would be unable
to metabolize homogentisic acid. Garrod described alkaptonuria
as an inborn error of metabolism. This hypothesis was the first
suggestion that a connection exists between the function of genes
and the production of enzymes. At the turn of the century, this
idea was particularly insightful, because the structure and function
of the genetic material were completely unknown.

Beadle and Tatum’s Experiments
with Neurospora Led Them to Propose
the One-Gene/One-Enzyme Hypothesis

In the early 1940s, George Beadle and Edward Tatum were also
interested in the relationship among genes, enzymes, and traits.
They developed an experimental system for investigating the
connection between genes and the production of particular
enzymes. Consistent with the ideas of Garrod, the underlying
assumption behind their approach was that a relationship exists
between genes and the production of enzymes. However, the
quantitative nature of this relationship was unclear. In particular,
they asked the question, Does one gene control the production
of one enzyme, or does one gene control the synthesis of many
enzymes involved in a complex biochemical pathway?

Como Garrod perceber que certos genes codificam enzimas?
Ele já sabia que alcaptonúria é uma característica hereditária
que segue um padrão de herança autossômico recessivo. Portanto,
um indivíduo com Alcaptonúria deve ter herdado o
gene mutante (defeituoso) que faz com que esta desordem de ambos os progenitores.
A partir dessas observações, Garrod propôs que um relacionamento
existe entre a herança da característica e da herança
de uma enzima defeituosa. Ou seja, se um indivíduo herdada
o gene mutante (que provoca uma perda da função da enzima), ou ela
ele não produziria qualquer enzima normal e seria incapaz
para metabolizar ácido homogentísico. Garrod descrito alcaptonúria
como um erro inato do metabolismo. Esta hipótese foi a primeira
sugestão de que existe uma ligação entre a função de genes
e a produção de enzimas. Na virada do século, este
ideia era particularmente criterioso, porque a estrutura e função
do material genético foram completamente desconhecido.

Experimentos de Beadle e Tatum
Neurospora com os levou a propor
o One-Gene / One-Enzyme Hipótese

No início dos anos 1940, George Beadle Edward Tatum e também foram
interessado na relação entre os genes, enzimas, e traços.
Eles desenvolveram um sistema experimental para a investigação da
ligação entre genes e a produção de determinada
enzimas. Consistente com as idéias de Garrod, o subjacente
pressuposto por trás de sua abordagem foi a de que existe uma relação
entre os genes e a produção de enzimas. No entanto, o
natureza quantitativa dessa relação não era clara. Em particular,
que fez a pergunta, faz um controle do gene da produção
de uma enzima, ou faz um controlo do gene da a síntese de muitos
enzimas envolvidas na via bioquímica um complexo?

At the time of their studies, many geneticists were trying
to understand the nature of the gene by studying morphological
traits. However, Beadle and Tatum realized that morphological
traits are likely to be based on systems of biochemical reactions so
complex as to make analysis exceedingly difficult. Therefore, they
turned their genetic studies to the analysis of simple nutritional
requirements in Neurospora crassa, a common bread mold. Neurospora
can be easily grown in the laboratory and has few nutritional
requirements: a carbon source (sugar), inorganic salts, and
the vitamin biotin. Normal Neurospora cells produce many different
enzymes that can synthesize the organic molecules, such as
amino acids and other vitamins, which are essential for growth.
Beadle and Tatum wanted to understand how enzymes are
controlled by genes. They reasoned that a mutation in a gene,
causing a defect in an enzyme needed for the cellular synthesis
of an essential molecule, would prevent that mutant strain
from growing on minimal medium, which contains only a carbon
source, inorganic salts, and biotin. In their original study
of 1941, Beadle and Tatum exposed Neurospora cells to X-rays,
which caused mutations to occur, and studied the growth of the
resulting cells. By plating the cells on media with or without vitamins,
they were able to identify mutant strains that required vitamins
for growth. In each case, a single mutation resulted in the
requirement for a single type of vitamin in the growth media.
This early study by Beadle and Tatum led to additional
research to study enzymes involved with the synthesis of other
substances, including the amino acid methionine. They first isolated
several different mutant strains that required methionine
for growth.

Na época de seus estudos, muitos geneticistas estavam tentando
para compreender a natureza do gene através do estudo morfológico
traços. No entanto, Beadle e Tatum percebeu que morfológica
traços são susceptíveis de ser baseados em sistemas de reacções bioquímicas assim
complexo como fazer análise extremamente difícil. Portanto, eles
transformaram seus estudos genéticos para a análise da simples nutricional
requisitos em Neurospora crassa, um bolor do pão comum. Neurospora
podem ser facilmente cultivadas em laboratório e tem poucos nutricional
requisitos: uma fonte de carbono (açúcar), sais inorgânicos, e
a vitamina biotina. As células normais Neurospora produzir muitos diferente
enzimas que podem sintetizar as moléculas orgânicas, tais como
aminoácidos e outras vitaminas, que são essenciais para o crescimento.
Beadle e Tatum queria entender como as enzimas são
controlada por genes. Eles argumentaram que uma mutação em um gene,
causando um defeito num enzima necessária para a síntese celular
de uma molécula essencial, impediria que estirpe mutante
de crescer em meio mínimo, que contém apenas um átomo de carbono
fonte, sais inorgânicos, e biotina. Em seu estudo original
de 1941, Beadle e Tatum expuseram células Neurospora para raios-X,
que causou a ocorrência de mutações, e estudou o crescimento do
células resultante. Por plaqueamento das células em meios com ou sem vitaminas,
eles foram capazes de identificar cepas mutantes que exigiam vitaminas
para o crescimento. Em cada caso, uma única mutação resultou na
requisito para um único tipo de vitamina no meio de crescimento.
Este estudo inicial por Beadle e Tatum levou a adicional
investigação para estudar as enzimas envolvidas na síntese de outros
substâncias, incluindo o aminoácido metionina. Eles primeiro isolado
várias estirpes mutantes diferentes que exigiam metionina
para o crescimento.

 They hypothesized that each mutant strain might
be blocked at only a single step in the consecutive series of
reactions that lead to methionine synthesis. To test this hypothesis,
the mutant strains were examined for their ability to grow
in the presence of O-acetylhomoserine, cystathionine, homocysteine,
or methionine. O-Acetylhomoserine, cystathionine, and
homocysteine are intermediates in the synthesis of methionine
from homoserine. A simplified depiction of the results is shown
in Figure 13.2a . The wild-type strain could grow on minimal
growth media that contained the minimum set of nutrients
that is required for growth. The minimal media did not contain
O-acetylhomoserine, cystathionine, homocysteine, or methionine.
Based on their growth properties, the mutant strains that
had been originally identified as requiring methionine for growth
could be placed into four groups designated strains 1, 2, 3, and 4
in this figure. A strain 1 mutant was missing enzyme 1, needed
for the conversion of homoserine into O-acetylhomoserine.
The cells could grow only if O-acetylhomoserine, cystathionine,
homocysteine, or methionine was added to the growth medium.
A strain 2 mutant was missing the second enzyme in this pathway
that is needed for the conversion of O-acetylhomoserine into
cystathionine and a strain 3 mutant was unable to convert cystathionine
into homocysteine. Finally, a strain 4 mutant could not
make methionine from homocysteine. Based on these results, the
researchers could order the enzymes into a biochemical pathway
as depicted in Figure 13.2b. Taken together, the analysis of these
mutants allowed Beadle and Tatum to conclude that a single gene
controlled the synthesis of a single enzyme. This was referred to
as the one-gene/one-enzyme hypothesis.

Eles hipótese que cada estirpe mutante pode
ser bloqueados com apenas um único passo para a série consecutiva de
reacções que conduzem à síntese de metionina. Para testar esta hipótese,
as estirpes mutantes foram examinadas quanto à sua capacidade para crescer
na presença de S-acetylhomoserine, cistationina, homocisteína,
e metionina. O-Acetylhomoserine, cystathionine, e
homocisteína são intermediários na síntese da metionina
do homo. Uma descrição simplificada dos resultados é mostrado
na Figura 13.2a. A estirpe de tipo selvagem poderia crescer no mínimo
meios de crescimento que continha o conjunto mínimo de nutrientes
que é necessária para o crescimento. O meio mínimo não continha
O-acetylhomoserine, cystathionine, homocisteína, ou metionina.
Com base nas suas propriedades de crescimento, as estirpes mutantes que
tinha sido originalmente identificado como requerendo metionina para o crescimento
Pode ser colocada em quatro grupos de estirpes 1, 2, 3, designados e 4
nesta figura. Uma estirpe mutante estava faltando uma enzima 1, necessária
para a conversão de O-homoserina em acetylhomoserine.
As células poderia crescer somente se O-acetylhomoserine, cystathionine,
homocisteína ou metionina foi adicionado ao meio de crescimento.
Uma estirpe mutante 2 estava faltando a segunda enzima nesta via
que é necessária para a conversão de O-acetylhomoserine em
cystathionine e uma estirpe mutante 3 foi incapaz de converter cystathionine
em homocisteína. Finalmente, uma estirpe mutante 4 não podia
fazer metionina a partir da homocisteína. Com base nestes resultados, o
os pesquisadores poderiam encomendar as enzimas em uma via bioquímica
como representado na Figura 13.2b. Tomados em conjunto, a análise destas
mutantes permitiu Beadle e Tatum concluir que um único gene
controlado a síntese de uma única enzima. Isto foi referido
como a hipótese de um gene de / uma enzima.


In later decades, this hypothesis had to be modified in
four ways. First, enzymes are only one category of cellular proteins.
All proteins are encoded by genes, and many of them do
not function as enzymes. Second, some proteins are composed of
two or more different polypeptides. Therefore, it is more accurate
to say that a structural gene encodes a polypeptide. The term
polypeptide refers to a structure; it is a linear sequence of amino
acids. A structural gene encodes a polypeptide. By comparison,
the term protein denotes function. Some proteins are composed
of one polypeptide. In such cases, a single gene does encode a
single protein. In other cases, however, a functional protein is
composed of two or more different polypeptides. An example
is hemoglobin, which is composed of two α-globin and two β-
globin polypeptides. In this case, the expression of two genes—
the α-globin and β-globin genes—is needed to create one functional
protein. A third reason why the one-gene/one-polypeptide
hypothesis needed revision is that we now know that many genes
do not encode polypeptides. As discussed in Chapter 12 , several
types of genes specify functional RNA molecules that are not
used to encode polypeptides (refer back to Table 12.1 ). Finally, as
discussed in Chapter 15, one gene can encode multiple polypeptides
due to alternative splicing and RNA editing.

During Translation, the Genetic Code Within
mRNA Is Used to Make a Polypeptide
with a Specific Amino Acid Sequence

Let’s now turn to a general description of translation. Why have
researchers named this process translation? At the molecular
level, translation involves an interpretation of one language—the
language of mRNA, a nucleotide sequence—into the language of
proteins—an amino acid sequence. The ability of mRNA to be
translated into a specific sequence of amino acids relies on the
genetic code. The sequence of bases within an mRNA molecule
provides coded information that is read in groups of three nucleotides
known as codons (Figure 13.3 ).

Em décadas posteriores, esta hipótese tinha que ser modificado em
quatro maneiras. Em primeiro lugar, as enzimas são apenas uma categoria de proteínas celulares.
Todas as proteínas são codificadas por genes, e muitos deles fazem
não funcionar como enzimas. Segundo, algumas proteínas são compostos de
dois ou mais polipéptidos diferentes. Portanto, é mais preciso
quer dizer que um gene estrutural codifica um polipéptido. O termo
polipéptido refere-se a uma estrutura; este é uma sequência de amino linear
ácidos. Um gene estrutural codifica um polipéptido. Por comparação,
o termo indica a função de proteína. Algumas proteínas são compostos
de um polipéptido. Em tais casos, um único gene codificar um faz
proteína única. Em outros casos, no entanto, é uma proteína funcional
composta de dois ou mais polipéptidos diferentes. Um exemplo
é a hemoglobina, que é composta de duas α-globina e duas β-
polipeptídeos de globina. Neste caso, a expressão dos dois genes-
o α-globina e genes da globina β-é necessária para criar um funcional
proteína. Uma terceira razão para que o de um gene de / um polipéptido
hipótese necessária revisão é que agora sabemos que muitos genes
não codificam polipéptidos. Como discutido no Capítulo 12, vários
tipos de genes que especificam as moléculas de RNA que não são funcionais
usado para codificar polipeptídeos (consultar a Tabela 12.1). Finalmente, como
discutido no Capítulo 15, um gene pode codificar vários polipeptídeos
devido ao splicing alternativo e edição de ARN.

Durante a tradução, o código genético Dentro
mRNA é usado para fazer um polipeptídeo
com uma sequência específica de aminoácidos

Vamos agora voltar de uma descrição geral de tradução. Por ter
pesquisadores nomeado esta tradução processo? No molecular
nível, a tradução envolve uma interpretação de uma língua-o
linguagem de mRNA, uma seqüência de nucleotídeos em língua de
Proteínas de uma sequência de aminoácidos. A capacidade de mRNA para ser
traduzida numa sequência específica de aminoácidos baseia-se na
Código genético. A sequência de bases de uma molécula de ARNm dentro
fornece informação codificada que é lido em grupos de três nucleótidos
conhecido como codões (Figura 13.3).

 The sequence of three bases
in most codons specifies a particular amino acid. These codons
are termed sense codons. For example, the codon AGC specifies
the amino acid serine, whereas the codon GGG encodes the
amino acid glycine. The codon AUG, which specifies methionine,
is used as a start codon; it is usually the first codon that begins a
polypeptide sequence. The AUG codon can also be used to specify
additional methionines within the coding sequence. Finally,
three codons are used to end the process of translation. These are
UAA, UAG, and UGA, which are known as stop codons. They
are also known as termination or nonsense codons.
The codons in mRNA are recognized by the anticodons in
transfer RNA (tRNA) molecules (see Figure 13.3). Anticodons are
three-nucleotide sequences that are complementary to codons in
mRNA. The tRNA molecules carry the amino acids that correspond
to the codons in the mRNA. In this way, the order of codons
in mRNA dictates the order of amino acids within a polypeptide.
The details of the genetic code are shown in Table 13.1 .
Because polypeptides are composed of 20 different kinds of
amino acids, a minimum of 20 codons is needed in order to
specify each type. With four types of bases in mRNA (A, U, G,
and C), a genetic code containing two bases in a codon would not
be sufficient because it would only have 42, or 16, possible types.
By comparison, a three-base codon system can specify 43, or 64,
different codons. Because the number of possible codons exceeds
20—which is the number of different types of amino acids—the
genetic code is termed degenerate . This means that more than
one codon can specify the same amino acid. For example, the
codons GGU, GGC, GGA, and GGG all specify the amino acid
glycine. Such codons are termed synonymous codons. In most
instances, the third base in the codon is the base that varies. The
third base is sometimes referred to as the wobble base. This
term is derived from the idea that the complementary base in the
tRNA can “wobble” a bit during the recognition of the third base
of the codon in mRNA. The significance of the wobble base will
be discussed later in this chapter.

A seqüência de três bases
na maioria dos codões especifica um aminoácido particular. Estes códons
são denominados codões dos sentidos. Por exemplo, o codão AGC especifica
o aminoácido serina, enquanto que o codão codifica a GGG
amino ácido glicina. O codão AUG, que especifica de metionina,
é utilizado como um codão de iniciação; é geralmente o primeiro codão que começa um
sequência polipeptídica. O codão AUG também pode ser usado para especificar
metionina adicional no interior da sequência de codificação. Finalmente,
três códons são utilizados para finalizar o processo de tradução. Esses são
UAA, UAG, e UGA, que são conhecidos como codões de paragem. Elas
são também conhecidos como terminação ou sem sentido códons.
Os codões de ARNm são reconhecidos pelos anticódons em
RNA de transferência (tRNA) moléculas (veja a Figura 13.3). Anticódons são
seqüências de três nucleótidos que são complementares em códons
ARNm. As moléculas de ARNt transportar os aminoácidos que correspondem
para os codões no ARNm. Deste modo, a fim de codões
em ARNm determina a ordem dos aminoácidos num polipéptido.
Os detalhes do código genético são mostrados na Tabela 13.1.
Porque os polipéptidos são compostos de 20 tipos diferentes de
aminoácidos, é necessário um mínimo de 20, a fim de codões
especificar cada tipo. Com quatro tipos de bases de ARNm (A, U, G,
e C), um código genético contendo duas bases num codão não faria
ser suficiente porque só teria 42 ou 16 tipos possíveis.
Por comparação, um sistema codão de três bases pode especificar 43, ou 64,
codões diferentes. Porque o número de codões possíveis excede
20, que é o número de diferentes tipos de aminoácidos a-
código genético é degenerado designado. Isto significa que mais de
um codão pode especificar o mesmo aminoácido. Por exemplo, a
códons GGU, GGC, GGA e GGG todos especificar o aminoácido
glicina. Tais codões são denominados codões sinónimos. Na maioria
casos, a terceira base do codão no é a base que varia. o
terceira base é por vezes referida como a base de oscilação. este
termo é derivado a partir da ideia de que a base complementar no
ARNt pode "wobble" um pouco durante o reconhecimento da terceira base
do codão no ARNm. O significado da base oscilante vai
ser discutido mais adiante neste capítulo.

The start codon (AUG) defines the reading frame of an
mRNA—a sequence of codons determined by reading bases in
groups of three, beginning with the start codon. This concept
is best understood with a few examples. The mRNA sequence
shown below encodes a short polypeptide with 7 amino acids:
5ʹ–AUGCCCGGAGGCACCGUCCAAU–3ʹ
Met–Pro–Gly–Gly–Thr–Val–Gln
If we remove one base (C) adjacent to the start codon, this
changes the reading frame to produce a different polypeptide
sequence:
5ʹ–AUGCCGGAGGCACCGUCCAAU–3ʹ
Met–Pro–Glu–Ala–Pro–Ser–Asn
Alternatively, if we remove three bases (CCC) next to the start
codon, the resulting polypeptide has the same reading frame as
the first polypeptide, though one amino acid (Pro, proline) has
been deleted:
5ʹ–AUGGGAGGCACCGUCCAAU–3ʹ
Met–Gly–Gly–Thr–Va l – G l n











ESTRUTURA DO RIBOSSOMO E MONTAGEM

De acordo com a hipótese adaptador, tRNAs ligam ao mRNA devido à complementaridade entre os anticódons e codões. Ao mesmo tempo, as tRNA's  tem o aminoácido correto ligado às suas extremidades 3 '. Para sintetizar um polipéptido, eventos adicionais precisam ocorrer. Em particular, a ligação entre a extremidade 3 'do tRNA e o aminoácido deve ser quebrado, e uma ligação petídica tem que ser formada entre os aminoácidos adjacentes. Para facilitar estes eventos, a tradução ocorre em um complexo macromolecular conhecido como o ribossoma. O ribossoma pode ser imaginado como uma fábrica macromolecular onde a tradução é efetuada.
Vamos descrever agora a composição bioquímica de ribossomas em células bacterianas e eucarióticas. Iremos examinar os locais funcionais fundamentais nos ribossomos para o processo de tradução.



Unless other-wise noted, the term eukaryotic ribosome
refers to ribosomes in the cytosol, not to those found within
organelles. Likewise, the description of eukaryotic translation
refers to translation via cytosolic ribosomes.
Each ribosome is composed of structures called the large
and small subunits. This term is perhaps misleading because
each ribosomal subunit itself is formed from the assembly of
many different proteins and RNA molecules called ribosomal
RNA or rRNA. In bacterial ribosomes, the 30S subunit is formed
from the assembly of 21 different ribosomal proteins and a 16S
rRNA molecule; the 50S subunit contains 34 different proteins
and 5S and 23S rRNA molecules (Table 13.6 ). The designations
30S and 50S refer to the rate that these subunits sediment when
subjected to a centrifugal force. This rate is described as a sedimentation
coefficient in Svedberg units (S), in honor of Theodor
Svedberg, who invented the ultracentrifuge. Together, the 30S
and 50S subunits form a 70S ribosome. (Note: Svedberg units
do not add up linearly.) In bacteria, the ribosomal proteins and
rRNA molecules are synthesized in the cytoplasm, and the ribosomal
subunits are assembled there.
The synthesis of eukaryotic rRNA occurs within the
nucleus, and the ribosomal proteins are made in the cytosol,
where translation takes place. The 40S subunit is composed of
33 proteins and an 18S rRNA; the 60S subunit is made of 49 proteins
and 5S, 5.8S, and 28S rRNAs (see Table 13.6). The assembly
of the rRNAs and ribosomal proteins to make the 40S and 60S
subunits occurs within the nucleolus, a region of the nucleus
specialized for this purpose. The 40S and 60S subunits are then
exported into the cytosol, where they associate to form an 80S
ribosome during translation.

Ribossomos bacterianos e eucarióticos são montados a partir rRNA e proteínas


As células bacterianas têm um tipo de ribossoma que é encontrado no interior do citoplasma. As células eucarióticas contêm ribossomas bioquimicamente distintas em diferentes localizações celulares. O tipo mais abundante
do ribossoma funciona no citossol, que é a região da célula eucariótica que está dentro da membrana do plasma, mas do lado de fora dos organelos ligados à membrana. Além dos ribossomas citosólicos, todas as células eucarióticas têm ribossomas dentro das mitocôndrias. Além disso, as células de plantas e algas têm  ribossomas nos seus cloroplastos. As composições de ribossomas mitocondrial e de cloroplastos são bastante diferentes  dos ribossomas citosólicos. A menos que  observado, o ribossoma eucariota refere-se aos ribossomas no citosol, não aos encontrados dentro de organelas. Da mesma forma, a descrição da tradução eucariótica refere-se a tradução por ribossomas citosólicas. Cada ribossoma é composto de estruturas chamado de subunidades  grandes e pequenas. Este termo é enganoso, porque talvez cada subunidade ribossômica em si é formada a partir da montagem de muitas  proteínas diferentes e as moléculas de RNA ribossomal chamadas  rRNA ( RNA ribossomal ). Em ribossomas bacterianos, a subunidade 30S é formada do conjunto de 21 proteínas ribossomais diferentes e uma  molécula de rRNA chamada 16S; a subunidade 50S contém 34 proteínas diferentes e moléculas de rRNA 23S e 5S (Tabela 13.6). As designações
30S e 50S referem-se à taxa que estas subunidades sedimentar quando
submetido a uma força centrífuga. Esta taxa é descrito como uma sedimentação
coeficiente em unidades Svedberg (S), em homenagem a Theodor
Svedberg, que inventou a ultracentrífuga. Juntas, as 30S
e 50S subunidades formam um ribossomo 70S. (Nota: unidades Svedberg
não se somam linearmente.) Em bactérias, as proteínas ribossomais e
moléculas de rRNA são sintetizadas no citoplasma, e a ribossomal
subunidades são montados ali.
A síntese de rRNA eucariótica ocorre dentro do
núcleo, e as proteínas ribossomais são feitas no citosol,
onde a tradução é efectuada. A subunidade 40S é composto de
33 proteínas e um ARNr 18S; a subunidade 60S é feita de 49 proteínas
e 5S, 5.8S e 28S rRNAs (ver Tabela 13.6). A montagem
dos rRNAs e proteínas ribossomais para fazer as 40S e 60S
subunidades ocorre no nucléolo, uma região do núcleo
especializada para esta finalidade. Os 40S e 60S subunidades são, então,
exportado para o citosol, onde eles se associam para formar uma 80S
ribossomo durante a tradução.

Components of Ribosomal Subunits Form
Functional Sites for Translation
To understand the structure and function of the ribosome at the
molecular level, researchers must determine the locations and
functional roles of the individual ribosomal proteins and rRNAs.
In recent years, many advances have been made toward a molecular
understanding of ribosomes. Microscopic and biophysical
methods have been used to study ribosome structure. An electron
micrograph of bacterial ribosomes is shown in Figure 13.15a .
More recently, a few research groups have succeeded in crystallizing
ribosomal subunits, and even intact ribosomes. This is an
amazing technical feat, because it is difficult to find the right
conditions under which large macromolecules will form highly
ordered crystals. Figure 13.15b shows the crystal structure of
bacterial ribosomal subunits. The overall shape of each subunit is
largely determined by the structure of the rRNAs, which constitute
most of the mass of the ribosome. The interface between the
30S and 50S subunits is primarily composed of rRNA. Ribosomal
proteins cluster on the outer surface of the ribosome and on the
periphery of the interface.
During bacterial translation, the mRNA lies on the surface
of the 30S subunit within a space between the 30S and 50S subunits.
As the polypeptide is being synthesized, it exits through
a channel within the 50S subunit (Figure 13.15c). Ribosomes
contain discrete sites where tRNAs bind and the polypeptide is
synthesized. In 1964, James Watson was the first to propose a
two-site model for tRNA binding to the ribosome. These sites are
known as the peptidyl site (P site) and aminoacyl site (A site).
In 1981, Knud Nierhaus, Hans Sternbach, and Hans-J örg Rheinberger
proposed a three-site model. This model incorporated the
observation that uncharged tRNA molecules can bind to a site on
the ribosome that is distinct from the P and A sites. This third
site is now known as the exit site (E site). The locations of the E,
P, and A sites are shown in Figure 13.15c. Next, we will examine
the roles of these sites during the three stages of translation.

Componentes de Ribosomal Subunidades Forma
Sites funcionais para Tradução
Para compreender a estrutura e função do ribossoma no
nível molecular, os pesquisadores devem determinar os locais e
papéis funcionais das proteínas ribossomais individuais e RNAs.
Nos últimos anos, muitos avanços foram feitos em direção a um molecular
compreensão dos ribossomos. Microscópica e biofísico
métodos têm sido utilizados para estudar a estrutura do ribossoma. Um elétron
micrografia de ribossomas bacterianos é mostrado na Figura 13.15a.
Mais recentemente, alguns grupos de pesquisa têm conseguido cristalizando
subunidades ribosomal, e até mesmo ribosomas intactos. Isto é um
incrível proeza técnica, porque é difícil encontrar o direito
condições sob as quais irão formar grandes macromoléculas altamente
cristais ordenados. Figura 13.15b mostra a estrutura de cristal
subunidades ribosomal bacterianas. A forma total de cada subunidade é
em grande parte determinada pela estrutura de rRNAs, as quais constituem
a maioria da massa do ribossoma. A interface entre o
30S e 50S subunidades é composto principalmente de rRNA. Ribosomal
proteínas aglomerar sobre a superfície exterior do ribossoma e no
periferia da interface.
Durante a tradução bacteriana, o mRNA está na superfície
da subunidade 30S dentro de um espaço entre os 30 e 50S subunidades.
À medida que o polipéptido está a ser sintetizado, que sai através
um canal dentro da subunidade 50S (Figura 13.15c). Ribossomos
conter locais discretos onde tRNAs ligamento e o polipeptídeo é
sintetizado. Em 1964, James Watson foi o primeiro a propor uma
modelo de dois locais para a ligação ao ribossomo tRNA. Estes sites são
conhecida como o local de peptidilo (local de P) e aminoacil local (sítio).
Em 1981, Knud Nierhaus, Hans Sternbach, e Hans-J Org Rheinberger
propôs um modelo de três site. Este modelo incorporado o
observação de que moléculas não carregadas de ARNt podem ligar-se a um sítio no
o ribossoma que é distinto dos locais P e A. Este terceiro
site é agora conhecido como o local de saída (local do E). As localizações dos E,
P, e A sítios são mostrados na Figura 13.15c. Em seguida, examinaremos
os papéis desses locais durante as três etapas de tradução.

13.4 STAGES OF TRANSLATION

Like transcription, the process of translation can be viewed as
occurring in three stages: initiation, elongation, and termination.
Figure 13.16 presents an overview of these stages. During initiation,
the ribosomal subunits, mRNA, and the first tRNA assemble
to form a complex. After the initiation complex is formed,
the ribosome slides along the mRNA in the 5ʹ to 3ʹ direction,
moving over the codons. This is the elongation stage of translation.
As the ribosome moves, tRNA molecules sequentially bind
to the mRNA at the A site in the ribosome, bringing with them
the appropriate amino acids. Therefore, amino acids are linked in
the order dictated by the codon sequence in the mRNA. Finally, a
stop codon is reached, signaling the termination of translation.
At this point, disassembly occurs, and the newly made polypeptide
is released. In this section, we will examine the components
required for the translation process and consider their functional
roles during the three stages of translation.
The Initiation Stage Involves the Binding of mRNA
and the Initiator tRNA to the Ribosomal Subunits
During initiation, an mRNA and the first tRNA bind to the ribosomal
subunits. A specific tRNA functions as the initiator tRNA,
which recognizes the start codon in the mRNA. In bacteria, the
initiator tRNA, which is also designated tRNAfMet, carries a methionine
that has been covalently modified to N-formylmethionine.
In this modification, a formyl group (—CHO) is attached to
the nitrogen atom in methionine after the methionine has been
attached to the tRNA. Figure 13.17 describes the initiation stage of translation
in bacteria during which the mRNA, tRNAfMet, and ribosomal
subunits associate with each other to form an initiation complex.
The formation of this complex requires the participation
of three initiation factors: IF1, IF2, and IF3. First, IF1 and IF3
bind to the 30S subunit. IF1 and IF3 prevent the association
of the 50S subunit. Next, the mRNA binds to the 30S subunit.
This binding is facilitated by a nine-nucleotide sequence within
the bacterial mRNA called the Shine-Dalgarno sequence. The
location of this sequence is shown in Figure 13.17 and in more
detail in Figure 13.18 . How does the Shine-Dalgarno sequence
facilitate the binding of mRNA to the ribosome? 

13.4 etapas de tradução

Como a transcrição, o processo de tradução pode ser visto como
ocorrendo em três etapas: iniciação, alongamento e terminação.
Figura 13.16 apresenta uma visão geral desses estágios. Durante a iniciação,
as subunidades ribossomais, ARNm, ARNt e os primeiros montar
para formar um complexo. Após o complexo de iniciação é formado,
ribossoma desliza ao longo do ARNm no sentido 5 'para 3',
movendo-se ao longo dos códons. Esta é a fase de elongação da tradução.
Como o ribossomo se move, tRNA moléculas se ligam sequencialmente
para o mRNA no um site da ribossoma, trazendo consigo
os aminoácidos apropriados. Portanto, os aminoácidos estão ligados em
a ordem determinada pela sequência codão no ARNm. Finalmente, uma
códon de parada é alcançado, sinalizando o término da tradução.
Neste ponto, ocorre a desmontagem, e o polipéptido feito recentemente
é libertado. Nesta seção, vamos examinar os componentes
requerido para o processo de tradução e considerar a sua funcional
papéis durante as três etapas de tradução.
A Iniciação Stage envolve a ligação de mRNA
e o iniciador de ARNt para as subunidades ribossomais
Durante a iniciação, um mRNA e tRNA a primeira ligação para o ribossômica
subunidades. Um ARNt funções específicas como o iniciador de ARNt,
que reconhece o codão de iniciação no ARNm. Em bactérias, o
tRNA iniciador, que também é designado tRNAfMet, carrega uma metionina
que foi covalentemente modificado a N-formilmetionina.
Nesta modificação, um grupo formilo (-CHO) está ligado a
o átomo de azoto em metionina após a metionina tem sido
ligado ao ARNt. Figura 13.17 descreve o estágio iniciação da tradução
em bactérias durante o qual o ARNm, tRNAfMet, e ribossomal
subunidades associar um com o outro para formar um complexo de iniciação.
A formação deste complexo requer a participação
de três fatores de iniciação: IF1, IF2, e IF3. Em primeiro lugar, IF1 e IF3
se ligam à subunidade 30S. IF1 e IF3 evitar a associação
da subunidade 50S. Em seguida, liga-se o ARNm para a subunidade 30S.
Esta ligação é facilitada por uma sequência de nove nucleótidos dentro
o ARNm bacteriano chamado a sequência de Shine-Dalgarno. o
localização desta sequência é apresentada na Figura 13,17 e em mais
detalhe na Figura 13.18. Como é que a sequência de Shine-Dalgarno
facilitar a ligação do ARNm ao ribossoma?

The Shine-
Dalgarno sequence is complementary to a short sequence within
the 16S rRNA, which promotes the hydrogen bonding of the
mRNA to the 30S subunit.
Next, tRNAfMet binds to the mRNA that is already attached
to the 30S subunit (see Figure 13.17). This step requires the function
of IF2, which uses GTP. The tRNAfMet binds to the start
encodes leucine), the first amino acid in the polypeptide is still
a formylmethionine because only a tRNAfMet can initiate translation.
During or after translation of the entire polypeptide, the
formyl group or the entire formylmethionine may be removed.
Therefore, some polypeptides may not have formylmethionine or
methionine as their first amino acid. As noted in Figure 13.17,
the tRNAfMet binds to the P site on the ribosome. IF1 is thought
to occupy a portion of the A site, thereby preventing the binding
of tRNAfMet to the A site during initiation. By comparison, during
the elongation stage that is discussed later, all of the other
tRNAs initially bind to the A site.
After the mRNA and tRNAfMet have become bound to the
30S subunit, IF1 and IF3 are released, and then IF2 hydrolyzes its
GTP and is also released. This allows the 50S ribosomal subunit
to associate with the 30S subunit. Much later, after translation is
completed, IF1 binding is necessary to dissociate the 50S and 30S
ribosomal subunits so that the 30S subunit can reinitiate with
another mRNA molecule.
In eukaryotes, the assembly of the initiation complex bears
similarities to that in bacteria. However, as described in Table
13.7 , additional factors are required for the initiation process.
Note that the initiation factors are designated eIF (for eukaryotic
Initiation Factor) to distinguish them from bacterial initiation
factors. The initiator tRNA in eukaryotes carries methionine
rather than formylmethionine, as in bacteria. A eukaryotic initiation
factor, eIF2, binds directly to tRNAMet to recruit it to the
40S subunit. Eukaryotic mRNAs do not have a Shine-Dalgarno
sequence. How then are eukaryotic mRNAs recognized by the
ribosome? The mRNA is recognized by eIF4, which is a multiprotein
complex that recognizes the 7-methylguanosine cap and
facilitates the binding of the mRNA to the 40S subunit.

O Shine-
Dalgarno é complementar a uma sequência dentro de curto
do rRNA 16S, que promove a ligação de hidrogénio do
ARNm para a subunidade 30S.
Em seguida, liga-se ao tRNAfMet ARNm que já está ligado
para a subunidade 30S (ver figura 13.17). Esta etapa requer a função
de IF2, que utiliza GTP. O ARNt fMet liga-se ao início
codifica a leucina), o primeiro aminoácido no polipéptido é ainda
um formilmetionina porque apenas uma tRNAfMet pode iniciar a tradução.
Durante ou após a tradução de todo o polipéptido, o
grupo formilo ou toda a formilmetionina pode ser removido.
Assim, alguns polipéptidos podem não ter ou formilmetionina
metionina como o primeiro aminoácido. Como observado na Figura 13,17,
o tRNAfMet liga-se ao local P no ribossoma. IF1 é pensado
para ocupar uma porção do local A, evitando, assim, a ligação
de tRNAfMet ao site A durante o início. Por comparação, durante
a fase de elongação que é discutido mais tarde, todos os outros
ARNt inicialmente ligar-se ao local A.
Após o mRNA e tRNAfMet se obrigaram à
30S subunidade, IF1 e IF3 são liberados e, em seguida hidrolisa sua IF2
GTP e também é liberado. Isto permite que as subunidade ribossomal 50S
para associar com a subunidade 30S. Muito mais tarde, após a tradução é
concluída, é necessário vinculativo IF1 dissociar 50S e 30S as
subunidades ribosomal para que a subunidade 30S pode reiniciar com
outra molécula de ARNm.
Em eucariotos, o conjunto dos ursos complexos de iniciação
semelhanças com que em bactérias. No entanto, tal como descrito na Tabela
13,7, factores adicionais são necessários para o processo de iniciação.
Note-se que os fatores de iniciação são designados eIF (para eucariótica
Fator de Iniciação) para distingui-los de iniciação bacteriana
factores. O tRNA iniciador em eucariotas carrega metionina
em vez de formilmetionina, como em bactérias. Uma iniciação eucariótico
factor de, eIF2, liga-se directamente ao tRNAMet para recrutar-lo para o
40S subunidade. MRNAs eucarióticos não tem uma Shine-Dalgarno
sequência. Como, então, mRNAs eucarióticos reconhecido pelo
ribossomo? O ARNm é reconhecido por eIF4, que é um multiproteico
complexo que reconhece a tampa 7-metilguanosina e
facilita a ligação do mRNA à subunidade 40S.


The identification of the correct AUG start codon in
eukaryotes differs greatly from that in bacteria. After the initial
binding of mRNA to the ribosome, the next step is to locate an
AUG start codon that is somewhere downstream from the 5ʹ cap
structure. In 1986, Marilyn Kozak proposed that the ribosome
begins at the 5ʹ end and then scans along the mRNA in the 3ʹ
direction in search of an AUG start codon. In many, but not all,
cases, the ribosome uses the first AUG codon that it encounters
as a start codon. When a start codon is identified, the 60S subunit
assembles onto the 40S subunit with the aid of eIF5.
By analyzing the sequences of many eukaryotic mRNAs,
researchers have found that not all AUG codons near the 5ʹ end
of mRNA can function as start codons. In some cases, the scanning
ribosome passes over the first AUG codon and chooses an
AUG farther down the mRNA. The sequence of bases around the
AUG codon plays an important role in determining whether or
not it is selected as the start codon by a scanning ribosome. The
consensus sequence for optimal start codon recognition in more
complex eukaryotes, such as vertebrates and vascular plants, is
shown here. Aside from an AUG codon itself, a guanine at the +4 position
and a purine, preferably an adenine, at the –3 position are
the most important sites for start codon selection. These rules for
optimal translation initiation are called Kozak’s rules.

A identificação correcta do codão de iniciação de agosto de
eucariotas difere grandemente do que em bactérias. Após o inicial
ligação do ARNm ao ribossoma, o próximo passo é o de localizar um
Agosto codão que está em algum lugar a jusante do cap 5 '
estrutura. Em 1986, Marilyn Kozak propôs que o ribossomo
começa na extremidade 5 'e, em seguida, verifica ao longo do ARNm no 3'
direção em busca de uma agosto códon de iniciação. Em muitos, mas não todos,
casos, o ribossoma utiliza o primeiro codão AUG que ele encontra
como um codão de iniciação. Quando um códon de início é identificado, o 60S da subunidade
monta para a subunidade 40S com o auxílio de eIF5.
Ao analisar as sequências de muitos mRNAs eucarióticos,
investigadores descobriram que nem todos os codões AUG perto da extremidade 5'
do ARNm podem funcionar como codões de iniciação. Em alguns casos, a digitalização
ribossoma passa sobre o primeiro codão AUG e um escolhe
Agosto mais abaixo do mRNA. A sequência de bases de todo o
Codão AUG desempenha um papel importante ao determinar se ou
não é selecionado como o codão por um ribossomo digitalização. o
sequência de consenso para o arranque ótima códon reconhecimento em mais
eucariotos complexos, tais como vertebrados e plantas vasculares, é
mostrado aqui. Além de um codão AUG em si, uma guanina na posição 4
e uma purina, de preferência, uma adenina, na posição -3 está
os locais mais importantes para a seleção códon de iniciação. Estas regras para
iniciação da tradução ideal são chamados regras de Kozak.

Polypeptide Synthesis Occurs
During the Elongation Stage

During the elongation stage of translation, amino acids are
added, one at a time, to the polypeptide chain (Figure 13.19 ).
Even though this process is rather complex, it occurs at a remarkable
rate. Under normal cellular conditions, a polypeptide chain
can elongate at a rate of 15 to 20 amino acids per second in bacteria
and 2 to 6 amino acids per second in eukaryotes!
To begin elongation, a charged tRNA brings a new amino
acid to the ribosome so it can be attached to the end of the
growing polypeptide chain. At the top of Figure 13.19, which
describes bacterial translation, a short polypeptide is attached to
the tRNA located at the P site of the ribosome. A charged tRNA
carrying a single amino acid binds to the A site. This binding
occurs because the anticodon in the tRNA is complementary to
the codon in the mRNA. The hydrolysis of GTP by the elongation
factor, EF-Tu, provides energy for the binding of a tRNA to
the A site. In addition, the 16S rRNA, which is a component of
the small 30S ribosomal subunit, plays a key role that ensures the
proper recognition between the mRNA and correct tRNA. The
16S rRNA can detect when an incorrect tRNA is bound at the
A site and will prevent elongation until the mispaired tRNA is
released from the A site. This phenomenon, termed the decoding
function of the ribosome, is important in maintaining high
fidelity of mRNA translation. An incorrect amino acid is incorporated
into a growing polypeptide at a rate of approximately
one mistake per 10,000 amino acids, or 10–4.

Polypeptide Síntese Ocorre
Durante a Fase Alongamento

Durante a fase de elongação da tradução, os aminoácidos são
adicionado, um de cada vez, para a cadeia polipeptídica (figura 13.19).
Mesmo que este processo é bastante complexo, que ocorra com uma notável
taxa. Sob condições celulares normais, uma cadeia polipeptídica
pode alongar a uma taxa de 15 a 20 aminoácidos por segundo em bactérias
e 2 a 6 aminoácidos por segundo em eucariotas!
Para começar o alongamento, um ARNt carregada traz uma nova amino
ácido ao ribossoma de modo que pode ser ligada à extremidade do
cadeia polipeptídica em crescimento. Na parte superior da figura 13.19, que
descreve tradução bacteriana, um curto polipéptido é ligado a
o ARNt localizado no local P do ribossoma. Um ARNt carregada
transportando um único aminoácido liga-se ao site A. Esta ligação
ocorre porque o anticodão do ARNt em é complementar
o codão no ARNm. A hidrólise de GTP por o alongamento
factor EF-Tu, fornece energia para a ligação de um ARNt de
o site A. Além disso, o rRNA 16S, que é um componente de
a subunidade ribossomal 30S pequenas, desempenha um papel fundamental que assegura o
reconhecimento adequado entre o mRNA e tRNA correta. o
16S rRNA pode detectar quando um ARNt incorrecto é ligado na
Um site e vai impedir que o alongamento até o tRNA é mispaired
liberada a partir do site A. Esse fenômeno, chamado de decodificação
função do ribossoma, é importante na manutenção de alta
fidelidade de tradução do mRNA. Um aminoácido é incorporado incorreto
num polipéptido a crescer a uma taxa de aproximadamente
um erro por 10.000 aminoácidos, ou 10-4.

The next step of elongation is the peptidyl transfer reaction—
the polypeptide is removed from the tRNA in the P site
and transferred to the amino acid at the A site. This transfer is
accompanied by the formation of a peptide bond between the
amino acid at the A site and the polypeptide chain, lengthening
the chain by one amino acid. The peptidyl transfer reaction is
catalyzed by a component of the 50S subunit known as peptidyl
transferase, which is composed of several proteins and rRNA.
Interestingly, based on the crystal structure of the 50S subunit,
Thomas Steitz, Peter Moore, and their colleagues concluded that
the 23S rRNA—not the ribosomal protein—catalyzes bond formation
between adjacent amino acids. In other words, the ribosome
is a ribozyme!
After the peptidyl transfer reaction is complete, the ribosome
moves, or translocates, to the next codon in the mRNA.
This moves the tRNAs at the P and A sites to the E and P sites,
respectively. Finally, the uncharged tRNA exits the E site. You
should notice that the next codon in the mRNA is now exposed
in the unoccupied A site. At this point, a charged tRNA can enter
the empty A site, and the same series of steps can add the next
amino acid to the polypeptide chain. As you may have realized, the
A, P, and E sites are named for the role of the tRNA that is usually
found there. The A site binds an aminoacyl-tRNA (also called
a charged tRNA), the P site usually contains the peptidyl-tRNA
(a tRNA with an attached peptide), and the E site is where the
uncharged tRNA exits.

O próximo passo de alongamento é a transferência de peptidilo reação-
o polipéptido é removido a partir do ARNt no local P
e transferida para o aminoácido no local Uma. Esta transferência é
acompanhada pela formação de uma ligação peptídica entre o
aminoácido no sítio A e a cadeia polipeptídica, alongando
a cadeia de um aminoácido. A reacção de transferência de peptidilo está
catalisada por um componente da subunidade 50S conhecido como peptidilo
transferase, que é composto por várias proteínas e ARNr.
Curiosamente, com base na estrutura de cristal da subunidade 50S,
Thomas Steitz, Peter Moore, e os seus colegas concluíram que
do rRNA 23S-não a proteína ribossómica-catalisa a formação da ligação
entre os aminoácidos adjacentes. Em outras palavras, o ribossoma
é uma ribozima!
Após a reacção de transferência de peptidilo está completa, o ribossoma
move-se, ou, se transloca para o próximo codão no ARNm.
Isto move o ARNt na P e A sites para a sítios E e P,
respectivamente. Finalmente, o ARNt descarregada sai do local do E. Vocês
deve notar que o próximo códon no mRNA está agora exposta
na desocupado Um site. Neste ponto, um ARNt carregada pode entrar
o vazio Um site, e da mesma série de passos pode adicionar a próxima
de aminoácidos para a cadeia polipeptídica. Como você deve ter percebido, o
Um, sítios P, e E são nomeados para o papel do ARNt que é geralmente
encontrado lá. O Um local de liga uma aminoacil-ARNt (também chamada
um tRNA carregado), o sítio P geralmente contém o peptidil-ARNt
(um ARNt com um péptido ligado), e o local onde E é a
uncharged tRNA sai.

Termination Occurs When a Stop Codon
Is Reached in the mRNA
The final stage of translation, known as termination, occurs when
a stop codon is reached in the mRNA. In most species, the three
stop codons are UAA, UAG, and UGA. The stop codons are not
recognized by a tRNA with a complementary sequence. Instead,
they are recognized by proteins known as release factors (see
Table 13.7). Interestingly, the three-dimensional structures of
release factor proteins are “molecular mimics” that resemble the
structure of tRNAs. Such proteins can specifically bind to a stop
codon sequence. In bacteria, RF1 recognizes UAA and UAG, and
RF2 recognizes UGA and UAA. A third release factor, RF3, is also
required. In eukaryotes, a single release factor, eRF, recognizes all
three stop codons and eRF3 is also required for termination.
Figure 13.20 illustrates the termination stage of translation
in bacteria. At the top of this figure, the completed polypeptide
chain is attached to a tRNA in the P site. A stop codon is located
at the A site. In the first step, RF1 or RF2 binds to the stop codon
at the A site and RF3 (not shown) binds at a different location
on the ribosome. After RF1 (or RF2) and RF3 have bound, the
bond between the polypeptide and the tRNA is hydrolyzed.
The polypeptide and tRNA are then released from the ribosome.
The final step in translational termination is the disassembly of
ribosomal subunits, mRNA, and the release factors.

Rescisão ocorre quando um Codon de parada
É alcançado no mRNA
A fase final de tradução, conhecido como terminação, ocorre quando
um codão de terminação é atingido no ARNm. Na maioria das espécies, a três
parar codões são UAA, UAG, e UGA. Os codões de paragem não são
reconhecido por um ARNt com uma sequência complementar. Ao invés,
eles são reconhecidos por proteínas conhecidas como fatores de liberação (ver
Tabela 13.7). Estruturas Curiosamente, as tridimensionais de
proteínas de fator de liberação são "imita" moleculares que se assemelham a
estrutura de ARNt. Tais proteínas podem ligar-se especificamente a uma paragem
sequência de codões. Em bactérias, RF1 reconhece UAA e UAG, e
RF2 reconhece UGA e UAA. Um fator de liberação terceiro, RF3, é também
requeridos. Em eucariotas, um fator de lançamento do single, eRF, reconhece tudo
três códons de parada e eRF3 também é necessária para a terminação.
Figura 13.20 ilustra a fase de terminação da tradução
em bactérias. No topo desta figura, o polipéptido concluída
cadeia está ligado a um ARNt no local P. Um codão de paragem está localizado
Uma no local. No primeiro passo, RF1 ou RF2 liga-se ao codão de paragem
no sítio A e RF3 (não mostrado) se liga a um local diferente
no ribossoma. Depois RF1 (ou RF2) e RF3 ter ligado, o
ligação entre o polipéptido e o ARNt é hidrolisado.
O polipéptido e tRNA são depois libertadas a partir do ribossoma.
O passo final é a terminação da tradução da desmontagem
subunidades ribossomais, mRNA, e os fatores de liberação.


Bacterial Translation Can Begin
Before Transcription Is Completed
Although most of our knowledge concerning transcription and
translation has come from genetic and biochemical studies, electron
microscopy (EM) has also been an important tool in elucidating
the mechanisms of transcription and translation. As
described earlier in this chapter, EM has been a critical technique
in facilitating our understanding of ribosome structure. In addition,
it has been employed to visualize genetic processes such as
translation.
The first success in the EM observation of gene expression
was achieved by Oscar Miller, Jr., and his colleagues in 1967. Figure
13.21 shows an electron micrograph of a bacterial gene in
the act of gene expression. Prior to this experiment, biochemical
and genetic studies had suggested that the translation of a bacterial
structural gene begins before the mRNA transcript is completed.
In other words, as soon as an mRNA strand is long enough,
a ribosome attaches to the 5ʹ end and begins translation, even
before RNA polymerase has reached the transcriptional termination
site within the gene. This phenomenon is termed the coupling
between transcription and translation in bacterial cells. Note that
coupling of these processes does not usually occur in eukaryotes,
because transcription takes place in the nucleus while translation
occurs in the cytosol.
As shown in Figure 13.21, several RNA polymerase enzymes
have recognized a gene and begun to transcribe it. Because the
transcripts on the right side are longer than those on the left,
Miller concluded that transcription was proceeding from left to
right in the micrograph. This EM image also shows the process
of translation. Relatively small mRNA transcripts, near the left
side of the figure, have a few ribosomes attached to them. As the
transcripts become longer, additional ribosomes are attached to
them. The term polyribosome, or polysome, is used to describe
an mRNA transcript that has many bound ribosomes in the act of
translation. In this electron micrograph, the nascent polypeptide
chains were too small for researchers to observe. In later studies,
as EM techniques became more refined, the polypeptide chains
emerging from the ribosome were also visible (see Figure 13.15a).

Tradução bacteriana pode começar
Antes de transcrição é concluída
Embora a maior parte de nosso conhecimento sobre a transcrição e
tradução veio de genética e estudos bioquímicos, elétron
microscopia (EM) também tem sido uma importante ferramenta na elucidação
os mecanismos de transcrição e tradução. Como
descrito anteriormente neste capítulo, EM tem sido uma técnica crítica
para facilitar nossa compreensão da estrutura do ribossoma. Além,
tem sido utilizada para visualizar processos genéticos tais como
tradução.
O primeiro sucesso na observação da expressão do gene EM
foi conseguida por Oscar Miller, Jr., e seus colegas em 1967. Figura
13,21 mostra uma micrografia electrónica de um gene bacteriano em
o ato de expressão do gene. Antes desta experiência, bioquímica
e estudos genéticos tinha sugerido que a tradução de uma bacteriana
gene estrutural começa antes do transcrito de ARNm é concluída.
Em outras palavras, assim que uma cadeia de ARNm é suficientemente longo,
um ribossomo atribui à extremidade 5 'e começa a tradução, mesmo
antes de ARN polimerase atingiu a terminação da transcrição
local no interior do gene. Este fenómeno é denominado o acoplamento
entre transcrição e tradução em células bacterianas. Observe que
acoplamento destes processos geralmente não ocorrem em eucariotas,
porque a transcrição ocorre no núcleo, enquanto tradução
ocorre no citosol.
Como mostrado na figura 13.21, vários RNA enzimas polimerases
ter reconhecido um gene e começaram a transcrevê-lo. Porque o
transcrições do lado direito são mais longos que os de esquerda,
Miller concluiu que a transcrição estava a decorrer a partir da esquerda para
direito na micrografia. Esta imagem EM também mostra o processo de
de tradução. Relativamente pequenas transcritos de ARNm, perto da esquerda
lado da figura, temos alguns ribossomos ligados a eles. Como o
transcritos se tornam mais longos, ribossomos adicionais estão ligados a
eles. O termo polyribosome, ou polissoma, é usado para descrever
uma transcrição do mRNA que tem muitos ribossomos ligados no ato de
tradução. Nesta micrografia eletrônica, o polipeptídeo nascente
cadeias foram pequeno demais para pesquisadores observar. Em estudos posteriores,
como técnicas de EM tornou-se mais refinada, as cadeias polipeptídicas
que emerge do ribossoma também eram visíveis (ver Figura 13.15a).

Bacterial and Eukaryotic Translation
Show Similarities and Differences

Throughout this chapter, we have compared translation in both
bacteria and eukaryotic organisms. The general steps of translation
are similar in all forms of life, but we have also seen some striking
differences between bacteria and eukaryotes. Table 13.8 compares
translation between these groups.


Tradução bacteriana e Eukaryotic
Mostrar Semelhanças e Diferenças

Ao longo deste capítulo, temos comparado tradução em ambos
bactérias e organismos eucarióticos. Os passos gerais de tradução
são semelhantes em todas as formas de vida, mas também vimos alguns impressionante
diferenças entre bactérias e eucariotas. Tabela 13.8 compara
tradução entre estes grupos.

GENE REGULATION
IN BACTERIA AND
BACTERIOPHAGES

14
CHAPTER OUTLINE
14.1 Transcriptional Regulation
14.2 Translational and Posttranslational
Regulation
14.3 Riboswitches
14.4 Gene Regulation in the Bacteriophage
Reproductive Cycle

A model showing the binding of a genetic regulatory protein to DNA,
which results in a DNA loop. The model shown here involves the lac repressor
protein found in E. coli binding to the operator site in the lac operon.
Chromosomes of bacteria, such as Escherichia coli, contain a few
thousand different genes. Gene regulation is the phenomenon in
which the level of gene expression can vary under different conditions.
In comparison, unregulated genes have essentially constant
levels of expression in all conditions over time. Unregulated
genes are also called constitutive genes. Frequently, constitutive
genes encode proteins that are continuously needed for the
survival of the bacterium. In contrast, the majority of genes are
regulated so that the proteins they encode can be produced at the
proper times and in the proper amounts.
A key benefit of gene regulation is that the encoded proteins
are produced only when they are required. Therefore, the cell
avoids wasting valuable energy making proteins it does not need.
From the viewpoint of natural selection, this enables an organism
such as a bacterium to compete as efficiently as possible for limited
resources. Gene regulation is particularly important because
bacteria exist in an environment that is frequently changing with
regard to temperature, nutrients, and many other factors. The following
are a few common processes regulated at the genetic level:

GENE REGULAMENTO
Em bactérias e
BACTERIÓFAGOS

14
DO CAPÍTULO
14.1 Regulação transcricional
14,2 Translational e pós-tradução
Regulamento
14.3 riboswitches
14,4 Gene regulamento no Bacteriophage
Ciclo reprodutivo

Um modelo que mostra a ligação de uma proteína de regulação genética de ADN,
o que resulta em um loop de DNA. O modelo mostrado aqui envolve o repressor lac
proteína encontrada em E. coli de ligação para o local de operador do operão lac em.
Os cromossomas de bactérias, tais como Escherichia coli, conter alguns
mil genes diferentes. Regulação do gene é o fenômeno em
que o nível de expressão do gene pode variar em diferentes condições.
Em comparação, os genes não regulados têm essencialmente constante
os níveis de expressão em todas as condições longo do tempo. Não regulado
genes também são chamados genes constitutivos. Freqüentemente, constitutiva
genes codificam proteínas que são necessários para a continuamente
a sobrevivência da bactéria. Em contraste, a maioria dos genes são
regulada de modo que as proteínas que eles codificam pode ser produzido no
tempos apropriados e nas quantidades apropriadas.
Um dos principais benefícios da regulação gênica é que as proteínas codificadas
são produzidos apenas quando eles são necessários. Por conseguinte, a célula
evita o desperdício de proteínas valiosas de energia tornando-o não precisa.
Do ponto de vista da seleção natural, isso permite que um organismo
tal como uma bactéria para competir de forma tão eficiente quanto possível, para limitar
recursos. Regulação do gene é particularmente importante porque
bactérias existem em um ambiente que está mudando com frequência
relação à temperatura, nutrientes, e muitos outros factores. Os seguintes
alguns processos comuns regulados no nível genético:


1. Metabolism: Some proteins function in the metabolism of
small molecules. For example, certain enzymes are needed
for a bacterium to metabolize particular sugars. These
enzymes are required only when the bacterium is exposed
to such sugars in its environment.
2. Response to environmental stress: Certain proteins help a
bacterium to survive environmental stress such as osmotic
shock or heat shock. These proteins are required only when
the bacterium is confronted with the stress.
3. Cell division: Some proteins are needed for cell division.
These are necessary only when the bacterial cell is getting
ready to divide.
The expression of structural genes, which encode polypeptides,
ultimately leads to the production of functional cellular proteins.
As we saw in Chapters 12 and 13 , gene expression is a multistep
process that proceeds from transcription to translation, and
it may involve posttranslational effects on protein structure and
function. As shown in Figure 14.1 , gene regulation can occur at
any of these steps in the pathway of gene expression. In this chapter,
we will examine the molecular mechanisms that account for
these types of gene regulation.

14.1 TRANSCRIPTIONAL REGULATION

In bacteria, the most common way to regulate gene expression
is by influencing the rate at which transcription is initiated.
Although we frequently refer to genes as being “turned on or
off,” it is more accurate to say that the level of gene expression is
increased or decreased. At the level of transcription, this means
that the rate of RNA synthesis can be increased or decreased.
In most cases, transcriptional regulation involves the
actions of regulatory proteins that can bind to the DNA and
affect the rate of transcription of one or more nearby genes.

1. Metabolismo: Algumas proteínas funcionam no metabolismo de
moléculas pequenas. Por exemplo, são necessárias certas enzimas
para uma bactéria de metabolizar açúcares particulares. Estes
enzimas são necessárias apenas quando a bactéria é exposta
a esses açúcares, no seu ambiente.
2. A resposta ao estresse ambiental: Certas proteínas ajudam a
bactéria sobreviver stress ambiental, tais como osmótica
choque ou choque térmico. Estas proteínas apenas quando são necessários
a bactéria é confrontado com o stress.
3. A divisão celular: Algumas proteínas são necessárias para a divisão celular.
Estes são necessários apenas quando a célula bacteriana está ficando
pronto para dividir.
A expressão de genes estruturais que codificam polipéptidos,
em última análise conduz à produção de proteínas celulares funcionais.
Como vimos nos capítulos 12 e 13, a expressão genética é uma de várias etapas
processo que procede da transcrição da tradução, e
pode envolver efeitos pós-translacionais sobre a estrutura da proteína e
função. Como mostrado na Figura 14.1, a regulação do gene pode ocorrer em
qualquer um destes passos na via da expressão do gene. Neste capítulo,
vamos examinar os mecanismos moleculares que são responsáveis ​​por
estes tipos de regulação gênica.

14,1 regulação transcricional

Em bactérias, o modo mais comum para regular a expressão do gene
é por influenciar a taxa à qual a transcrição é iniciada.
Embora nós freqüentemente se referem aos genes como sendo "ligada ou
off ", é mais preciso dizer que o nível de expressão do gene é
aumentada ou diminuída. Ao nível da transcrição, isto significa
que a taxa de síntese de ARN pode ser aumentada ou diminuída.
Na maioria dos casos, a regulação da transcrição envolve
acções de proteínas reguladoras que se podem ligar ao DNA e
afectar a taxa de transcrição de um ou mais genes próximos.



Two
types of regulatory proteins are common. A repressor is a regulatory
protein that binds to the DNA and inhibits transcription,
whereas an activator is a regulatory protein that increases the
rate of transcription. Transcriptional regulation by a repressor
protein is termed negative control, and regulation by an activator
protein is considered to be positive control. In conjunction with regulatory proteins, small effector
molecules often play a critical role in transcriptional regulation.
However, small effector molecules do not bind directly to the
DNA to alter transcription. Rather, an effector molecule exerts its
effects by binding to an activator or repressor. The binding of the
effector molecule causes a conformational change in the regulatory
protein and thereby influences whether or not the protein
can bind to the DNA. Genetic regulatory proteins that respond
to small effector molecules have two functional domains. One
domain is a site where the protein binds to the DNA; the other
domain is the binding site for the effector molecule.
Regulatory proteins are given names describing how they
affect transcription when they are bound to the DNA (repressor
or activator). In contrast, small effector molecules are given
names that describe how they affect transcription when they
are present in the cell at a sufficient concentration to exert their
effect (Figure 14.2 ). An inducer is a small effector molecule that
causes transcription to increase. An inducer may accomplish this
in two ways: It could bind to a repressor protein and prevent it
from binding to the DNA, or it could bind to an activator protein
and cause it to bind to the DNA. In either case, the transcription
rate is increased. Genes that are regulated in this manner are
called inducible genes.

Dois
tipos de proteínas reguladoras são comuns. Um repressor é um regulador
proteína que se liga ao ADN e inibe a transcrição,
Considerando que um activador é uma proteína reguladora que aumenta o
taxa de transcrição. A regulação da transcrição por um repressor
proteína é denominada controle negativo, e regulação por um activador
proteína é considerada como controlo positivo. Em conjunto com as proteínas reguladoras, pequena efectora
moléculas muitas vezes desempenham um papel crítico na regulação da transcrição.
No entanto, pequenas moléculas efectoras não se ligam directamente ao
DNA para alterar a transcrição. Pelo contrário, uma molécula efectora exerce a sua
efeitos através da ligação a um activador ou repressor. A ligação do
molécula efectora provoca uma alteração conformacional no regulador
proteínas e, assim influências se ou não a proteínas
pode ligar-se ao ADN. Proteínas reguladoras que respondem genéticos
para pequenas moléculas efectoras têm dois domínios funcionais. Um
domínio é um local onde a proteína se liga ao ADN; o outro
domínio é o sítio de ligação para a molécula efectora.
Proteínas reguladoras são dados nomes descrevendo como eles
afectar a transcrição quando se encontram ligados ao ADN (repressor
ou activador). Em contraste, pequenas moléculas efectoras são dadas
nomes que descrevem como eles afetam a transcrição quando eles
estão presentes na célula, a uma concentração suficiente para exercer a sua
efeito (Figura 14.2). Um indutor é uma pequena molécula que efectora
faz com que a transcrição a aumentar. Um indutor pode alcançar este
de duas maneiras: Pode ligar-se a uma proteína repressora e impedi-lo
de ligação ao ADN, ou pode ligar-se a uma proteína activadora
e fazer com que se liguem ao ADN. Em ambos os casos, a transcrição
taxa é aumentada. Genes que são regulados desta forma são
chamados genes induzíveis.

Alternatively, the presence of a small effector molecule
may inhibit transcription. This can also occur in two ways. A
corepressor is a small molecule that binds to a repressor protein,
thereby causing the protein to bind to the DNA. An inhibitor
binds to an activator protein and prevents it from binding to
the DNA. Both corepressors and inhibitors act to reduce the rate
of transcription. Therefore, the genes they regulate are termed
repressible genes. Unfortunately, this terminology can be confusing
because a repressible system could involve an activator
protein, or an inducible system could involve a repressor protein.
In this section, we will examine several examples in which
genes are regulated by the actions of genetic regulatory proteins
that influence the rate of transcription. We will see how gene
regulation provides an efficient way for bacteria to synthesize
proteins.
The Phenomenon of Enzyme Adaptation
Is Due to the Synthesis of Cellular Proteins
Our initial understanding of gene regulation can be traced back
to the creative minds of François Jacob and Jacques Monod at
the Pasteur Institute in Paris, France. Their research into genes
and gene regulation stemmed from an interest in the phenomenon
known as enzyme adaptation, which had been identified
at the turn of the twentieth century. Enzyme adaptation refers to
the observation that a particular enzyme appears within a living
cell only after the cell has been exposed to the substrate for that
enzyme. When a bacterium is not exposed to a particular substance,
it does not make the enzymes needed to metabolize that
substance.
To investigate this phenomenon, Jacob and Monod focused
their attention on lactose metabolism in E. coli. Key experimental
observations that led to an understanding of this genetic system
are listed here.

Alternativamente, a presença de uma pequena molécula efectora
pode inibir a transcrição. Isto também pode ocorrer em duas formas. UMA
repressor é uma pequena molécula que se liga a uma proteína repressora,
fazendo assim com que a proteína de se ligar ao ADN. Um inibidor
liga-se a um activador de proteína e impede-o de se ligar a
o ADN. Ambos os co-repressores e inibidores actuam para reduzir a taxa
de transcrição. Portanto, os genes que eles regulam são denominados
genes reprimível. Infelizmente, essa terminologia pode ser confusa
porque um sistema reprimível pode envolver um activador
proteína, ou um sistema indutível pode envolver uma proteína repressora.
Nesta seção, vamos examinar vários exemplos em que
genes são regulados pelas ações de proteínas reguladoras genéticos
que influenciam a taxa de transcrição. Vamos ver como gene
regulamentação fornece uma maneira eficiente para que as bactérias sintetizam
proteínas.
O fenômeno da enzima Adaptação
É devido à síntese de proteínas celulares
Nosso entendimento inicial de regulação do gene pode ser rastreada
para as mentes criativas de François Jacob e Jacques Monod em
do Instituto Pasteur em Paris, França. Sua pesquisa em genes
e regulação do gene resultou de um interesse no fenômeno
conhecida como enzima de adaptação, que tinha sido identificado
na virada do século XX. Refere-se a adaptação da enzima
a observação de que uma enzima particular aparece dentro de uma sala
células apenas depois de a célula ter sido exposta ao substrato para esse
enzima. Quando uma bactéria não é exposto a uma substância em particular,
não faz as enzimas necessárias para metabolizar que
substância.
Para investigar esse fenômeno, Jacob e Monod focado
a sua atenção sobre o metabolismo da lactose em E. coli. Key experimental
observações que conduziram a uma compreensão deste sistema genético
estão listados aqui.


1. The exposure of bacterial cells to lactose increased the
levels of lactose-utilizing enzymes by 1000- to 10,000-fold.
2. Antibody and labeling techniques revealed that the
increase in the activity of these enzymes was due to the
increased synthesis of the enzymes.
3. The removal of lactose from the environment caused an
abrupt termination in the synthesis of the enzymes.
4. Mutations that prevented the synthesis of a particular
protein involved in lactose utilization showed that a
separate gene encoded each protein.

These critical observations indicated to Jacob and Monod that
enzyme adaptation is due to the synthesis of specific cellular
proteins in response to lactose in the environment. Next, we will
examine how Jacob and Monod discovered that this phenomenon
is due to the interactions between genetic regulatory proteins
and small effector molecules. In other words, we will see
that enzyme adaptation is due to the transcriptional regulation
of genes.
The lac Operon Encodes Proteins Involved
in Lactose Metabolism
In bacteria, it is common for a few genes to be arranged together
in an operon—a group of two or more genes under the transcriptional
control of a single promoter. An operon encodes a
polycistronic RNA, an RNA that contains the sequences for two
or more genes. Why do operons occur in bacteria? One biological
advantage of an operon organization is that it allows a bacterium
to coordinately regulate a group of two or more genes
that are involved with a common functional goal; the expression
of the genes occurs as a single unit. For transcription to take
place, an operon is flanked by a promoter that signals the beginning
of transcription and a terminator that specifies the end of
transcription. Two or more genes are found between these two
sequences. Figure 14.3a shows the organization of the genes involved
in lactose utilization and their transcriptional regulation. Two
distinct transcriptional units are present.

1. A exposição de células bacterianas para o aumento da lactose
os níveis de enzimas que utilizam lactose por 1000- para 10.000 vezes.
2. Técnicas de anticorpo e de rotulagem revelou que o
aumento da actividade destas enzimas foi devido ao
aumento da síntese das enzimas.
3. A remoção da lactose do ambiente causado um
cessação abrupta da síntese das enzimas.
4. As mutações que impediram a síntese de uma determinada
proteína envolvida na utilização de lactose mostrou que um
gene separado codificado cada proteína.

Estas observações críticas indicadas para Jacob e Monod que
adaptação enzima é devido à síntese de celular específica
proteínas em resposta à lactose no meio ambiente. Em seguida, vamos
examinar como Jacob e Monod descobriu que este fenómeno
é devido às interacções entre as proteínas reguladoras genéticos
e pequenas moléculas efectoras. Em outras palavras, vamos ver
que a adaptação da enzima é devida à regulação da transcrição
de genes.
Os Operon lac codifica as proteínas envolvidas
Lactose em Metabolismo
Em bactérias, é comum para alguns genes para ser dispostas juntas
em-um operão grupo de dois ou mais genes sob o transcricional
controlo de um único promotor. Um codifica um operão
ARN policistrónico, um ARN que contém as sequências de dois
ou mais genes. Por que operons ocorrer em bactérias? Uma biológica
vantagem de uma organização operão é que ele permite uma bactéria
para regular coordenadamente um grupo de dois ou mais genes
que estão envolvidos com um objetivo funcional comum; a expressão
dos genes ocorre como uma única unidade. Para transcrição de tomar
lugar, um operão é flanqueado por um promotor que sinaliza o início
de transcrição e um terminador que especifica o fim de
transcrição. Dois ou mais genes encontram-se entre estes dois
sequências. Figura 14.3a mostra a organização dos genes envolvidos
na utilização de lactose e a sua regulação da transcrição. Dois
unidades de transcrição distintos estão presentes.

 The first unit, known
as the lac operon, contains a CAP site; promoter (lacP); operator
site (lacO); three structural genes, lacZ, lacY, and lacA; and a
terminator. LacZ encodes the enzyme β-galactosidase, an enzyme
that cleaves lactose into galactose and glucose. As a side reaction,
β-galactosidase also converts a small percentage of lactose into
allolactose, a structurally similar sugar (Figure 14.3b). As we will
see later, allolactose acts as a small effector molecule to regulate
the lac operon. The lacY gene encodes lactose permease, a membrane
protein required for the active transport of lactose into the
cytoplasm of the bacterium. The lacA gene encodes galactoside
transacetylase, an enzyme that covalently modifies lactose and
lactose analogs . Although the functional necessity of the transacetylase
remains unclear, the acetylation of nonmetabolizable
lactose analogs may prevent their toxic buildup within the bacterial
cytoplasm.
The CAP site and the operator site are short DNA segments
that function in gene regulation. The CAP site is a DNA
sequence recognized by an activator protein called the catabolite
activator protein (CAP). The operator site (also known simply
as the operator) is a sequence of bases that provides a binding
site for a repressor protein. A second transcriptional unit involved in genetic regulation
is the lacI gene (see Figure 14.3a), which is not part of the
lac operon. The lacI gene, which is constitutively expressed at
fairly low levels, has its own promoter, the i promoter. The lacI
gene encodes the lac repressor, a protein that is important for
the regulation of the lac operon. The lac repressor functions as
a homotetramer, a protein composed of four identical subunits.
The amount of lac repressor made is approximately 10 homotetramer
proteins per cell. Only a small amount of the lac repressor
protein is needed to repress the lac operon.

A primeira unidade, conhecido
como o operão lac, contém um sítio CAP; promotor (LACP); operador
local (lacO); três genes estruturais, lacZ, laçado, e laca; e um
Exterminador do Futuro. LacZ codifica a enzima β-galactosidase, uma enzima
que cliva lactose em galactose e glicose. Como uma reacção lateral,
β-galactosidase também converte uma pequena percentagem da lactose em
alolactose, um açúcar estruturalmente semelhante (Figura 14.3b). Como vamos
ver mais tarde, alolactose actua como uma pequena molécula efectora para regular
o operão lac. O gene codifica Lacy permease lactose, uma membrana
proteína necessária para o transporte activo de lactose para o
citoplasma da bactéria. O gene codifica lacA galactósido
transacetilase, uma enzima que modifica covalentemente a lactose e
análogos de lactose. Embora a necessidade funcional da transacetilase
permanece incerto, a acetilação da não metabolizável
análogos de glicose podem impedir a sua acumulação de toxinas no bacteriana
citoplasma.
O site da PAC e do local do operador são curtos segmentos de DNA
essa função na regulação dos genes. O site PAC é um DNA
sequência reconhecida por uma proteína activadora catabólica a chamada
activador de proteína (PAC). O local do operador (também conhecido simplesmente
como o operador) é uma sequência de bases que fornece uma ligação
local para uma proteína repressora. Uma segunda unidade de transcrição envolvidos na regulação genética
é o gene lacl (ver Figura 14.3a), que não faz parte do
operon lac. O gene lacl, que é constitutivamente expressa em
níveis bastante baixos, tem o seu próprio promotor, o promotor i. O lacl
gene codifica o repressor lac, uma proteína que é importante para
a regulação do operon lac. As funções como repressor lac
um homotetrâmero, uma proteína composta de quatro subunidades idênticas.
A quantidade de repressor lac é feita aproximadamente 10 homotetrâmero
proteínas por célula. Apenas uma pequena quantidade do repressor lac
proteína é necessária para reprimir o operão lac.

The lac Operon Is Regulated by a Repressor Protein
The lac operon can be transcriptionally regulated in more than
one way. The first mechanism that we will examine is one that is
inducible and under negative control. As shown in Figure 14.4 ,
this form of regulation involves the lac repressor protein, which
binds to the sequence of nucleotides found within the lac operator
site. Once bound, the lac repressor prevents RNA polymerase
from transcribing the lacZ, lacY, and lacA genes (Figure 14.4a).
The binding of the repressor to the operator site is a reversible
process. In the absence of allolactose, the lac repressor is bound
to the operator site most of the time.
The ability of the lac repressor to bind to the operator site
depends on whether or not allolactose is bound to it. Each of
the repressor protein’s four subunits has a single binding site for
allolactose, the inducer. How does a small molecule like allolactose
exert its effects? When allolactose binds to the repressor, a
conformational change occurs in the lac repressor protein that
prevents it from binding to the operator site. Under these conditions,
RNA polymerase is now free to transcribe the operon
(Figure 14.4b). In genetic terms, we would say that the operon
has been induced. The action of a small effector molecule, such
as allolactose, is called allosteric regulation. Allosteric proteins
have at least two binding sites. The effector molecule binds to the
protein’s allosteric site, which is a site other than the protein’s
active site. In the case of the lac repressor, the active site is the
part of the protein that binds to the DNA.
Rare mutations in the lacI gene that alter the regulation
of the lac operon reveal that the lac repressor is composed of a
protein domain that binds to the DNA and another domain that
contains the allolactose-binding site.

O Operon lac é regulado por uma proteína repressora
O operon lac pode ser regulado transcricionalmente em mais de
mão única. O primeiro mecanismo que vamos examinar é aquele que é
induzível e sob controle negativo. Como mostrado na Figura 14.4,
esta forma de regulação envolve a proteína repressor lac, que
liga-se à sequência de nucleótidos encontradas dentro do operador lac
local. Uma vez ligado, o repressor lac impede RNA polimerase
de transcrever o lacZ, laçado, e genes Laca (Figura 14.4a).
A ligação do repressor para o local de operador é um reversível
processo. Na ausência de alolactose, o repressor lac é ligado
o local de operador para a maior parte do tempo.
A capacidade do repressor lac para se ligar ao local do operador
depende se ou não alolactose é obrigado a isso. Cada um dos
quatro sub-unidades da proteína repressora tem um único local de ligação para
alolactose, o indutor. Como é que uma pequena molécula como alolactose
exercer os seus efeitos? Quando alolactose se liga ao repressor, um
alteração conformacional ocorre na proteína repressora de lac que
impede-o de se ligar ao local do operador. Sob estas condições,
RNA polimerase é agora livre para transcrever o operon
(Figura 14.4b). Em termos genéticos, diríamos que o operon
foi induzida. A acção de uma pequena molécula efectora, tal
como alolactose, é chamada regulação alostérica. Proteínas alostéricas
tem, pelo menos, dois sítios de ligação. A molécula efectora se liga ao
local alostérico da proteína, que é um sítio que não seja a proteína de
Site ativo. No caso de o repressor lac, o local activo é o
uma parte da proteína que se liga ao ADN.
Mutações raras no gene lacI que alteram o regulamento
do operão lac revelam que o repressor lac é composto de um
domínio de proteína que se liga ao ADN e outro domínio que
contém o local de ligação alolactose.



 As discussed later in Figure
14.7, researchers have identified lacI – mutations that result in the
constitutive expression of the lac operon, which means that it is
expressed in the presence and absence of lactose. Such mutations
may result in an inability to synthesize any repressor protein, or
they may produce a repressor protein that is unable to bind to the
DNA at the lac operator site. If the lac repressor is unable to bind
to the DNA, the lac operon cannot be repressed. By comparison,
lacI S mutations have the opposite effect: the lac operon cannot
be induced even in the presence of lactose. These mutations,
which are called super-repressor mutations, are typically located
in the domain that binds allolactose. The mutation usually results
in a lac repressor protein that cannot bind allolactose. If the lac
repressor is unable to bind allolactose, it will remain bound to
the lac operator site and therefore induction cannot occur.

The Regulation of the lac Operon Allows a
Bacterium to Respond to Environmental Change

To better appreciate lac operon regulation at the cellular level,
let’s consider the process as it occurs over time. Figure 14.5
illustrates the effects of external lactose on the regulation of the
lac operon. In the absence of lactose, no inducer is available to
bind to the lac repressor. Therefore, the lac repressor binds to the
operator site and inhibits transcription. In reality, the repressor
does not completely inhibit transcription, so very small amounts
of β-galactosidase, lactose permease, and transacetylase are
made. However, the levels are far too low for the bacterium to
readily use lactose. When the bacterium is exposed to lactose, a
small amount can be transported into the cytoplasm via lactose
permease, and β-galactosidase converts some of it to allolactose.
As this occurs, the cytoplasmic level of allolactose gradually rises;
eventually, allolactose binds to the lac repressor. The binding of
allolactose promotes a conformational change that prevents the
repressor from binding to the lac operator site and thereby allows
transcription of the lacZ, lacY, and lacA genes to occur. Translation
of the encoded polypeptides produces the proteins needed
for lactose uptake and metabolism.

Como discutido mais tarde na Figura
14.7, os investigadores identificaram lacl - mutações que resultam na
a expressão constitutiva do operão lac, o que significa que é
expresso na presença e na ausência de lactose. Tais mutações
pode resultar numa incapacidade para sintetizar qualquer proteína repressora, ou
eles podem produzir uma proteína repressora que é incapaz de se ligar ao
ADN no local de operador lac. Se o repressor lac é incapaz de se ligar
para o DNA, o operão lac não pode ser reprimida. Por comparação,
lacI S mutações têm o efeito oposto: o operon lac não pode
ser induzida mesmo na presença de lactose. Estas mutações,
que são chamados mutações super-repressor, estão normalmente localizados
no domínio que se liga alolactose. A mutação resulta geralmente
em uma proteína repressora de lac que não se pode ligar alolactose. Se o lac
repressor é incapaz de se ligar alolactose, ele permanecerá ligado a
o local de operador lac e, portanto, a indução não pode ocorrer.

O regulamento do lac Operon Permite que um
Bactéria para responder à mudança ambiental

Para melhor apreciar lac operon regulação a nível celular,
vamos considerar o processo como ocorre ao longo do tempo. Figura 14.5
ilustra os efeitos de lactose externo sobre a regulamentação do
operon lac. Na ausência da lactose, o indutor não está disponível para
ligar-se ao repressor lac. Portanto, o repressor Lac liga-se ao
operador local e inibe a transcrição. Na realidade, o repressor
não inibem completamente a transcrição, de modo que quantidades muito pequenas
de β-galactosidase, permease da lactose, e são transacetilase
feito. No entanto, os níveis são demasiado baixos para que a bactéria
prontamente utilizar lactose. Quando a bactéria é exposta a lactose, um
pequena quantidade pode ser transportado para o citoplasma através de lactose
permease, e β-galactosidase converte-lo a alguns dos alolactose.
Enquanto isto ocorre, o nível citoplasmático de alolactose aumenta gradualmente;
Eventualmente, alolactose se liga ao repressor lac. A ligação de
alolactose promove uma alteração conformacional que impede o
repressor da ligação ao local do operador lac, permitindo assim
transcrição dos genes lacZ, Lacy, e laca para ocorrer. Tradução
dos polipéptidos codificados produz as proteínas necessárias
para a absorção e metabolismo da lactose.

To understand how the induction process is shut off in
a lactose-depleted environment, let’s consider the interaction
between allolactose and the lac repressor. The lac repressor
has a measurable affinity for allolactose. The binding of allolactose
to the lac repressor is reversible. The likelihood that
allolactose will bind to the repressor depends on the allolactose
concentration. During induction of the operon, the
concentration of allolactose rises and approaches the affinity
for the repressor protein. This makes it likely that allolactose
will bind to the lac repressor, thereby causing it to be
released from the operator site. Later on, however, the bacterial
cell metabolizes the sugars, thereby lowering the concentration
of allolactose below its affinity for the repressor. At
this point, the lac repressor is unlikely to be bound to allolactose.
When allolactose is released, the lac repressor returns to
the conformation that binds to the operator site. In this way,
the binding of the repressor shuts down the lac operon when
lactose is depleted from the environment. After repression
occurs, the mRNA and proteins encoded by the lac operon
are eventually degraded (see Figure 14.5). The lac Operon Is Also Regulated
by an Activator Protein
The lac operon can be transcriptionally regulated in a second
way, known as catabolite repression (as we shall see, a somewhat
imprecise term). This form of transcriptional regulation is
influenced by the presence of glucose, which is a catabolite—a
substance that is broken down inside the cell. The presence of
glucose ultimately leads to repression of the lac operon. When
exposed to both glucose and lactose, E. coli cells first use glucose,
and catabolite repression prevents the use of lactose. Why
is this an advantage? The explanation is efficiency. The bacterium
does not have to express all of the genes necessary for both
glucose and lactose metabolism. If the glucose is used up, catabolite
repression is alleviated, and the bacterium then expresses
the lac operon. The sequential use of two sugars by a bacterium,
known as diauxic growth, is a common phenomenon among
many bacterial species. 

Para entender como o processo de indução é desligado em
um ambiente empobrecido-lactose, vamos considerar a interação
entre alolactose e o repressor lac. O repressor lac
tem uma afinidade mensurável para alolactose. A ligação de alolactose
ao repressor lac é reversível. A probabilidade de que
alolactose irá ligar-se ao repressor depende da alolactose
concentração. Durante a indução do operão, o
concentração de aumentos alolactose e se aproxima da afinidade
para a proteína do repressor. Isto faz com que seja provável que alolactose
vai ligar-se ao repressor Lac, provocando assim que seja
libertado a partir do local do operador. Mais tarde, no entanto, o bacteriana
célula metaboliza os açúcares, diminuindo assim a concentração
alolactose abaixo da sua afinidade para o repressor. Em
Neste ponto, é improvável que seja obrigado a alolactose o repressor lac.
Quando alolactose é liberada, o repressor lac retorna ao
a conformação que se liga ao local do operador. Nesse caminho,
a ligação do repressor desliga o operão lac quando
a lactose é esgotada do meio. Depois de repressão
ocorre, o ARNm e proteínas codificadas pelo operão lac
são eventualmente degradada (veja a Figura 14.5). O Operon lac é também regulada
por uma proteína activadora
O operon lac pode ser regulado transcricionalmente em um segundo
forma, conhecida como catabolite repressão (como veremos, um pouco
termo impreciso). Esta forma de regulação da transcrição é
influenciado pela presença de glicose, o qual é um catabolito de um-
substância que é dividido no interior da célula. A presença de
glucose em última análise, leva à repressão do operão lac. Quando
exposto a ambos glicose e lactose, E. coli primeira utilização da glicose,
e repressão catabólica impede a utilização de lactose. Por quê
este é uma vantagem? A explicação é a eficiência. A bactéria
não tem de expressar todos os genes necessários para ambos
metabolismo da glicose e a lactose. Se a glicose é usado para cima, catabolite
repressão é aliviada, e a bactéria expressa então
o operão lac. O uso sequencial de dois açúcares por uma bactéria,
conhecido como o crescimento diauxic, é um fenômeno comum entre os
muitas espécies bacterianas.


Glucose, a more commonly encountered
sugar, is metabolized preferentially, and then a second sugar is
metabolized after glucose is depleted from the environment.
Glucose, however, is not itself the small effector molecule
that binds directly to a genetic regulatory protein. Instead, this
form of regulation involves a small effector molecule, cyclic
AMP (cAMP), which is produced from ATP via an enzyme
known as adenylyl cyclase. When a bacterium is exposed to glucose,
the transport of glucose into the cell stimulates a signaling
pathway that causes the intracellular concentration of cAMP
to decrease because the pathway inhibits adenylyl cyclase, the
enzyme needed for cAMP synthesis. The effect of cAMP on the
lac operon is mediated by an activator protein called the catabolite
activator protein (CAP). CAP is composed of two subunits,
each of which binds one molecule of cAMP.
Figure 14.8 considers how the interplay between the lac
repressor and CAP determines whether the lac operon is expressed
in the presence or absence of lactose and/or glucose. When only
lactose is present, cAMP levels are high (Figure 14.8a). The cAMP
binds to CAP, and then CAP binds to the CAP site and stimulates
the ability of RNA polymerase to begin transcription. In the
presence of lactose, the lac repressor is not bound to the operator
site, so transcription can proceed at a high rate. In the absence of
both lactose and glucose, cAMP levels are also high (Figure 14.8b).
Under these conditions, however, the binding of the lac repressor
inhibits transcription even though CAP is bound to the DNA.
Therefore, the transcription rate is very low.
Figure 14.8c considers the situation in which both sugars
are present. The presence of lactose causes the lac repressor to
be inactive, which prevents it from binding to the operator site.
Even so, the presence of glucose decreases cAMP levels so that
cAMP is released from CAP, which prevents CAP from binding
to the CAP site. Because CAP is not bound to the CAP site,
the transcription of the lac operon is low in the presence of both
sugars. Finally, Figure 14.8d illustrates what happens when only
glucose is present. The transcription of the lac operon is very low
because the lac repressor is bound to the operator site and CAP
is not bound to the CAP site due to low cAMP levels.

Glicose, um mais comumente encontradas
de açúcar, de preferência, é metabolizado, e, em seguida, um segundo açúcar é
metabolizada após a glicose é esgotada do meio.
Glicose, no entanto, não é por si só a pequena molécula efectora
que se liga directamente a uma proteína de regulação genética. Em vez disso, este
forma de regulação envolve uma pequena molécula efectora, cíclica
AMP (cAMP), que é produzido a partir de ATP por meio de uma enzima
conhecido como a adenilil ciclase. Quando uma bactéria é exposto à glicose,
o transporte de glucose para a célula estimula uma sinalização
percurso que faz com que a concentração intracelular de cAMP
a diminuir, porque a via inibe a adenilil ciclase, o
enzima necessária para a síntese de cAMP. O efeito de AMPc na
operão lac é mediada por uma proteína denominada activador do catabolito
activador de proteína (PAC). PAC é composta por duas subunidades,
cada um dos quais se liga uma molécula de AMPc.
Figura 14.8 considera como a interação entre o lac
repressor e CAP determina se o operão lac é expresso
na presença ou ausência de lactose e / ou glicose. Quando apenas
lactose está presente, os níveis de cAMP são elevados (Figura 14.8a). O campo
liga-se ao PAC, PAC e, em seguida liga-se ao local do PAC e estimula
a capacidade de ARN-polimerase para iniciar a transcrição. no
presença de lactose, o repressor lac não está ligado ao operador
local, de modo a transcrição possa prosseguir a um ritmo elevado. Na falta de
tanto de lactose e glicose, os níveis de cAMP são também elevados (Figura 14.8b).
Sob estas condições, no entanto, a ligação do repressor lac
inibe a transcrição embora PAC é ligado ao ADN.
Portanto, a taxa de transcrição é muito baixo.
Figura 14.8c considera a situação em que ambos os açúcares
estão presentes. A presença de lactose faz com que o repressor lac para
ser inactiva, que o impede de se ligar ao local do operador.
Mesmo assim, a presença de glucose diminui assim os níveis de cAMP que
cAMP é liberado da PAC, o que impede PAC de ligação
para o site do PAC. Porque CAP não está vinculado ao site do CAP,
a transcrição do operão lac é baixa na presença de ambos
açúcares. Finalmente, a Figura 14.8d ilustra o que acontece quando somente
glicose está presente. A transcrição do operão lac é muito baixa
porque o repressor lac é vinculado ao site do operador e CAP
não está vinculado ao site do PAC devido a baixos níveis de acampamento.


The effect of glucose, called catabolite repression, may
seem like a puzzling way to describe this process because this
regulation involves the action of an inducer (cAMP) and an activator
protein (CAP), not a repressor. The term was coined before
the action of the cAMP-CAP complex was understood. At that
time, the primary observation was that glucose (a catabolite)
inhibited (repressed) lactose metabolism.
Many bacterial promoters that transcribe genes involved in
the breakdown of other sugars, such as maltose, arabinose, and
melibiose, also have binding sites for CAP. Therefore, when glucose
levels are high, these operons are inhibited. This promotes
diauxic growth.
Further Studies Have Revealed That the lac Operon
Has Three Operator Sites for the lac Repressor
Our traditional view of the regulation of the lac operon has been
modified as we gain a greater understanding of the molecular
process. In particular, detailed genetic and crystallographic
studies have shown that the binding of the lac repressor is more
complex than originally realized. The site in the lac operon commonly
called the operator site was first identified by mutations
that prevented lac repressor binding. These mutations, called
lacO− or lacOC mutants, resulted in the constitutive expression
of the lac operon even in strains that make a normal lac repressor
protein. LacOC mutations were localized in the lac operator
site, which is now known as O1. This led to the view that a single
operator site was bound by the lac repressor to inhibit transcription,
as in Figure 14.4.
In the late 1970s and 1980s, two additional operator sites
were identified. As shown at the top of Figure 14.9 , these sites
are called O2 and O3. O1 is the operator site slightly downstream
from the promoter. O2 is located farther downstream in the
lacZ coding sequence, and O3 is located slightly upstream from
the promoter. The O2 and O3 operator sites were initially called
pseudo-operators, because substantial repression occurred in the
absence of either one of them. However, studies by Benno Müller-
Hill and his colleagues revealed a surprising result. 

O efeito da glicose, chamado repressão catabólica, pode
parecer como uma maneira intrigante para descrever este processo porque este
regulação envolve a acção de um indutor (AMPc) e de um activador
proteína (PAC), e não um repressor. O termo foi inventado antes
a acção do complexo de cAMP-CAP foi compreendido. Em que
tempo, a observação preliminar de que foi glicose (um catabolito)
inibido (reprimido) metabolismo lactose.
Muitos promotores bacterianos que transcrevem os genes envolvidos em
A composição de outros açúcares, tais como maltose, arabinose, e
melibiose, também têm sítios de ligação para CAP. Portanto, quando a glicose
níveis são elevados, estes operões são inibidas. Isto promove
crescimento diauxic.
Mais estudos têm revelado que o Operon lac
Possui três fábricas de operador para o repressor lac
Nossa visão tradicional da regulação do operon lac foi
modificada à medida que ganhamos uma maior compreensão da molecular
processo. Em particular, detalhado genética e cristalográfica
estudos têm demonstrado que a ligação do repressor lac é mais
complexo do que originalmente realizado. O site do operon lac comumente
chamado o site operador foi identificado pela primeira vez por mutações
ligação que repressor lac impedido. Estas mutações, chamados
lacO- lacOC ou mutantes, resultou na expressão constitutiva
do operão lac mesmo em cepas que fazer um repressor lac normais
proteína. LacOC mutações foram localizadas no operador lac
site, que agora é conhecido como O1. Isto levou à ideia de que um único
operador local estava vinculado pelo repressor lac para inibir a transcrição,
como na Figura 14.4.
No final dos anos 1970 e 1980, dois locais do operador adicionais
foram identificados. Como mostrado no topo da figura 14.9, estes locais
são chamados de O2 e O3. O1 é o site operador ligeiramente a jusante
a partir do promotor. O2 é localizado mais a jusante no
sequência de codificação de lacZ, O3 e está localizado a montante da ligeiramente
o promotor. Os locais do operador O2 e O3 foram inicialmente chamada
pseudo-operadores, porque a repressão substancial ocorreu no
ausência de qualquer um deles. No entanto, estudos realizados por Benno Müller-
Hill e seus colegas revelaram um resultado surpreendente.


As shown in
Figure 14.9 (fourth example down), if both O2 and O3 are missing,
repression is dramatically reduced even when O1 is present.
When O1 is missing, even in the presence of one of the other
operator sites, repression is nearly abolished.
How were these results interpreted? The data of Figure 14.9
supported a hypothesis that the lac repressor must bind to O1 and
either O2 or O3 to cause full repression. According to this view,
the lac repressor can readily bind to O1 and O2, or to O1 and O3,
but not to O2 and O3. If either O2 or O3 were missing, maximal
repression is not achieved because it is less likely for the repressor
to bind when only two operator sites are present. Look at Figure
14.9 and you will notice that the operator sites are a fair distance
from each other. For this reason, it was proposed that the binding
of the lac repressor to two operator sites requires the DNA to
form a loop. A loop in the DNA would bring the operator sites
closer together, thereby facilitating the binding of the repressor
protein (Figure 14.10a ).

Como mostrado em
Figura 14.9 (quarto exemplo abaixo), se ambos O2 e O3 estão faltando,
repressão é drasticamente reduzido, mesmo quando O1 está presente.
Quando O1 está ausente, mesmo na presença de um dos outros
locais do operador, a repressão é quase abolida.
Como foram esses resultados interpretado? Os dados da Figura 14.9
suportada uma hipótese de que o repressor lac deve ligar-se a O1 e
quer O2 O3 ou para causar repressão completa. De acordo com este ponto de vista,
o repressor lac pode facilmente ligar-se a O1 e O2, ou para O1 e O3,
mas não para O2 e O3. Se quer O2 ou O3 estavam faltando, máxima
repressão não é conseguido porque é menos provável para o repressor
para se ligar quando apenas dois locais do operador estão presentes. Observe a Figura
14,9 e você vai notar que os sites do operador são uma distância razoável
de cada um. Por esta razão, foi proposto que a ligação
do repressor lac para dois locais do operador requer que o ADN de
formar um loop. Um laço no ADN traria os locais do operador
mais juntos, facilitando desse modo a ligação do repressor
proteína (Figura 14.10a).

In 1996, the proposal that the lac repressor binds to two
operator sites was confirmed by studies in which the lac repressor
was crystallized by Mitchell Lewis and his colleagues. The crystal
structure of the lac repressor has provided exciting insights into
its mechanism of action. As mentioned earlier in this chapter, the
lac repressor is a tetramer of four identical subunits. The crystal
structure revealed that each dimer within the tetramer recognizes
one operator site. Figure 14.10b is a molecular model
illustrating the binding of the lac repressor to the O1 and O3 sites.
The amino acid side chains in the protein interact directly with
bases in the major groove of the DNA helix. This is how genetic
regulatory proteins recognize specific DNA sequences. Because
each dimer within the tetramer recognizes a single operator site,
the association of two dimers to form a tetramer requires that the
two operator sites be close to each other. For this to occur, a loop
must form in the DNA. The formation of this loop dramatically
inhibits the ability of RNA polymerase to slide past the O1 site
and transcribe the operon.
Figure 14.10b also shows the binding of the cAMP-CAP
complex to the CAP site (see the blue protein within the loop). A
particularly striking observation is that the binding of the cAMPCAP
complex to the DNA causes a 90° bend in the DNA structure.
When the repressor is active—not bound to allolactose—the
cAMP-CAP complex facilitates the binding of the lac repressor to
the O1 and O3 sites. When the repressor is inactive, this bending
also appears to be important in the ability of RNA polymerase to
initiate transcription slightly downstream from the bend.

Em 1996, a proposta de que o repressor lac se liga a dois
locais do operador foi confirmada por estudos em que o repressor lac
foi cristalizada por Mitchell Lewis e seus colegas. O cristal
estrutura do repressor lac forneceu introspecções emocionantes em
o seu mecanismo de acção. Como mencionado anteriormente neste capítulo, a
repressor lac é um tetrâmero de quatro subunidades idênticas. O cristal
estrutura revelou que cada dímero dentro do tetrâmero reconhece
um site de operador. Figura 14.10b é um modelo molecular
que ilustra a ligação do repressor lac para os sítios O1 e O3.
As cadeias laterais de aminoácidos na proteína interagir directamente com
bases no sulco maior da hélice do ADN. Isto é como genética
proteínas reguladoras reconhecem sequências específicas de DNA. porque
cada dímero dentro do tetrâmero reconhece um único local de operador,
a associação de dois dímeros para formar um tetrâmero requer que o
dois locais do operador estar próximos uns dos outros. Para que isto ocorra, um loop
deve formar no DNA. A formação deste circuito dramaticamente
inibe a capacidade da RNA polimerase para o local deslizam O1
e transcrever o operon.
Figura 14.10b também mostra a ligação do cAMP-PAC
complexo para o site do PAC (veja a proteína azul dentro do loop). UMA
observação é particularmente surpreendente que a ligação do cAMPCAP
complexa com o DNA provoca uma curvatura de 90 ° na estrutura do DNA.
Quando o repressor está activo não-vinculados a alolactose-o
complexo cAMP-PAC facilita a ligação do repressor lac a
os locais O1 e O3. Quando o repressor é inactivo, esta flexão
Também parece ser importante na capacidade de ARN-polimerase de
iniciar a transcrição a jusante ligeiramente a partir da curva.


The ara Operon Can Be Regulated Positively
or Negatively by the Same Regulatory Protein
Now that we have considered the regulation of the lac operon,
let’s compare its regulation to that of other genes in the bacterial
chromosome. Another operon in E. coli involved in sugar metabolism
is the ara (arabinose) operon. The sugar arabinose is a constituent
of the cell walls of a few types of plants. As shown in Figure
14.11 , the ara operon contains three structural genes, araB,
araA, and araD, encoding a polycistronic mRNA for the three
enzymes involved in arabinose metabolism. The actions of the
three enzymes metabolize arabinose into d-xylulose-5-phosphate.
Like the lac operon, the ara operon contains a single promoter,
designated PBAD. The operon also contains a CAP site for
the binding of the catabolite activator protein. The araC gene,
which has its own promoter (PC), is adjacent to the ara operon.
AraC encodes a regulatory protein, called the AraC protein, that
can bind to sites designated araI, araO1, and araO2.
As we have seen with the lac operon, some regulatory proteins
such as the lac repressor inhibit transcription, whereas others
such as CAP turn on transcription. AraC is a rather interesting
protein because it can act as either a negative or positive
regulator of transcription, depending on whether or not arabinose
is present. How can a protein function in both ways? In
the absence of arabinose, the AraC protein binds to the araI,
araO1, and araO2 sites (Figure 14.12a ). An AraC protein dimer
is bound to araO1, whereas monomers are bound at araO2 and
araI. The binding of the AraC dimer to the araO1 site inhibits
the transcription of the araC gene. In other words, the AraC protein
is a repressor of the araC gene. This keeps AraC protein levels
fairly low. The AraC proteins bound at araO2 and araI repress
the ara operon, but only in the absence of arabinose. As shown
in Figure 14.12a, the AraC proteins at araO2 and araI can bind
to each other by causing a loop in the DNA, as originally proposed
by Robert Schleif and his colleagues in 1990. This DNA
loop prevents RNA polymerase from binding to the DNA and
transcribing the ara operon via PBAD. Therefore, in the absence of
arabinose, the ara operon is turned off.

O Operon ara pode ser regulada Positivamente
ou negativamente pela proteína reguladora Same
Agora que temos considerado a regulação do operon lac,
vamos comparar sua regulamentação à de outros genes no bacteriana
cromossoma. Outra operon em E. coli envolvidos no metabolismo do açúcar
é o ARA (arabinose) operão. A arabinose açúcar é um constituinte
das paredes das células de alguns tipos de plantas. Como mostrado na Figura
14.11, o operão ara contém três genes estruturais, árabe,
araA e araD, que codifica para um ARNm policistrónico para os três
enzimas envolvidas no metabolismo da arabinose. As ações do
três enzimas metabolizar a arabinose em d-xilulose-5-fosfato.
Como o operão lac, o operão ara contém um único promotor,
PBAD designado. O operon também contém um sítio CAP para
a ligação da proteína activadora de catabolitos. O gene araC,
que tem o seu próprio promotor (PC), é adjacente ao operão ARA.
AraC codifica uma proteína reguladora, chamado a proteína AraC, que
pode ligar-se a sites de área, AO1 e aO2 designados.
Como vimos com o operon lac, algumas proteínas reguladoras
tal como o repressor lac inibem a transcrição, ao passo que outros
tal como PAC ligar transcrição. AraC é um bastante interessante
proteína, porque ele pode atuar tanto como um negativo ou positivo
regulador de transcrição, dependendo ou não arabinose
é presente. Como pode uma função da proteína em ambos os sentidos? Dentro
a ausência de arabinose, AraC liga-se a proteína para o Arai,
araO1, e sites de araO2 (Figura 14.12a). Um dímero de proteína AraC
é obrigado a araO1, ao passo que os monómeros são obrigados a araO2 e
Arai. A ligação do dimero de AraC para as inibições do sítio araO1
a transcrição do gene araC. Em outras palavras, a proteína AraC
é um repressor do gene araC. Isso mantém os níveis de proteína AraC
razoavelmente baixo. As proteínas AraC presos junto araO2 e Arai reprimir
o operão ARA, mas apenas na ausência de arabinose. Como mostrado
na Figura 14.12a, as proteínas AraC na araO2 e Arai pode vincular
uns aos outros, fazendo com que um laço no ADN, como originalmente proposto
por Robert Schleif e seus colegas em 1990. Este DNA
ciclo impede de se ligar a RNA polimerase para o ADN e
transcrevendo o operão ara via PBAD. Portanto, na ausência de
arabinose, o operão ara está desligado.


Figure 14.12b illustrates the activation of the ara operon in
the presence of arabinose. When arabinose is bound to the AraC
protein, the interaction between the AraC proteins at the araO2
and araI sites is broken. This opens the DNA loop. In addition,
a second AraC protein binds at the araI site. This AraC dimer at
the araI operator site activates transcription by directly interacting
with RNA polymerase. This activation can occur in conjunction
with the activation of the ara operon by CAP and cAMP
if glucose levels are low. When the ara operon is activated, the
bacterial cell can efficiently metabolize arabinose.
The trp Operon Is Regulated by a Repressor
Protein and Also by Attenuation
The trp operon (pronounced “trip”) encodes enzymes that are
needed for the biosynthesis of the amino acid tryptophan. The
trpE, trpD, trpC, trpB, and trpA genes encode enzymes involved
in tryptophan biosynthesis. The trpR and trpL genes are involved
in regulating the trp operon in two different ways. The trpR
gene encodes the trp repressor protein. When tryptophan levels
within the cell are very low, the trp repressor cannot bind
to the operator site. Under these conditions, RNA polymerase
transcribes the trp operon (Figure 14.13a ). In this way, the cell
expresses the genes required for the synthesis of tryptophan.
When the tryptophan levels within the cell become high, tryptophan
acts as a corepressor that binds to the trp repressor protein.
This causes a conformational change in the trp repressor that
allows it to bind to the trp operator site (Figure 14.13b). This
inhibits the ability of RNA polymerase to transcribe the operon.
Therefore, when a high level of tryptophan is present within the
cell—when the cell does not need to make more tryptophan—the
trp operon is turned off. In the 1970s, after the action of the trp repressor was elucidated,
Charles Yanofsky and coworkers made a few unexpected
observations. Mutant strains were found that lacked the trp repressor
protein. Surprisingly, these mutant strains still could inhibit
the expression of the trp operon in the presence of tryptophan. 

Figura 14.12b ilustra a activação do operão em ARA
a presença de arabinose. Quando arabinose é vinculado ao AraC
proteína, a interacção entre as proteínas AraC no araO2
e sites de Arai está quebrado. Isso abre o circuito de ADN. Além,
uma segunda proteína AraC liga no local do Arai. Este dímero AraC em
local do operador, a Arai ativa a transcrição, interagindo diretamente
com ARN-polimerase. Esta activação pode ocorrer em conjunto
com a activação do operão ARA por PAC e cAMP
se os níveis de glucose são baixos. Quando o operão ara é ativado, o
célula bacteriana pode metabolizar eficientemente arabinose.
O Operon trp é regulada por um repressor
Proteína e também por Atenuação
O operão trp (pronuncia-se "viagem") codifica enzimas que são
necessária para a biossíntese do aminoácido triptofano. o
genes trpE, trpD, trpC, trpB e trpA codificam enzimas envolvidas
na biossíntese de triptofano. Os genes trpR trpl e estão envolvidos
na regulação do operão trp de duas maneiras diferentes. O trpR
gene codifica a proteína do repressor trp. Quando os níveis de triptofano
dentro da célula são muito baixos, o repressor trp não se pode ligar
para o operador local. Sob estas condições, a polimerase de ARN
transcreve o operão trp (Figura 14.13a). Desta forma, a célula
expressa os genes necessários para a síntese do triptofano.
Quando os níveis de triptofano no interior da célula se tornar alto, triptofano
actua como um co-repressor que se liga à proteína do repressor trp.
Isto provoca uma alteração conformacional no repressor trp que
permite que ele se ligue ao local de operador Trp (Figura 14.13b). este
inibe a capacidade da RNA polimerase transcrever o operão.
Portanto, quando um elevado nível de triptofano está presente dentro do
-célula quando a célula não é preciso fazer mais do triptofano-
operão trp é desligado. Na década de 1970, após a acção do repressor trp foi elucidada,
Charles Yanofsky e colaboradores fizeram alguns inesperado
observações. Estirpes mutantes foram encontrados que faltava o repressor trp
proteína. Surpreendentemente, estas estirpes mutantes ainda poderia inibir
a expressão do operão trp na presença de triptofano.


In
addition, trp operon mutations were identified in which a region
including the trpL gene was missing from the operon. These mutations
resulted in higher levels of expression of the other genes
in the trp operon. As is often the case, unusual observations can
lead scientists into productive avenues of study. By pursuing this
research further, Yanofsky discovered a second regulatory mechanism
in the trp operon, called attenuation, that is mediated by the
region that includes the trpL gene (Figure 14.13c).
Attenuation can occur in bacteria because the processes
of transcription and translation are coupled. As described in
Chapter 13 , bacterial ribosomes quickly attach to the 5ʹ end of
mRNA soon after its synthesis begins via RNA polymerase.
During attenuation, transcription actually begins, but it is terminated
before the entire mRNA is made. A segment of DNA,
termed the attenuator sequence, is important in facilitating this
termination. When attenuation occurs, the mRNA from the trp
operon is made as a short piece that terminates shortly past the
trpL gene (see Figure 14.13c). Because this short mRNA has been
terminated before RNA polymerase has transcribed the trpE,
trpD, trpC, trpB, and trpA genes, it will not encode the proteins
required for tryptophan biosynthesis. In this way, attenuation
inhibits the further production of tryptophan in the cell.
The segment of the trp operon immediately downstream
from the operator site plays a critical role during attenuation. The
first gene in the trp operon is the trpL gene, which encodes a peptide
containing 14 amino acids called the leader peptide. As shown
in Figure 14.14 , two features are key in the attenuation mechanism.
First, two tryptophan (Trp) codons are found within the mRNA that
encodes the trp leader peptide. What is the role of these codons? As
we will see later, these two codons provide a way to sense whether
or not the bacterium has sufficient tryptophan to synthesize its proteins.
Second, the mRNA can form stem-loop structures. The type
of stem-loop structure that forms underlies attenuation.

Dentro
Adicionalmente, as mutações de operão trp foram identificadas em que uma região
incluindo o gene trpl estava ausente do operon. Estas mutações
resultou em níveis mais elevados de expressão de genes de outros
no operão trp. Como é frequentemente o caso, observações incomuns podem
cientistas de chumbo em avenidas produtivas de estudo. Ao prosseguir esta
pesquisa adiante, Yanofsky descoberto um segundo mecanismo de regulação
no operão trp, chamado de atenuação, que é mediada pela
região que inclui o gene trpl (Figura 14.13c).
A atenuação pode ocorrer em bactérias porque os processos
de transcrição e tradução são acopladas. Tal como descrito em
Capítulo 13, ribossomos bacterianos rapidamente anexar ao fim de 5 '
ARNm logo após a sua síntese começa por meio de ARN polimerase.
Durante a atenuação, a transcrição começa realmente, mas é encerrado
antes de todo o ARNm é feita. Um segmento de ADN,
denominou a sequência atenuador, é importante para facilitar este
rescisão. Quando ocorre atenuação, o ARNm do trp
operão é feita como uma peça curta que termina logo após a
gene trpl (veja a Figura 14.13c). Porque este mRNA curto tem sido
terminada antes de ARN-polimerase transcrito tem o trpE,
trpD, trpC, trpB e genes trpA, não irá codificar as proteínas
necessária para a biossíntese do triptofano. Desta forma, a atenuação
inibe a produção adicional de triptofano na célula.
O segmento do operão trp imediatamente a jusante
a partir do local do operador desempenha um papel crítico durante a atenuação. o
primeiro gene no operão trp é o gene trpl, que codifica um peptídeo
contendo 14 aminoácidos chamado o péptido líder. Como mostrado
na Figura 14.14, duas características são fundamentais no mecanismo de atenuação.
Em primeiro lugar, dois (trp) codões de triptofano se encontram dentro do mRNA que
codifica o péptido líder trp. Qual é o papel desses códons? Como
veremos mais adiante, estes dois códons fornecer uma maneira de detectar se
ou a bactéria não tem suficiente para sintetizar triptofano suas proteínas.
Em segundo lugar, o ARNm pode formar estruturas de haste-laçada. O tipo
da estrutura haste-laçada que se forma subjaz atenuação.

Different combinations of stem-loop structures are possible
due to interactions among four regions within the RNA transcript
(see the color key in Figure 14.14). Region 2 is complementary to
region 1 and also to region 3. Region 3 is complementary to region
2 as well as to region 4. Therefore, three stem-loop structures are
possible: 1–2, 2–3, and 3–4. Even so, keep in mind that a particular
segment of RNA can participate in the formation of only one
stem-loop structure. For example, if region 2 forms a stem-loop
with region 1, it cannot (at the same time) form a stem-loop with
region 3. Alternatively, if region 2 forms a stem-loop with region
3, then region 3 cannot form a stem-loop with region 4. Though
three stem-loop structures are possible, the 3–4 stem-loop structure
is functionally unique. The 3–4 stem-loop together with the
U-rich attenuator sequence acts as an intrinsic terminator—a
ρ-independent terminator, as described in Chapter 12 . Therefore,
the formation of the 3–4 stem-loop causes RNA polymerase to
pause, and the U-rich sequence dissociates from the DNA. This
terminates transcription at the U-rich attenuator. In comparison, if
region 3 forms a stem-loop with region 2, transcription will not be
terminated because a 3–4 stem-loop cannot form.
Conditions that favor the formation of the 3–4 stem-loop
ultimately rely on the translation of the trpL gene. As shown in
Figure 14.15 , three scenarios are possible. In Figure 14.15a, translation
is not coupled with transcription. Region 1 rapidly hydrogen
bonds to region 2, and region 3 is left to hydrogen bond to region
4. Therefore, the terminator stem-loop forms, and transcription is
terminated just past the trpL gene at the U-rich attenuator.
In Figure 14.15b, coupled transcription and translation
occur under conditions in which the tryptophan concentration is
low. When tryptophan levels are low, the cell cannot make a sufficient
amount of charged tRNATrp. As we see in Figure 14.15b, the
ribosome pauses at the Trp codons in the trpL mRNA because
it is waiting for charged tRNATrp. This pause occurs in such a
way that the ribosome shields region 1 of the mRNA. This sterically
prevents region 1 from hydrogen bonding to region 2.

Diferentes combinações de estruturas de haste-laçada são possíveis
devido a interações entre quatro regiões do RNA transcrito
(veja a chave de cores na Figura 14.14). Região 2 é complementar
região 1, e também para a região 3. Região 3 é complementar à região
2, bem como a região 4. Portanto, três estruturas de haste-laçada estão
possível: 1-2, 2-3, e 3-4. Mesmo assim, tenha em mente que um determinado
segmento de ARN pode participar na formação de uma única
estrutura de haste-loop. Por exemplo, se a região-2 forma uma ansa pedunculada
1 com a região, não pode (ao mesmo tempo) formar uma ansa pedunculada com
região 3. Alternativamente, se a região-2 forma uma ansa pedunculada com a região
3, então a região 3 não pode formar uma ansa pedunculada com a região 4. Embora
três estruturas de haste-laçada são possíveis, a estrutura de haste-laçada 3-4
é funcionalmente única. A haste-laçada 3-4 em conjunto com o
U-rica sequência atenuador actua como um terminador intrínseca-a
independente de ρ terminator, conforme descrito no Capítulo 12. Portanto,
a formação da estrutura haste-laçada 3-4 faz com que a ARN-polimerase
pausa, e a sequência de L-rico dissocia-se do ADN. este
termina a transcrição no U-rico atenuador. Em comparação, se
região 3 forma uma ansa pedunculada com a região 2, transcrição não será
rescindido pelo facto de uma haste de ciclo 04/03 não pode formar.
Condições que favorecem a formação da estrutura haste-laçada 3-4
em última análise, depender da tradução do gene trpl. Como mostrado em
Figura 14.15, três cenários são possíveis. Na Figura 14.15a, tradução
Não é acoplado com a transcrição. Região 1 de hidrogénio rapidamente
ligações a região 2, 3 e região é deixado para ligação de hidrogênio para a região
4. Por conseguinte, as formas de haste-laçada de terminação, e a transcrição é
encerrado apenas após o gene trpl no U-rico atenuador.
Na Figura 14.15b, acoplado transcrição e tradução
ocorrer sob condições em que a concentração de triptofano é
baixo. Quando os níveis de triptofano são baixos, a célula não pode fazer uma suficiente
quantidade de tRNATrp carregada. Como podemos ver na Figura 14.15b, o
ribossoma pausa com os codões Trp trpl no ARNm porque
ele está esperando por tRNATrp cobrado. Esta pausa ocorre de tal
maneira que o ribossoma protege região 1 do ARNm. Este estericamente
impede a região de ligação de hidrogénio de 1 a região 2.


 As
an alternative, region 2 hydrogen bonds to region 3. Therefore,
because region 3 is already hydrogen bonded to region 2, the
3–4 stem-loop structure cannot form. Under these conditions,
transcriptional termination does not occur, and RNA polymerase
transcribes the rest of the operon. This ultimately enables the
bacterium to make more tryptophan.
Finally, in Figure 14.15c, coupled transcription and translation
occur under conditions in which a sufficient amount of
tryptophan is present in the cell. In this case, translation of the
trpL mRNA progresses to its stop codon, where the ribosome
pauses. The pausing at the stop codon prevents region 2 from
hydrogen bonding with any region and thereby enables region 3
to hydrogen bond with region 4. As in Figure 14.15a, this terminates
transcription. Of course, keep in mind that the trpL gene
contains two tryptophan codons. For the ribosome to smoothly
progress to the trpL stop codon, enough charged tRNATrp must
be available to translate this mRNA. It follows that the bacterium
must have a sufficient amount of tryptophan. Under these conditions,
the rest of the transcription of the operon is terminated.
Attenuation is a mechanism to regulate transcription that
is found in several other operons involved with amino acid biosynthesis.
In all cases, the mRNAs that encode the leader peptides
are rich in codons for the particular amino acid that is synthesized
by the enzymes encoded by the particular operon. For example,
the mRNA that encodes the leader peptide of the histidine operon
has seven histidine codons in its sequence, and the mRNA for the
leader peptide of the leucine operon has four leucine codons. Like
the trp operon, these other operons have alternative stem-loop
structures, one of which is a transcriptional terminator.

Como
alternativa, ligações de hidrogênio região 2 para a região 3. Portanto,
porque a região 3 já é hidrogénio ligado a região 2, o
3-4 estrutura de haste de laço não pode formar. Sob estas condições,
de terminação da transcrição não ocorrer, e RNA polimerase
transcreve o resto do operão. Esta última análise permite a
bactéria para fazer mais triptofano.
Finalmente, na Figura 14.15c, acoplado transcrição e tradução
ocorrer sob condições em que uma quantidade suficiente de
triptofano está presente na célula. Neste caso, a tradução do
trpl ARNm progride ao seu codão de terminação, em que o ribossoma
faz uma pausa. A pausa no codão de paragem impede região de 2
pontes de hidrogênio com qualquer região e, assim, permite região 3
a ligação de hidrogênio com a região 4. Como na Figura 14.15a, este termina
transcrição. Claro, tenha em mente que o gene trpl
contém dois codões de triptofano. Para o ribossomo para sem problemas
o progresso para o códon de parada trpl, bastante carregada tRNA Trp deve
estar disponível para traduzir este mRNA. Segue-se que a bactéria
devem ter uma quantidade suficiente de triptofano. Sob estas condições,
o resto da transcrição do operão é terminada.
A atenuação é um mecanismo para regular a transcrição de que
é encontrado em diversos outros operões envolvidos na biossíntese de aminoácidos.
Em todos os casos, os mRNAs que codificam os péptidos líder
são ricas em codões para os aminoácidos em particular que é sintetizado
por as enzimas codificadas pelo operão particular. Por exemplo,
o ARNm que codifica o péptido líder do operão histidina
tem sete códons histidina na sua sequência, e o mRNA para o
péptido líder do operão leucina tem quatro codões de leucina. Como
o operon trp, estes outros operons têm de ciclo-tronco alternativa
estruturas, um dos quais é um terminador da transcrição.



Inducible Operons Encode Catabolic
Enzymes, and Repressible Operons
Usually Encode Anabolic Enzymes
Thus far, we have seen that bacterial genes can be transcriptionally
regulated in a positive or negative way—and sometimes both.
The lac operon and ara operon are inducible systems regulated
by sugar molecules that activate transcription of these operons.
By comparison, the trp operon is a repressible operon regulated
by tryptophan, a corepressor that binds to the repressor and turns
the operon off. In addition, an abundance of charged tRNATrp in
the cytoplasm can turn the trp operon off via attenuation.
By studying the genetic regulation of many operons, geneticists
have discovered a general trend concerning inducible versus
repressible regulation. When the genes in an operon encode
proteins that function in the catabolism or breakdown of a substance,
they are usually regulated in an inducible manner. The substance
to be broken down or a related compound often acts as the
inducer. For example, allolactose and arabinose act as inducers of
the lac and ara operons, respectively. An inducible form of regulation
allows the bacterium to express the appropriate genes only
when they are needed to catabolize these sugars.
In contrast, other enzymes are important for the anabolism
or synthesis of small molecules. The genes that encode these
anabolic enzymes tend to be regulated by a repressible mechanism.
The corepressor or inhibitor is commonly the small molecule
that is the product of the enzymes’ biosynthetic activities.
For example, tryptophan is produced by the sequential action of
several enzymes that are encoded by the trp operon. Tryptophan
itself acts as a corepressor that can bind to the trp repressor protein
when the intracellular levels of tryptophan become relatively
high. This mechanism turns off the genes required for tryptophan
biosynthesis when enough of this amino acid has been
made. Therefore, genetic regulation via repression provides the
bacterium with a way to prevent the overproduction of the product
of a biosynthetic pathway.

Inducible Operons Encode Catabolic
Enzimas e Operons reprimível
Normalmente Encode anabolizantes Enzimas
Até agora, vimos que os genes bacterianos podem ser transcriptionally
regulado de uma forma e positivo ou negativo às vezes ambos.
O operon lac e ara operon são sistemas indutíveis regulamentada
por moléculas de açúcar que activam a transcrição de operons estes.
Por comparação, o operão trp é um operão reprimível regulada
por triptofano, um co-repressor que se liga ao repressor e voltas
o operão fora. Além disso, uma abundância de ARNt Trp carregada em
o citoplasma pode transformar o operon trp off via atenuação.
Ao estudar a regulação genética de muitas Operons, geneticistas
descobriram uma tendência geral em matéria de contra induzível
regulação reprimível. Quando os genes codificam um operão
proteínas que funcionam no catabolismo ou avaria de uma substância,
eles geralmente são regulados de forma induzível. A substância
ser discriminados ou um composto relacionado muitas vezes age como o
indutor. Por exemplo, ato alolactose e arabinose como indutores de
LAC e ara operons, respectivamente. Uma forma induzida da regulação
permite à bactéria expressam apenas genes apropriados
quando eles são necessários para catabolizar esses açúcares.
Em contraste, outras enzimas são importantes para o anabolismo
ou a síntese de moléculas pequenas. Os genes que codificam estes
enzimas anabolizantes tendem a ser regulado por um mecanismo reprimível.
A co-repressor ou inibidor é geralmente pequena molécula
que é o produto de actividades biossintéticas das enzimas '.
Por exemplo, o triptofano é produzido pela acção sequencial de
várias enzimas que são codificadas pelo operão trp. Triptofano
própria actua como um co-repressor, que podem ligar-se a proteína do repressor trp o
quando os níveis intracelulares de triptofano se tornar relativamente
alto. Este mecanismo desliga os genes necessários para o triptofano
biossíntese quando o suficiente deste aminoácido tem sido
feito. Portanto, a regulação genética via repressão fornece o
bactéria com uma forma de evitar a produção excessiva do produto
de uma via biossintética.

14.2 TRANSLATIONAL AND
POSTTRANSLATIONAL REGULATION
Though genetic regulation in bacteria occurs predominantly at
transcription, many examples are known in which regulation is
exerted at a later stage in gene expression. In some cases, specialized
mechanisms have evolved to regulate the translation of certain
mRNAs. Recall that the translation of mRNA occurs in three
stages: initiation, elongation, and termination. Genetic regulation
of translation is usually aimed at preventing the initiation step.
In addition, as described later in Section 14.3, translation can be
regulated by riboswitches.
The net result of translation is the synthesis of a protein.
The activities of proteins within living cells and organisms ultimately
determine an individual’s traits. Therefore, to fully understand
how proteins influence an organism’s traits, researchers
have investigated how the functions of proteins are regulated.
The term posttranslational regulation refers to the functional
control of proteins that are already present in the cell rather
than regulation of transcription or translation. Posttranslational
control can either activate or inhibit the function of a protein.
Compared with transcriptional or translational regulation, posttranslational
control can be relatively fast, occurring in a matter
of seconds, which is an important advantage. In contrast, transcriptional
and translational regulation typically require several
minutes or even hours to take effect because these two mechanisms
involve the synthesis and turnover of mRNA and polypeptides.
In this section, we will examine some of the ways that bacteria
can regulate the initiation of translation, as well as ways that
protein function can be regulated posttranslationally.

14,2 translacional e
REGULAMENTO posttranslational
Embora regulação genética em bactérias ocorre predominantemente em
transcrição, são conhecidos muitos exemplos em que a regulação é
exercida numa fase posterior, na expressão do gene. Em alguns casos, especializada
mecanismos evoluíram para regular a tradução de certos
mRNAs. Recorde-se que a tradução de ARNm ocorre em três
etapas: iniciação, alongamento e terminação. Regulação genética
de tradução é normalmente destinada a impedir a etapa de iniciação.
Além disso, como descrito mais adiante na Secção 14.3, a tradução pode ser
regulada por riboswitches.
O resultado líquido da tradução é a síntese de uma proteína.
As actividades de proteínas no interior das células e organismos vivos, em última análise
determinar traços de um indivíduo. Portanto, para entender plenamente
como as proteínas influenciar traços de um organismo, pesquisadores
investigaram como as funções das proteínas são regulados.
A regulação pós translacional termo refere-se ao funcional
controlo de proteínas que já estão presentes na célula em vez
do que a regulação da transcrição ou tradução. Posttranslational
controlo podem activar ou inibir a função de uma proteína.
Comparado com regulação transcricional ou traducional, pós-tradução
o controlo pode ser relativamente rápida, ocorrendo em questão
de segundos, o que é uma vantagem importante. Em contraste, transcrição
e regulação de translação tipicamente requerem vários
minutos ou mesmo horas para fazer efeito, porque estes dois mecanismos
envolver a síntese e volume de negócios de mRNA e polipeptídeos.
Nesta seção, vamos examinar algumas das maneiras que as bactérias
pode regular a iniciação da tradução, bem como formas que
a função da proteína pode ser regulada pós-traducionalmente.


Repressor Proteins and Antisense RNA
Can Inhibit Translation
For some bacterial genes, the translation of mRNA is regulated
by the binding of proteins or other RNA molecules that influence
the ability of ribosomes to translate the mRNA into a polypeptide.
A translational regulatory protein recognizes sequences
within the mRNA, much as transcription factors recognize
DNA sequences. In most cases, translational regulatory proteins
act to inhibit translation. These are known as translational
repressors. When a translational repressor protein binds to the
mRNA, it can inhibit translational initiation in one of two ways.
One possibility is that it can bind in the vicinity of the Shine-
Dalgarno sequence and/or the start codon and thereby sterically
block the ribosome’s ability to initiate translation in this
region. Alternatively, the repressor protein may bind outside the
Shine-Dalgarno/start codon region but stabilize the mRNA secondary
structure that prevents initiation. Translational repression
is also a form of genetic regulation found in eukaryotic species,
and we will consider specific examples in Chapter 15 .
A second way to regulate translation is via the synthesis
of antisense RNA, an RNA strand that is complementary to a
strand of mRNA. (The mRNA strand has the same sequence
as the DNA sense strand.) To understand this form of genetic
regulation, let’s consider a trait known as osmoregulation, which
is essential for the survival of most bacteria. Osmoregulation
refers to the ability to control the amount of water inside the
cell. Because the solute concentrations in the external environment
may rapidly change between hypotonic and hypertonic
conditions, bacteria must have an osmoregulation mechanism to
maintain their internal cell volume. Otherwise, bacteria would be
susceptible to the harmful effects of lysis or shrinking.

As proteínas do repressor e ARN anti-sentido
Pode inibir a tradução
Para alguns genes bacterianos, a tradução de ARNm é regulada
pela ligação das proteínas ou outras moléculas de ARN que influenciam
a capacidade dos ribossomas para traduzir o mRNA num polipéptido.
Uma proteína reguladora translacional reconhece sequências
dentro do ARNm, bem como factores de transcrição reconhecer
As sequências de ADN. Na maior parte dos casos, proteínas reguladoras translacionais
actuar para inibir a tradução. Estes são conhecidos como translacional
repressores. Quando uma proteína repressora se liga ao translacional
ARNm, que podem inibir a iniciação da tradução de uma de duas maneiras.
Uma possibilidade é que ele pode ligar-se na vizinhança do Shine-
Dalgarno e / ou o codão de iniciação e assim estericamente
bloquear a capacidade do ribossomo para iniciar a tradução neste
região. Alternativamente, a proteína repressora se pode ligar a fora
Brilhar-Dalgarno / start região códon mas estabilizar o mRNA secundária
estrutura que impede a iniciação. Repressão translacional
é também uma forma de regulação genética encontrada em espécies eucarióticas,
e vamos considerar exemplos específicos no Capítulo 15.
Um segundo modo para regular a tradução é através da síntese
de ARN anti-sentido, uma cadeia de ARN que é complementar a uma
mecha de mRNA. (O ARNm de cadeia tem a mesma sequência
como a cadeia de sentido DNA.) Para compreender essa forma de genética
regulação, vamos considerar uma característica conhecida como osmorregulação, que
é essencial para a sobrevivência da maior parte das bactérias. Osmoregulation
refere-se à capacidade de controlar a quantidade de água no interior da
célula. Uma vez que as concentrações do soluto no ambiente externo
podem mudar rapidamente entre hipotônica e hipertônica
condições, as bactérias devem ter um mecanismo para osmoregulation
manter seu volume de célula interna. Caso contrário, as bactérias seria
suscetíveis aos efeitos nocivos da lise ou encolhendo.

In E. coli, an outer membrane protein encoded by the
ompF gene is important in osmoregulation. At low osmolarity,
the ompF protein is preferentially produced, whereas at high
osmolarity, its synthesis is decreased. The expression of another
gene, known as micF, is responsible for inhibiting the expression
of the ompF gene at high osmolarity. As shown in Figure
14.16 , the inhibition occurs because the micF RNA is complementary
to the ompF mRNA; it is an antisense strand of RNA.
When the micF gene is transcribed, its RNA product binds to
the ompF mRNA via hydrogen bonding between their complementary
regions. The binding of the micF RNA to the ompF
mRNA prevents the ompF mRNA from being translated. The
RNA transcribed from the micF gene is called antisense RNA
because it is complementary to the ompF mRNA, which is a
sense strand of mRNA that encodes a protein. The micF RNA
does not encode a protein.

Em E. coli, uma proteína da membrana externa codificada pela
ompF gene é importante em osmoregulation. Em baixa osmolaridade,
a proteína ompF é preferencialmente produzido, enquanto que a alta
osmolaridade, a sua síntese é diminuída. A expressão de uma outra
de genes, conhecidos como micF, é responsável pela inibição da expressão
do gene ompF em alta osmolaridade. Como mostrado na Figura
14.16, a inibição ocorre porque o ARN é complementar micF
para o ARNm ompF; é uma cadeia anti-sentido de ARN.
Quando o gene micF é transcrito, o seu produto de ARN liga-se a
o ARNm ompF através de ligações de hidrogénio entre as suas complementares
regiões. A ligação do ARN micF ao ompF
ARNm evita o ARNm seja traduzido ompF. o
ARN transcrito a partir do gene micF é chamado de ARN anti-sentido
porque o mesmo é complementar ao ARNm ompF, que é um
cadeia sentido do mRNA que codifica uma proteína. O micF RNA
não codifica uma proteína.

Posttranslational Regulation Can Occur Via
Feedback Inhibition and Covalent Modifications
Let’s now turn our attention to ways that protein function is regulated
posttranslationally. A common mechanism to regulate the
activity of metabolic enzymes is feedback inhibition. The synthesis
of many cellular molecules such as amino acids, vitamins,
and nucleotides occurs via the action of a series of enzymes that
convert precursor molecules to a particular product. The final
product in a metabolic pathway then inhibits an enzyme that acts
early in the pathway.
Figure 14.17 depicts feedback inhibition in a metabolic
pathway. Enzyme 1 is an example of an allosteric enzyme, an
enzyme that contains two different binding sites. (The lac repressor
is an allosteric protein, but not an enzyme.) The catalytic site
is responsible for the binding of the substrate and its conversion
to intermediate 1. The second site is a regulatory or allosteric
site. This site binds the final product of the metabolic pathway.
When bound to the regulatory site, the final product inhibits the
catalytic ability of enzyme 1.
To appreciate feedback inhibition at the cellular level, we
can consider the relationship between the product concentration
and the regulatory site on enzyme 1. As the final product is
made within the cell, its concentration gradually increases. Once
the final product concentration has reached a level that is similar
to its affinity for enzyme 1, the final product is likely to bind to
the regulatory site on enzyme 1 and inhibit its function. In this
way, the net result is that the final product of a metabolic pathway
inhibits the further synthesis of more product. Under these
conditions, the concentration of the final product has reached a
level sufficient for the purpose of the bacterium.

Posttranslational regulamento pode ocorrer por
A inibição de feedback e covalente Modificações
Vamos agora voltar nossa atenção para formas que a função da proteína é regulada
pós-traducionalmente. Um mecanismo comum para regular a
atividade de enzimas metabólicas é a inibição feedback. A síntese
de muitas moléculas celulares, tais como aminoácidos, vitaminas,
e nucleótidos ocorre através da acção de uma série de enzimas que
converter moléculas precursoras para um determinado produto. O final
O produto em uma via metabólica, em seguida, inibe uma enzima que actua
no início da via.
Figura 14.17 descreve a inibição do feedback num metabólica
via. Enzima 1 é um exemplo de uma enzima alostérica, uma
enzima que contém dois sítios de ligação diferentes. (O repressor lac
é uma proteína alostérica, mas não uma enzima.) O sítio catalítico
é responsável pela ligação do substrato e a sua conversão
a 1. intermediário O segundo site é um regulador ou allosteric
local. Este local de liga do produto final da via metabólica.
Quando ligado para o local regulador, o produto final inibe a
capacidade catalítica de um enzima.
Para apreciar a inibição do feedback no nível celular, nós
pode-se considerar a relação entre a concentração do produto
e o local regulador na enzima 1. À medida que o produto final seja
feita no interior da célula, a sua concentração aumenta gradualmente. Uma vez
a concentração final do produto atingiu um nível que é semelhante
com a sua afinidade para a enzima 1, o produto final é susceptível de se ligar a
o site regulamentar sobre uma enzima e inibir sua função. Nisso
Assim, o resultado líquido é que o produto final de uma via metabólica
inibe a síntese adicional de mais produto. Sob estes
condições, a concentração do produto final atingiu uma
nível suficiente para a finalidade da bactéria.


A second strategy to control the function of proteins is
by the covalent modification of their structure, a process called
posttranslational covalent modification (look ahead to Figure
21.4). Certain types of modifications are involved primarily
in the assembly and construction of a functional protein. These
alterations include proteolytic processing; disulfide bond formation;
and the attachment of prosthetic groups, sugars, or lipids.
These are typically irreversible changes required to produce a
functional protein. In contrast, other types of modifications, such
as phosphorylation (—PO4), acetylation (—COCH3), and methylation
(—CH3), are often reversible modifications that transiently
affect the function of a protein.

14.3 RIBOSWITCHES
In 2001 and 2002, researchers in a few different laboratories discovered
a mechanism of gene regulation called a riboswitch. In
this form of regulation, an RNA molecule can exist in two different
secondary conformations. The conversion from one conformation
to the other is due to the binding of a small molecule. As
described in Table 14.2 , a riboswitch can regulate transcription,
translation, RNA stability, and splicing.
Riboswitches are widespread in bacteria. Researchers estimate
that 3 to 5% of all bacterial genes may be regulated by riboswitches.
In bacteria, they are involved in regulating genes associated
with the biosynthesis of purines, amino acids, vitamins,
and other essential molecules. Riboswitches are also found in
archaea, algae, fungi, and plants. In this section, we will examine
two examples of riboswitches in bacteria. The first example
shows how riboswitches can regulate transcription and the second
example involves translational regulation.

Uma segunda estratégia para controlar a função de proteínas é
pela modificação covalente da sua estrutura, um processo chamado
postar modificação covalente translacional (olhar em frente para Figura
21,4). Certos tipos de modificações estão envolvidos principalmente
na montagem e construção de uma proteína funcional. Estes
alterações incluem processamento proteolítico; formação de ligações dissulfureto;
e a ligação de grupos prostéticos, açúcares, ou lípidos.
Essas são mudanças irreversíveis normalmente necessários para produzir um
proteico funcional. Em contraste, outros tipos de modificações, tais
como fosforilação (-PO4), acetilação (-OCH3), e metilação
(-CH3), São muitas vezes modificações reversíveis que transitoriamente
afectar a função de uma proteína.
14.3 riboswitches
Em 2001 e 2002, os investigadores em alguns laboratórios diferentes descoberto
um mecanismo de regulação do gene chamado de riboswitch. Dentro
esta forma de regulação, uma molécula de RNA pode existir em dois diferentes
conformações secundárias. A conversão de uma conformação
para o outro é devida à ligação de uma molécula pequena. Como
descrito na Tabela 14.2, um riboswitch pode regular a transcrição,
a tradução, a estabilidade de ARN, e de splicing.
Riboswitches são comuns em bactérias. Pesquisadores estimam
que 3 a 5% de todos os genes de bactérias pode ser regulada por riboswitches.
Em bactérias, eles são envolvidos na regulação de genes associados
com a biossíntese de purinas, aminoácidos, vitaminas,
e outras moléculas essenciais. Riboswitches também são encontrados em
archaea, algas, fungos e plantas. Nesta seção, examinaremos
dois exemplos de riboswitches em bactérias. O primeiro exemplo
mostra como riboswitches pode regular a transcrição e a segunda
exemplo envolve regulação de translação.


A Riboswitch Can Regulate Transcription
Thiamin, also called vitamin B1, is an important organic molecule
for bacteria, archaea, and eukaryotes. The active form of
this vitamin is thiamin pyrophosphate (TPP). TPP is an essential
coenzyme for the functioning of a variety of enzymes such
as certain enzymes in the citric acid cycle. In bacteria, TPP is
made via biosynthetic enzymes that are encoded in the bacterial
genome. For example, in Bacillus subtilis, the majority of genes
involved in TPP synthesis are found within the thi operon that
contains seven genes.
Certain genes that encode TPP biosynthetic enzymes, such
as those of the thi operon in B. subtilis, are regulated by a riboswitch
that controls transcription (Figure 14.18 ). As the polycistronic
mRNA for the thi operon is being made, the 5ʹ end
quickly folds into a secondary structure. When TPP levels are
low, the secondary structure has a stem-loop called an antiterminator,
which prevents the formation of the terminator stem-loop.
Therefore, under these conditions, transcription of the entire thi
operon occurs. In this way, the bacterium is able to make more
TPP, which is in short supply. By comparison, when TPP levels
are high, TPP binds to the RNA and causes a change in its secondary
structure. As shown on the right side of Figure 14.18, a
ρ-independent terminator forms instead of the antiterminator
stem-loop. The ρ-independent terminator abruptly stops transcription,
thereby inhibiting the production of the enzymes that
are needed to make more TPP. Similar to the trp operon discussed
earlier in this chapter, this is an example of attenuation.
A Riboswitch Can Regulate Translation
Let’s now consider an example in which a riboswitch regulates
translation. In gram-positive bacteria, such as B. subtilis, the
regulation of TPP biosynthetic enzymes occurs via a riboswitch
that controls transcription. However, in gram-negative bacteria,
such as Escherichia coli, a structurally similar riboswitch regulates
translation.

A riboswitch pode regular a transcrição
Tiamina, também chamado de vitamina B1, é uma molécula orgânica importante
para as bactérias, archaea e eucariotas. A forma activa de
este é o pirofosfato de tiamina vitamina (TPP). TPP é um elemento essencial
coenzima para o funcionamento de uma variedade de enzimas tais
como certas enzimas no ciclo do ácido cítrico. Em bactérias, é TPP
feita por meio de enzimas biossintéticas que são codificados no bacteriana
genoma. Por exemplo, em Bacillus subtilis, a maioria dos genes
envolvido na síntese de TPP são encontrados dentro do operão que thi
contém sete genes.
Certos genes que codificam enzimas biossintéticas, tais TPP
como aqueles do operão thi em B. subtilis, são reguladas por um riboswitch
que controla a transcrição (Figura 14.18). Como o policistrónico
mRNA para o operão thi está a ser feito, a extremidade 5 '
rapidamente se dobra em uma estrutura secundária. Quando os níveis de TPP são
, a estrutura secundária de baixo tem uma haste de ciclo chamado de antiterminator,
que impede a formação da estrutura haste-laçada terminador.
Portanto, nestas condições, a transcrição de todo o THI
operão ocorre. Desta forma, a bactéria é capaz de tornar mais
TPP, que é escasso. Por comparação, quando os níveis de TPP
são elevadas, TPP liga-se ao RNA e faz com que uma mudança no seu secundário
estrutura. Como mostrado no lado direito da figura 14.18, uma
formas de terminadores independentes de P, em vez de o antiterminator
stem-loop. O terminador independente de ρ pára abruptamente transcrição,
inibindo assim a produção das enzimas que
são necessárias para tornar mais TPP. Semelhante ao operão trp discutido
anteriormente neste capítulo, este é um exemplo de atenuação.
A riboswitch pode regular Tradução
Vamos agora considerar um exemplo em que um riboswitch regula
tradução. Em bactérias Gram-positivas, tais como B. subtilis, o
regulação de enzimas biossintéticas TPP ocorre através de um riboswitch
que controla a transcrição. No entanto, em bactérias gram-negativas,
tais como Escherichia coli, uma regula riboswitch estruturalmente similares
tradução.

Figure 14.19 shows how a riboswitch can regulate translation.
In E. coli, the thiMD operon encodes two enzymes involved
with TPP biosynthesis. When TPP levels are low, the 5ʹ end of the
mRNA folds into a structure that contains a stem-loop called
the Shine-Dalgarno anti-sequestor. When this stem-loop forms,
the Shine-Dalgarno sequence is accessible to ribosome binding.
Therefore, the mRNA is translated when TPP is in short supply.
By comparison, when TPP levels are high, TPP binds to the RNA
and causes a change in its secondary structure. As shown on the
right side of Figure 14.19, a stem-loop forms that contains the
Shine-Dalgarno sequence and the start codon. The formation of
this stem-loop sequesters the Shine-Dalgarno sequence, thereby
preventing ribosomal binding. This blocks the translation of the
enzymes that are needed to make more TPP.
When comparing Figures 14.18 and 14.19, it is worth noting
that the 5ʹ end of the thiMD mRNA of E. coli can exist in two
different secondary structures that greatly resemble those that
occur at the 5ʹ end of the thi operon of B. subtilis. However, the
effects on regulation are quite different. The TPP riboswitch in
E. coli controls translation, whereas the TPP riboswitch in B. subtilis
controls transcription.

Figura 14.19 mostra como um riboswitch pode regular a tradução.
Em E. coli, o operão terceiro codifica duas enzimas envolvidas
com TPP biossíntese. Quando os níveis de TPP são baixos, a extremidade 5 'do
ARNm dobra em uma estrutura que contém uma haste-laço chamada
o anti-sequestor Shine-Dalgarno. Quando formas de loop esta haste,
a sequência de Shine-Dalgarno é acessível para ligação ao ribossoma.
Portanto, o mRNA é traduzida quando TPP é escasso.
Por comparação, quando os níveis de TPP são elevados, TPP liga-se ao ARN
e faz com que uma mudança na sua estrutura secundária. Como mostrado na
lado direito da figura 14.19, forma uma haste-ansa que contém o
Sequência Shine-Dalgarno e o codão de iniciação. A formação de
este de ciclo-tronco sequestra a sequência de Shine-Dalgarno, assim,
prevenção de ligação ribossómica. Isto bloqueia a tradução da
enzimas que são necessários para tornar mais TPP.
Ao comparar Figuras 14.18 e 14.19, é digno de nota
que a extremidade 5 'do ARNm de terceiros coli E. podem existir em dois
diferentes estruturas secundárias que se assemelham àquelas que grandemente
ocorrer na extremidade 5 'do operão de B. subtilis de THI. No entanto, o
efeitos sobre a regulamentação são bastante diferentes. O TPP em riboswitch
E. coli controla a tradução, ao passo que o riboswitch TPP em B. subtilis
controla a transcrição.


14.4 GENE REGULATION
IN THE BACTERIOPHAGE
REPRODUCTIVE CYCLE
Viruses are small particles that contain genetic material surrounded
by a protein coat. They can infect a living cell and
then propagate themselves by using the energy and metabolic
machinery of the host cell. For this to occur, the genetic material
of viruses orchestrates an intricate series of steps, involving the
expression of many viral genes. During the past several decades,
the reproduction of viruses has presented an interesting and
challenging problem for geneticists to investigate. The study of
bacteriophages, which are viruses that infect bacteria, has greatly
advanced our basic knowledge of how genetic regulatory proteins
work. In addition, the study of viruses has been instrumental
in our ability to devise medical strategies aimed at combating
viral diseases. For example, our knowledge of the reproductive
cycles of human viruses has led to the development of drugs that
inhibit viral growth. Azidothymidine (AZT), which is used to
combat human immunodeficiency virus (HIV), suppresses the
production of viral DNA by inhibiting a viral gene product called
reverse transcriptase that is involved in viral DNA synthesis.
In this section, we will focus on the function of bacteriophage
genes that encode genetic regulatory proteins. The structural
genes of bacteriophages are often arranged in operons.
This enables all of the genes within an operon to be controlled
by regulatory proteins that bind to operator sites and influence
the function of nearby promoters. Like bacterial operons,
phage operons can be controlled by repressor proteins or activator
proteins. To understand how this works, we will carefully
examine the two reproductive cycles—lytic and lysogenic—of a
virus called phage λ (lambda), which was discovered by Esther
Lederberg in 1951. Since its discovery, phage λ has been investigated
extensively and has provided geneticists with a model on
which to base our understanding of viral proliferation.
Phage λ Can Follow a Lytic or Lysogenic Cycle
Phage λ can bind to the surface of a bacterium and inject its
genetic material into the bacterial cytoplasm. After this occurs,
the phage proceeds along only one of two alternative cycles,
known as the lytic cycle and the lysogenic cycle. This topic is
also discussed in Chapter 7 (see Figure 7.10 ).

14,4 GENE REGULAMENTO
EM bacteriófago
Ciclo reprodutivo
Os vírus são partículas pequenas que contêm o material genético rodeado
por uma camada de proteína. Eles podem infectar uma célula viva e
em seguida, propagar-se usando a energia e metabólica
maquinaria da célula hospedeira. Para que isto ocorra, o material genético
vírus de orquestra uma série complexa de passos, envolvendo o
expressão de muitos genes virais. Durante as últimas décadas,
a reprodução de vírus apresentou um interessante e
problema desafiador para os geneticistas para investigar. O estudo de
bacteriófagos, que são vírus que infectam bactérias, tem grandemente
avançado nosso conhecimento básico de proteínas reguladoras como genéticos
trabalho. Além disso, o estudo de vírus foi instrumental
na nossa capacidade de conceber estratégias médicas destinadas a combater
doenças virais. Por exemplo, o nosso conhecimento do reprodutiva
ciclos de vírus humanos levou ao desenvolvimento de drogas que
inibir o crescimento viral. Azidotimidina (AZT), que é usado para
combate vírus da imunodeficiência humana (HIV), o suprime
produção de ADN virai através da inibição de um produto de gene viral chamada
transcriptase que está envolvida na síntese de DNA virai reversa.
Nesta seção, vamos nos concentrar na função de bacteriófago
genes que codificam as proteínas reguladoras genéticos. A estrutural
genes de bacteriófagos são muitas vezes dispostas de operões.
Isto permite que todos os genes no interior de um operão para ser controlado
por proteínas reguladoras que se ligam aos locais de operação e influência
a função de promotores nas proximidades. Como operões bacterianas,
operões de fago pode ser controlado por proteínas do repressor ou activador
proteínas. Para entender como isso funciona, vamos com cuidado
examinar os dois ciclos reprodutivos-lítico e de um lisogênico-
vírus denominado fago λ (lambda), que foi descoberto por Ester
Lederberg em 1951. Desde a sua descoberta, o fago λ foi investigada
extensivamente e providenciou geneticistas com um modelo em
qual basear a nossa compreensão da proliferação viral.
Fago λ podem seguir um ciclo lítico ou lysogenic
O fago λ pode ligar-se à superfície de uma bactéria e injectar o seu
material genético no citoplasma bacteriano. Depois de isto ocorrer,
O fago prossegue ao longo de apenas um dos dois ciclos alternativos,
conhecido como o ciclo lítico e o ciclo lisogénico. Este tópico é
também discutido no Capítulo 7 (ver Figura 7.10).


 During the lytic
cycle, the genetic instructions of the bacteriophage direct the
synthesis of many copies of the phage genetic material and coat
proteins that are then assembled to make new phages. When synthesis
and assembly are completed, the bacterial host cell is lysed,
and the newly made phages are released into the environment.
Alternatively, in the lysogenic cycle, the phage can act as a
temperate phage, which usually does not produce new phages
and does not kill the bacterial cell that acts as its host. During
the lysogenic cycle, phage λ integrates its genetic material into
the chromosome of the bacterium. This integrated phage DNA is
known as a prophage. A prophage can exist in a dormant state
for a long time, during which no new bacteriophages are made.
When a bacterium containing a lysogenic prophage divides to
produce two daughter cells, it copies the prophage’s genetic material
along with its own chromosome. Therefore, both daughter
cells inherit the prophage. At some later time, in a process called
induction, a prophage may become activated to excise itself
from the bacterial chromosome and enter the lytic cycle. During
induction, the phage promotes the synthesis of new phages and
eventually lyses the host cell.
Inside the virus particle, phage λ DNA is linear. After injection
into the bacterium, the two ends of the DNA become covalently
attached to each other to form a circular piece of DNA.
Figure 14.20 shows the genome of phage λ. The organization of
the genes within this circular structure reflects the two alternative
cycles of this virus. The genes in the top center of the figure
are transcribed very soon after infection. This occurs at the
beginning of either reproductive cycle. As we will see, the expression
pattern of these early genes determines whether the lytic or
lysogenic cycle prevails.
If the lysogenic cycle prevails, the integrase (int) gene is
subsequently turned on. The integrase gene encodes an enzyme
that integrates the λ DNA into the bacterial chromosome. (The
mechanism of phage λ integration is described in Chapter 17 .) If
the lysogenic cycle is not chosen, the genes on the right side and
bottom of the figure are transcribed. These genes are necessary for
the synthesis of new phages. They encode replication proteins, coat
proteins, proteins involved in coat assembly, proteins involved in
packaging the DNA into the phage head, and enzymes that cause
the bacterium to lyse.

Durante o lítica
ciclo, as instruções genéticas do bacteriófago a dirigir
a síntese de várias cópias do material genético e no revestimento do fago
proteínas que são então montados para fazer novos fagos. Quando a síntese
e montagem sejam concluídas, a célula hospedeira bacteriana é lisadas,
e os fagos recém-feitas são liberados no meio ambiente.
Em alternativa, no ciclo lisogénica, o fago pode actuar como um
fago temperado, o que geralmente não produz novos fagos
e não mata a célula bacteriana que actua como seu hospedeiro. Durante
o ciclo lisogênico, fago λ integra o seu material genético nas
no cromossoma da bactéria. Este ADN do fago é integrado
conhecido como um profago. A prophage pode existir em um estado dormente
por um longo período de tempo, durante o qual não há novos bacteriófagos são feitos.
Quando uma bactéria lisogénica que contém um profago divide a
produzir duas células-filhas, ele copia-los material genético prophage
juntamente com o seu próprio cromossoma. Portanto, tanto filha
células herdar o prophage. Em algum tempo depois, em um processo chamado
indução, um profago pode tornar-se activado para excisar-se
a partir do cromossoma bacteriano e introduzir o ciclo lítico. Durante
indução, o fago promove a síntese de novos fagos e
eventualmente, lise da célula hospedeira.
Dentro da partícula do vírus, fago λ ADN é linear. Após a injecção
na bactéria, as duas extremidades do ADN tornar-se covalentemente
ligados uns aos outros para formar uma peça circular de ADN.
Figura 14.20 mostra o genoma de fago λ. A organização do
os genes dentro desta estrutura circular reflecte os dois alternativa
ciclos deste vírus. Os genes no centro da parte superior da figura
são transcritos muito mais rapidamente após a infecção. Isto ocorre no
começando de qualquer ciclo reprodutivo. Como veremos, a expressão
padrão destes genes precoces determina se o lítico ou
ciclo lisogênico prevalece.
Se o ciclo lisogênico prevalece, a (int) gene da integrase seja
posteriormente ligado. O gene codifica uma enzima integrase
que integra a λ ADN no cromossoma bacteriano. (O
mecanismo de integração fago λ é descrito no Capítulo 17). Se
o ciclo lisogênico não é escolhido, os genes do lado direito e
parte inferior da figura estão transcritos. Estes genes são necessários para a
a síntese de novos fagos. Eles codificam proteínas de replicação, casaco
proteínas, proteínas envolvidas no conjunto do revestimento, proteínas envolvidas na
o empacotamento do ADN na cabeça do fago, e enzimas que causam
lisar a bactéria.


The Choice Between the Lytic or Lysogenic Cycle
Depends on the Relative Levels of the cII
and Cro Proteins
Now that we understand the phage λ reproductive cycles and
genome organization, let’s examine how the decision is made
between the lytic and lysogenic cycles. This choice depends on
the actions of certain genetic regulatory proteins.
Soon after the λ DNA enters the bacterial cell, two promoters,
designated PL and PR, are used for transcription. This
initiates a competition between the lytic and lysogenic cycles
(Figure 14.21 ). Initially, transcription from PL and PR results in
the synthesis of two short RNA transcripts that encode two proteins
called the N protein and the cro protein, both of which are
genetic regulatory proteins. The N protein is a genetic regulatory
protein with an interesting function that we have not yet considered.
Its function, known as antitermination, is to prevent
transcriptional termination. The N protein inhibits termination
at three sites, designated tL, tR1, and tR2. The N protein actually
binds to RNA polymerase and prevents transcriptional termination
when these sites are being transcribed. When the N protein
prevents termination at tR1 and tR2, the transcript from PR
is extended to include the cII, O, P, and Q genes. The cII gene
encodes an activator protein, the O and P genes encode enzymes
needed for the initiation of λ DNA synthesis, and the Q gene
encodes another antiterminator that is required for the lytic cycle.
When the N protein prevents termination at tL, the transcript
from PL is extended to include the int, xis, and cIII genes. The
int gene encodes integrase, which is involved with integrating λ
DNA into the E. coli chromosome, and the xis gene encodes excisionase,
which can excise the λ DNA if a switch is made from the
lysogenic to the lytic cycle. The cIII gene encodes the cIII protein,
which inhibits a cellular protease and thereby makes cII less vulnerable
to protease digestion.

A escolha entre as Lytic ou ciclo lisogênico
Depende dos níveis relativos do cll
e Cro Proteínas
Agora que entendemos ciclos reprodutivos do fago λ e
organização do genoma, vamos examinar como a decisão é tomada
entre o lítica e ciclos lysogenic. Esta escolha depende
as ações de certas proteínas reguladoras genéticos.
Logo após a λ ADN entra na célula bacteriana, dois promotores,
PL e PR designado, são utilizados para a transcrição. este
inicia uma competição entre o lítica e ciclos lysogenic
(Figura 14.21). Inicialmente, a transcrição a partir de PL e PR resulta
a síntese de dois transcritos de ARN curtos que codificam duas proteínas
chamado a proteína N e a proteína cro, ambos os quais são
proteínas reguladoras genéticos. A proteína N é um genética reguladora
proteína com uma função interessante que nós ainda não ter considerado.
A sua função, conhecido como antitermination, é para prevenir
de terminação da transcrição. A proteína inibe a terminação N
em três locais, designada LT, TR1, e TR2. A proteína N realmente
liga-se à ARN-polimerase e de terminação da transcrição impede
quando esses sites estão sendo transcritas. Quando a proteína N
impede a terminação TR1 e TR2, a transcrição a partir de PR
é alargado para incluir a cll, O, P, Q e genes. O gene cll
codifica uma proteína activadora, os genes S e P codificam enzimas
necessária para a iniciação da síntese de ADN λ, e o gene Q
codifica outro antiterminator que é necessário para o ciclo lítico.
Quando a proteína N impede rescisão a tL, a transcrição
do PL é estendido para incluir o int, xis, e genes CIII. o
gene codifica int integrase, que está envolvido com a integração de λ
ADN no cromossoma de E. coli e o gene codifica XIS excisionase,
que pode excisar o ADN λ se um interruptor for feita a partir da
lisogénica para o ciclo lítico. O gene codifica a proteína cIII CHI,
que inibe uma protease celular e, assim, faz cll menos vulnerável
a digestão por proteases.


As shown at the bottom of Figure 14.21, if the cII protein
accumulates to sufficient levels, the lysogenic cycle is favored.
Alternatively, if the level of the cro protein becomes high, the
lytic cycle prevails. What environmental factors determine
whether the lytic or lysogenic cycle prevails? A critical issue is
that the cII protein is easily degraded by a cellular protease that
is produced by E. coli. Whether or not this protease is made
at high levels depends on the environmental conditions. If the
growth conditions are very favorable, such as a rich growth
medium, the intracellular protease levels are relatively high, and
the cII protein tends to be degraded. In this case, the cro protein
slowly accumulates to sufficient levels. Therefore, environmental
conditions that are favorable for growth promote the lytic cycle.
This makes sense, because a sufficient supply of nutrients is necessary
to synthesize new bacteriophages.
Alternatively, starvation conditions favor the lysogenic cycle.
When nutrients are limited, the cellular protease level is relatively
low. Under these conditions, the cII protein builds up much more
quickly than the cro protein. This event favors the lysogenic cycle.
From the perspective of the bacteriophage, lysogeny may be a better
choice under starvation conditions because nutrients may be
insufficient for the production of new λ phages.
Integrase and the λ Repressor Control the
Lysogenic Cycle
Let’s now consider how the lysogenic cycle is followed (Figure
14.22a ). If the level of cII-cIII complex becomes high, the
cII protein activates two different promoters in the λ genome.
When the cII protein binds to the promoter PRE, it turns on the
transcription of cI, a gene that encodes the λ repressor. The cII
protein also activates the int gene by binding to the promoter
PI. The λ repressor and integrase proteins play central roles in
promoting the lysogenic cycle. When the λ repressor is made in
sufficient quantities, it binds to operator sites (OL and OR) that
are adjacent to PL and PR. When the λ repressor is bound to
OR, it inhibits the expression of the genes required for the lytic
cycle.

Tal como mostrado na parte inferior da figura 14.21, se a proteína cll
acumula para níveis suficientes, o ciclo lisogênico é favorecida.
Alternativamente, se o nível da proteína cro torna-se elevada, o
ciclo lítico prevalece. Que fatores ambientais determinam
se o ciclo lítico ou lisogênico prevalece? Uma questão crítica é
que a proteína cll é facilmente degradada por uma protease celular que
é produzido por E. coli. Seja ou não este protease é feito
em níveis elevados depende das condições ambientais. Se o
condições de crescimento são muito favoráveis, tais como um crescimento rico
meio, os níveis de protease intracelular são relativamente elevados, e
a proteína cll tende a ser degradada. Neste caso, a proteína cro
lentamente acumula para níveis suficientes. Portanto, ambiental
condições que são favoráveis ​​para o crescimento promover o ciclo lítico.
Isso faz sentido, porque uma oferta suficiente de nutrientes é necessário
para sintetizar novos bacteriófagos.
Alternativamente, as condições de fome favorecer o ciclo lysogenic.
Quando os nutrientes estão limitados, ao nível da protease celular é relativamente
baixo. Sob estas condições, a proteína cll acumula-se muito mais
rapidamente do que a proteína cro. Este evento favorece o ciclo lisogénico.
Do ponto de vista do bacteriófago, lisogenia pode ser uma melhor
escolha em condições de fome porque nutrientes podem ser
insuficiente para a produção de novos fagos X.
Integrase ea λ repressor Controle
Ciclo lysogenic
Vamos agora considerar como o ciclo lisogênico é seguido (Figura
14.22a). Se o nível de complexo cll-cIII torna-se elevada, o
proteína cll activa dois promotores diferentes no genoma λ.
Quando a proteína cll liga-se ao promotor PRÉ, que liga o
transcrição de Ci, um gene que codifica o repressor λ. O cll
proteína também activa o gene int por ligação ao promotor
PI. As proteínas do repressor e integrase de X desempenham papéis centrais em
promover o ciclo lisogénico. Quando o repressor é feita em λ
quantidades suficientes, ele liga-se a locais do operador (OL e OR) que
são adjacentes ao PL e PR. Quando o repressor é obrigado a λ
OR, que inibe a expressão dos genes necessários para a lítico
ciclo.


Notice in Figure 14.22a that the binding of the λ repressor
to OR will inhibit the expression of cII. This may seem counterintuitive,
because the cII protein was initially required to activate
the cI gene that encodes the λ repressor. You may be thinking that
the inhibition of the cII gene eventually prevents the expression
of the cI gene and ultimately stops the synthesis of the λ repressor
protein. What prevents the inhibition of cI gene expression?
The explanation is that the cI gene actually has two promoters:
PRE, which is activated by the cII protein, and a second promoter
called PRM. Transcription from PRE occurs early in the lysogenic
cycle. PRE gets its name because the use of this promoter results
in the expression of the λ Repressor during the Establishment of
the lysogenic cycle. The transcript made from the use of PRE is
very stable and quickly leads to a buildup of the λ repressor protein.
This causes an abrupt inhibition of the lytic cycle because
the binding of the λ repressor protein to OR blocks the PR promoter.
Later in the lysogenic cycle, it is no longer necessary to
make a large amount of the λ repressor. At this point, the use of
the PRM promoter is sufficient to make enough Repressor protein
to Maintain the lysogenic cycle. Interestingly, the PRM promoter
is activated by the λ repressor protein. The λ repressor was
named when it was understood that it repressed the lytic cycle.
Later studies revealed that it also activates its own transcription
from PRM.
After the lysogenic cycle is established, certain environmental
conditions can also favor induction to the lytic cycle at
some later time. For example, exposure to UV light promotes
induction. This also is caused by the activation of cellular proteases.
In this case, a cellular protein known as recA (a protein
ordinarily involved in facilitating recombination between DNA
molecules) detects the DNA damage from UV light and is activated
to become a mediator of protein cleavage. RecA protein
mediates the cleavage of the λ repressor, thereby inactivating it.
This allows transcription from PR and eventually leads to the
accumulation of the cro protein, which thereby favors the lytic
cycle. Under these conditions, it may be advantageous for λ
to make new phages and lyse the cell, because the exposure to
UV light may have already damaged the bacterium to the point
where further bacterial growth and division are prevented.

Note na Figura 14.22a que a ligação do repressor λ
a OR irá inibir a expressão de cll. Isto pode parecer contra-intuitivo,
porque a proteína cll foi inicialmente necessária para activar
o gene cl que codifica o repressor λ. Você pode estar pensando que
a inibição do gene cll, eventualmente, impede a expressão
do gene cl e, finalmente interrompe a síntese do repressor λ
proteína. O que evita a inibição da expressão do gene cl?
A explicação é que o gene cl, na verdade, tem dois promotores:
PRÉ, o qual é activado pela proteína cll, e um segundo promotor
chamado PRM. Transcrição da PRE ocorre no início do lysogenic
ciclo. PRE recebe este nome porque a utilização desta resultados promotor
na expressão do repressor λ durante o estabelecimento de
o ciclo lisogénico. A transcrição feita a partir da utilização do PRE é
muito estável e rapidamente leva a uma acumulação da proteína repressora λ.
Isto provoca uma inibição abrupta do ciclo lítico porque
a ligação da proteína λ repressor para o promotor ou blocos PR.
Mais tarde no ciclo lysogenic, não é mais necessário
fazer uma grande quantidade do repressor λ. Neste ponto, o uso de
o promotor PRM é suficiente para fazer o suficiente proteína repressora
para manter o ciclo lysogenic. Curiosamente, o promotor PRM
é activado pela proteína repressora λ. O repressor foi λ
nomeado quando foi entendido que reprimiu o ciclo lítico.
Estudos posteriores revelaram que ele também ativa a sua própria transcrição
da PRM.
Depois é estabelecido o ciclo lysogenic, certo ambiental
condições também pode favorecer a indução do ciclo lítico em
algum tempo mais tarde. Por exemplo, a exposição à luz UV promove
indução. Isto também é causada pela activação de proteases celulares.
Neste caso, uma proteína celular conhecido como recA (uma proteína
normalmente envolvido na facilitação da recombinação entre ADN
moléculas) detecta o dano de ADN a partir de luz ultravioleta e é activado
para se tornar um mediador de clivagem da proteína. Proteína RecA
medeia a clivagem do repressor λ, inactivando assim ele.
Isto permite a transcrição do PR e, eventualmente, leva à
acumulação da proteína cro, que deste modo favorece a lítico
ciclo. Sob estas condições, pode ser vantajoso para λ
para fazer novos fagos e lisar a célula, porque a exposição a
Luz UV pode já ter danificado a bactéria ao ponto
em que adicionalmente o crescimento bacteriano e divisão são impedidos.


The Lytic Cycle Depends on the Action
of the Cro Protein
If the activity of the cro protein exceeds the activity of the cII
protein, the lytic cycle prevails (Figure 14.22b). As was mentioned,
an early step in the expression of λ genes is the transcription
from PR to produce the cro protein. If the concentration of the
cro protein builds to sufficient levels, it will bind to two operator
regions: OL and OR. The binding of cro to OL inhibits transcription
from PL; the binding of cro to OR has several effects. When
the cro protein binds to OR, it inhibits transcription from PRM in
the leftward direction. This inhibition prevents the expression
of the cI gene, which encodes the λ repressor; the λ repressor is
needed to maintain the lysogenic state. Therefore, the λ repressor
cannot successfully shut down transcription from PR.
Although the binding of the cro protein to OR inhibits
transcription from PR in the rightward direction, this inhibition
occurs after the transcription of the O, P, and Q genes. The O
and P proteins are necessary for the replication of the λ DNA.
The Q protein is an antiterminator protein that permits transcription
through another promoter, designated PRʹ (not to be
confused with PR). The PRʹ promoter controls a very large operon
that encodes the proteins necessary for the phage coat, the assembly
of the coat proteins, the packaging of the λ DNA, and the lysis
of the bacterial cell (refer back to Figure 14.20). These proteins
are made toward the end of the lytic cycle. The expression of
these late genes leads to the synthesis and assembly of many new
λ phages that are released from the bacterial cell when it lyses.
The OR Region Provides a Genetic Switch
Between the Lytic and Lysogenic Cycles
Before we end this section on the λ reproductive cycles, let’s consider
how the OR region acts as a genetic switch between the two
cycles. Depending on the binding of genetic regulatory proteins to
this region, the switch can be turned to favor the lytic or lysogenic
cycle. How does this switch work? To understand the mechanism,
we need to take a closer look at the OR region (Figure 14.23 ).
The OR region contains three operator sites, designated
OR1, OR2, and OR3. These operator sites control two promoters
called PRM and PR that transcribe in opposite directions. The λ
repressor protein or the cro protein can bind to any or all of the
three operator sites. The binding of these two proteins at these
sites governs the switch between the lysogenic and lytic cycles.
Two critical issues influence this binding event. The first is the
relative affinities that the regulatory proteins have for these operator
sites. The second is the concentrations of the λ repressor
protein and the cro protein within the cell.

O ciclo lítico depende da ação
da proteína Cro
Se a actividade da proteína cro excede a actividade de cll
proteína, o ciclo lítico prevalece (Figura 14.22b). Como já foi mencionado,
um passo inicial na expressão de genes X é a transcrição
do PR para produzir a proteína cro. Se a concentração do
proteína Cro constrói a níveis suficientes, ele vai ligar-se a dois operador
regiões: OL e OR. A ligação do cro para OL inibe a transcrição
do PL; a ligação de cro a OR tem vários efeitos. Quando
a proteína se liga a cro OR, que inibe a transcrição da PRM em
o sentido para a esquerda. Esta inibição impede a expressão
do gene cl, que codifica o repressor λ; o repressor é λ
necessários para manter o estado lisogénico. Portanto, o repressor λ
não pode encerrado com êxito transcrição de PR.
Embora a ligação da proteína cro para ou inibe
a transcrição a partir de RP na direcção para a direita, esta inibição
ocorre após a transcrição dos genes O, P, Q e. O O
P e proteínas são necessárias para a replicação do ADN λ.
A proteína Q é uma proteína que permite a transcrição antiterminator
através de outro promotor, designado PR' (para não ser
confundida com PR). O promotor controla PR' uma muito grande operão
que codifica as proteínas necessárias para o revestimento do fago, o conjunto
das proteínas de revestimento, o empacotamento do ADN λ, e a lise
da célula bacteriana (ver novamente a Figura 14.20). Estas proteínas
são feitos para o fim do ciclo lítico. A expressão de
estes genes tardios conduz à síntese e montagem de muitas novas
fagos X que são liberados a partir da célula bacteriana quando se lisa.
A Região OR Fornece um interruptor genético
Entre os líticas e lysogenic Cycles
Antes de terminar esta seção sobre os ciclos reprodutivos X, vamos considerar
como a região ou age como um interruptor genético entre os dois
ciclos. Dependendo da ligação de proteínas reguladoras para genéticos
Nesta região, o interruptor pode ser ligado a favorecer a lítico ou lysogenic
ciclo. Como é que este interruptor funciona? Para compreender o mecanismo,
precisamos dar uma olhada na região do OR (Figura 14.23).
A região OU contém três locais do operador, designados
OR1, OR2, e OR3. Estes locais operador de controle de dois promotores
chamado PRM e PR que transcrever em direções opostas. O λ
proteína repressora ou a proteína Cro pode ligar-se a qualquer ou todos da
três locais do operador. A ligação destas duas proteínas a estes
Sites governa a transição entre os ciclos lysogenic e líticas.
Duas questões críticas influenciar este evento de ligação. A primeira é a
afinidades relativas que as proteínas reguladoras têm para estes operador
locais. A segunda é a concentração do repressor λ
proteína e a proteína Cro dentro da célula.

Let’s consider how an increasing concentration of the λ
repressor protein can switch on the lysogenic cycle and switch
off the lytic cycle (Figure 14.23, left side). This protein was first
isolated by Mark Ptashne and his colleagues in 1967. Their studies
showed that λ repressor binds with highest affinity to OR1,
followed by OR2 and OR3. As the concentration of the λ repressor
builds within the cell, a dimer of the λ repressor protein
first binds to OR1 because it has the highest affinity for this site.
Next, a second λ repressor dimer binds to OR2. This occurs very
rapidly, because the binding of the first dimer to OR1 favors the
binding of a second dimer to OR2. This is called a cooperative
interaction. The binding of the λ repressor to OR1 and OR2 inhibits
transcription from PR, thereby switching off the lytic cycle.
Early in the lysogenic cycle, the λ repressor protein concentration
may become so high that it occupies OR3. Eventually,
however, the λ repressor concentration begins to drop, because
the inhibition of PR decreases the synthesis of cII, which activates
the λ repressor gene from PRE. As the λ repressor concentration
gradually falls, it is first removed from OR3. This allows transcription
from PRM. As mentioned earlier, the term λ repressor
is somewhat misleading because the binding of the λ repressor
at only OR1 and OR2 acts as an activator of PRM. The ability of the
λ repressor to activate its own transcription allows the switch to
the lysogenic cycle to be maintained.
In the lytic cycle (Figure 14.23, right side), the binding of
the cro protein controls the switch. The cro protein has its highest
affinity for OR3 and has a similar affinity for OR2 and OR1.
Under conditions that favor the lytic cycle, the cro protein accumulates,
and a cro dimer first binds to OR3. This blocks transcription
from PRM, thereby switching off the lysogenic cycle.
Later in the lytic cycle, the cro protein concentration continues
to rise, so eventually it binds to OR2 and OR1. This inhibits transcription
from PR, which is not needed in the later stages of the
lytic cycle.

Vamos considerar como uma concentração crescente da λ
proteína repressora pode ligar o ciclo lisogênico e interruptor
fora do ciclo lítico (Figura 14.23, lado esquerdo). Esta proteína foi primeiro
isolado por Mark Ptashne e seus colegas em 1967. Seus estudos
mostrou que λ repressora liga-se com afinidade mais elevada para OR1,
seguido por OR2 e OR3. À medida que a concentração do repressor λ
acumula no interior da célula, um dímero da proteína repressora λ
liga-se ao primeiro OR1 porque tem a afinidade mais elevada para este local.
Em seguida, um segundo dímero se liga ao repressor λ OR2. Isto ocorre muito
rapidamente, porque a ligação do primeiro ao dímero favorece a OR1
ligação de um dímero de segunda OR2. Isso é chamado de uma cooperativa
interação. A ligação do repressor para λ OR1 e OR2 inibe
a transcrição a partir de RP, de comutação, assim, fora do ciclo lítico.
No início do ciclo lisogénico, a concentração de proteína do repressor λ
pode tornar-se tão alta que ocupa OR3. Eventualmente,
No entanto, a concentração do repressor λ começa a cair, porque
a inibição do PR diminui a síntese de cll, o qual activa
o gene repressor de λ PRE. À medida que a concentração do repressor λ
cai gradualmente, ele é removido do primeiro OR3. Isto permite que a transcrição
da PRM. Como mencionado anteriormente, o repressor λ prazo
é um pouco enganador porque a ligação do repressor λ
em apenas OR1 e OR2 age como um ativador da PRM. A capacidade do
λ repressor para ativar sua própria transcrição permite que o switch
o ciclo lisogénica para ser mantido.
No ciclo lítico (Figura 14,23, lado direito), a ligação de
a proteína cro controla o switch. A proteína cro tem seu mais alto
afinidade para OR3 e tem uma afinidade semelhante para OR2 OR1 e.
Sob condições que favorecem o ciclo lítico, a proteína acumula de Cro,
e um dímero cro primeiro liga-se ao OR3. Este bloqueia a transcrição
da PRM, comutação, assim, fora do ciclo lisogênico.
Mais tarde no ciclo lítico, a concentração de proteína Cro continua
a subir, por isso, eventualmente, ele se liga a OR2 e OR1. Isto inibe a transcrição
do PR, o que não é necessária nas fases posteriores do
ciclo lítico.

Genetic switches, like the one just described for phage λ,
represent an important form of genetic regulation. As we have
just seen, a genetic switch can be used to control two alternative
reproductive cycles of a bacteriophage. In addition, genetic
switches are also important in the developmental pathways of
bacteria and eukaryotes. For example, certain species of bacteria
can grow in a vegetative state when nutrients are abundant
but produce spores when conditions are unfavorable for growth.
The choice between vegetative growth and sporulation involves
genetic switches. Likewise, genetic switches operate in the developmental
pathways in eukaryotes. As we will discover in Chapter
23 , they are key events in the initiation of cell differentiation during
development. Studies of the phage λ life cycle have provided
fundamental information with which to understand how these
other switches can operate at the molecular level.

Interruptores genéticos, como a que acabamos de descrever para fago λ,
representam uma importante forma de regulação genética. Como temos
apenas visto, um interruptor genético pode ser usado para controlar dois alternativa
ciclos reprodutivos de um bacteriófago. Além disso, genética
comutadores também são importantes nas vias de desenvolvimento
bactérias e eucariotas. Por exemplo, certas espécies de bactérias
pode crescer em um estado vegetativo quando os nutrientes são abundantes
mas produzir esporos quando as condições são desfavoráveis para o crescimento.
A escolha entre o crescimento vegetativo ea esporulação envolve
interruptores genéticos. Do mesmo modo, os interruptores genéticos no desenvolvimento operar
vias em eucariotas. Como vamos descobrir no capítulo
23, eles são eventos-chave no início da diferenciação celular durante
desenvolvimento. Estudos do fago λ ciclo de vida forneceram
informações fundamentais com os quais a entender como estes
outros switches podem operar no nível molecular.

GENE REGULATION
IN EUKARYOTES

Gene regul ation refers to the phenomenon that the level of gene
expression can be controlled so that genes can be expressed at high
or low levels. The ability to regulate genes provides many benefits
to eukaryotic organisms, a category that includes protists, fungi,
plants, and animals. Like their prokaryotic counterparts, eukaryotic
cells need to adapt to changes in their environment. For example,
eukaryotic cells can respond to changes in nutrient availability by
enzyme adaptation, much as prokaryotic cells do. Eukaryotic cells
also respond to environmental stresses such as ultraviolet (UV)
radiation by inducing genes that provide protection against harmful
environmental agents. An example is the ability of humans to
develop a tan. The tanning response helps to protect a person’s skin
cells against the damaging effects of UV rays.
Among plants and animals, multicellularity and a more
complex cell structure also demand a much greater level of
gene regulation. The life cycle of complex eukaryotic organisms
involves the progression through developmental stages to achieve
a mature organism. Some genes are expressed only during early
stages of development, such as the embryonic stage, whereas others
are expressed in the adult. In addition, complex eukaryotic
species are composed of many different tissues that contain a
variety of cell types. Gene regulation is necessary to ensure the
differences in structure and function among distinct cell types.
It is amazing that the various cells within a multicellular organism
usually contain the same genetic material, yet phenotypically
may look quite different. For example, the appearance of a human
nerve cell seems about as similar to a muscle cell as an amoeba
is to a paramecium. In spite of these phenotypic differences, a
human nerve cell and muscle cell actually contain the same complement
of human chromosomes. Nerve and muscle cells look
strikingly different because of gene regulation rather than differences
in DNA content. Many genes are expressed in the nerve cell
and not the muscle cell, and vice versa.
The molecular mechanisms that underlie gene regulation in
eukaryotes bear many similarities to the ways that bacteria regulate
their genes. As in bacteria, regulation in eukaryotes can occur
at any step in the pathway of gene expres​sion( Figure 15.1 ). We
will begin this chapter with an exploration of gene regulation at
the level of transcription, an important form of control. In addition,
research in the past few decades has revealed that eukaryotic organisms frequently 
regulate gene expression at points other
than transcription. We will discuss some well-studied examples in
which genes are regulated at many of these other control points.

GENE REGULAMENTO
Em eucariotos

Gene Regul ção refere-se ao fenómeno de que o nível do gene
a expressão pode ser controlada de modo a que os genes podem ser expressos a alta
ou níveis baixos. A capacidade de regular genes proporciona muitos benefícios
para os organismos eucarióticos, uma categoria que inclui protistas, fungos,
plantas e animais. Como suas contrapartes procariotas, eucariotas
as células precisam para se adaptar às mudanças no seu ambiente. Por exemplo,
células eucarióticas pode responder a mudanças na disponibilidade de nutrientes por
adaptação enzima, assim como células procarióticas fazer. As células eucarióticas
também responder aos stresses ambientais, tais como luz ultravioleta (UV)
radiação por genes que induzem que fornecem proteção contra prejudicial
agentes ambientais. Um exemplo é a capacidade dos seres humanos para
desenvolvem um bronzeado. A resposta de bronzeamento ajuda a proteger a pele de uma pessoa
as células contra os efeitos nocivos dos raios UV.
Entre as plantas e animais, e um mais multicelularidade
estrutura celular complexo também exigem um nível muito maior de
regulação gênica. O ciclo de vida de organismos eucarióticos complexos
envolve a progressão através de etapas de desenvolvimento para alcançar
um organismo maduro. Alguns genes são expressos apenas durante o início
estágios de desenvolvimento, tais como o estado embrionário, enquanto outros
são expressos no adulto. Além disso, eucariótica complexo
espécies são compostos por muitos tecidos diferentes que contêm um
variedade de tipos de células. Regulação do gene é necessária para garantir a
diferenças na estrutura e função entre os tipos de células distintas.
É surpreendente que as várias células dentro de um organismo multicelular
geralmente contêm o mesmo material genético, mas fenotipicamente
pode parecer bem diferente. Por exemplo, a aparência de um ser humano
células nervosas parece tão semelhante a uma célula muscular como uma ameba
é um paramécias. Apesar destas diferenças fenotípicas, uma
célula nervosa humana e de células musculares na verdade, contêm o mesmo complemento
de cromossomas humanos. As células nervosas e musculares olhar
notavelmente diferente por causa da regulação de genes em vez de diferenças
em teor de ADN. Muitos genes são expressos na célula nervosa
e não a de células do músculo, e vice-versa.
Os mecanismos moleculares que estão na base regulação gênica em
eucariontes ter muitas semelhanças com as maneiras que as bactérias regulam
seus genes. Como em bactérias, a regulação em eucariotos pode ocorrer
em qualquer passo na via de expressão de gene (Figura 15.1). Nós
vai começar este capítulo com uma exploração da regulação gênica em
ao nível da transcrição, uma importante forma de controlo. Além,
pesquisas nas últimas décadas revelou que organismos eucarióticos freqüentemente
regular a expressão génica por outros pontos
de transcrição. Vamos discutir alguns exemplos bem estudados em
que genes são regulados em muitos desses outros pontos de controlo.

15.1 REGULATORY TRANSCRIPTION
FACTORS

The term transcription factor is broadly used to describe proteins
that influence the ability of RNA polymerase to transcribe
a given gene. We will focus our attention on transcription factors
that affect the ability of RNA polymerase to begin the transcription
process. Such transcription factors can regulate the binding of
the transcriptional apparatus to the core promoter and/or control
the switch from the initiation to the elongation stage of transcription.
Two categories of transcription factors play a key role in these
processes. In Chapter 12 , we considered general transcription
factors, which are required for the binding of RNA polymerase
to the core promoter and its progression to the elongation stage.
General transcription factors are necessary for a basal level of transcription.
In addition, eukaryotic cells possess a diverse array of
regulatory transcription factors that serve to regulate the rate of
transcription of target genes. The importance of transcription factors
is underscored by the number of genes that encode this category
of proteins. A sizeable portion of the genomes of complex
organisms such as plants and animals is devoted to the process of
gene regulation. For example, in Arabidopsis thaliana, a plant that
is used as a model organism by plant geneticists, approximately 5%
of its genome encodes transcription factors. This species has more
than 1500 different genes that encode proteins that regulate the
transcription of other genes. Similarly, 2 to 3% of the genes in the
human genome encode transcription factors.
As discussed in this section, regulatory transcription factors
exert their effects by influencing the ability of RNA polymerase
to begin transcription of a particular gene. They typically
recognize cis-acting elements that are located in the vicinity of the
core promoter. These DNA sequences are analogous to the operator
sites found near bacterial promoters. In eukaryotes, these DNA
sequences are generally known as control elements, or regulatory
elements. When a regulatory transcription factor binds to a regulatory
element, it affects the transcription of an associated gene.
For example, the binding of regulatory transcription factors may
enhance the rate of transcription (Figure 15.2a ). Such a transcription
factor is termed an activator, and the sequence it binds to is
called an enhancer. Alternatively, regulatory transcription factors
may act as repressors by binding to elements called silencers and
preventing transcription from occurring (Figure 15.2b).

15.1 TRANSCRIPTION REGULAMENTAÇÃO
FATORES

O fator de transcrição termo é amplamente usado para descrever proteínas
que influenciam a capacidade da RNA polimerase transcrever
um determinado gene. Vamos nos concentrar nossa atenção em fatores de transcrição
que afecta a capacidade de a RNA polimerase para iniciar a transcrição
processo. Tais factores de transcrição pode regular a ligação de
o aparelho de transcrição para o promotor e / ou de controlo do núcleo
o comutador a partir do início da fase de elongação da transcrição.
Duas categorias de factores de transcrição desempenham um papel chave nestes
processos. No capítulo 12, considerou-se a transcrição geral
factores, que são necessários para a ligação da ARN polimerase
ao promotor-núcleo e a sua progressão para a fase de alongamento.
Factores de transcrição gerais são necessárias para um nível basal de transcrição.
Além disso, as células eucarióticas possuem um conjunto diversificado de
factores reguladores da transcrição que servem para regular a taxa de
transcrição de genes alvo. A importância dos factores de transcrição
é sublinhada pelo número de genes que codificam esta categoria
de proteínas. Uma parte considerável dos genomas de complexo
organismos, tais como plantas e animais é dedicado ao processo de
regulação gênica. Por exemplo, em Arabidopsis thaliana, uma planta que
é utilizado como organismo modelo por geneticistas de plantas, cerca de 5%
do seu genoma codifica factores de transcrição. Esta espécie tem mais
do que 1500 genes diferentes que codificam para proteínas que regulam o
a transcrição de outros genes. Do mesmo modo, de 2 a 3% dos genes no
genoma humano codifica fatores de transcrição.
Como discutido nesta seção, fatores de transcrição regulatórios
exercem os seus efeitos influenciando a capacidade de ARN polimerase
para iniciar a transcrição de um gene em particular. Eles normalmente
reconhecem elementos cis-actuantes que se encontram na vizinhança do
promotor do núcleo. Estas sequências de ADN são análogos ao operador
sites encontrados perto promotores bacterianos. Em eucariotas, estes ADN
sequências são geralmente conhecidos como elementos de controlo, ou regulador
elementos. Quando um factor de transcrição se liga a um regulador de regulamentação
elemento, afecta a transcrição de um gene associado.
Por exemplo, a ligação de factores de transcrição reguladora pode
aumentar a taxa de transcrição (Figura 15.2a). Tal transcrição
factor é denominado um activador, e a sequência que se liga a é
chamado um potenciador. Em alternativa, os factores de transcrição reguladoras
pode actuar como repressores através da ligação a elementos chamados e silenciadores
impedindo a ocorrência de transcrição (Figura 15.2b).

By studying transcriptional regulation, researchers have
discovered that most eukaryotic genes, particularly those found
in multicellular species, are regulated by many factors. This phenomenon
is called combinatorial control because the combination
of many factors determines the expression of any given
gene. At the level of transcription, the following are common factors
that contribute to combinatorial control:
1. One or more activator proteins may stimulate the ability of
RNA polymerase to initiate transcription.
2. One or more repressor proteins may inhibit the ability of
RNA polymerase to initiate transcription.
3. The function of activators and repressors may be
modulated in a variety of ways, including the binding of
small effector molecules, protein–protein interactions, and
covalent modifications.
4. Regulatory proteins may alter the composition or
arrangements of nucleosomes in the vicinity of a promoter,
thereby affecting transcription.
5. DNA methylation may inhibit transcription, either by
preventing the binding of an activator protein or by
recruiting proteins that cause the chromatin to become
more compact.
All five of these factors can contribute to the regulation of a
single gene, or possibly only three or four will play a role. In
most cases, transcriptional regulation is aimed at controlling
the initiation of transcription at the promoter. In this section,
we will survey the first three factors that affect transcription.
In the following sections, we will consider the fourth and fifth
factors.
Structural Features of Regulatory Transcription
Factors Allow Them to Bind to DNA
Genes that encode general and regulatory transcription factor
proteins have been identified and sequenced from a wide variety
of eukaryotic species, including yeast, plants, and animals.
Several different families of evolutionarily related transcription
factors have been discovered. In recent years, the molecular
structures of transcription factor proteins have become an
area of intense research. Transcription factor proteins contain
regions, called domains, that have specific functions.
For example, one domain of a transcription factor may have
a DNA-binding function, and another may provide a binding
site for a small effector molecule. When a domain or portion
of a domain has a very similar structure in many different
proteins, such a structure is called a motif.

Ao estudar a regulação da transcrição, os pesquisadores têm
descobriu que a maioria dos genes eucariotas, particularmente aqueles encontrados
em espécies multicelulares, são regulados por muitos fatores. Este fenômeno
é chamado controlo combinatório porque a combinação
de muitos factores determina a expressão de qualquer dado
gene. Ao nível da transcrição, os seguintes são fatores comuns
que contribuem para o controle combinatória:
1. Um ou mais proteínas activadoras podem estimular a capacidade de
A ARN-polimerase para iniciar a transcrição.
2. Um ou mais proteínas repressoras podem inibir a capacidade de
A ARN-polimerase para iniciar a transcrição.
3. A função de activadores e repressores podem ser
modulado em uma variedade de formas, incluindo a ligação de
moléculas pequenas efectoras, de interacções proteína-proteína, e
Modificações covalentes.
4. proteínas reguladoras podem alterar a composição ou
arranjos de nucleossomas na proximidade de um promotor,
afectando assim a transcrição.
5. metilação de ADN pode inibir a transcrição, quer pela
impedindo a ligação de um activador de proteína ou por
recrutamento de proteínas que fazem com que a cromatina para se tornar
mais compacto.
Todos os cinco desses fatores pode contribuir para a regulação de uma
gene único, ou possivelmente apenas três ou quatro vão desempenhar um papel. Dentro
maior parte dos casos, a regulação da transcrição é destinado a controlar
a iniciação da transcrição no promotor. Nesta secção,
vamos examinar os três primeiros fatores que afetam a transcrição.
Nas seções seguintes, vamos considerar o quarto e quinto
factores.
Características estruturais da transcrição Regulatory
Fatores de permitir que eles se ligam ao DNA
Genes que codificam fator de transcrição geral e regulamentar
proteínas foram identificados e sequenciados a partir de uma ampla variedade
das espécies eucarióticas, incluindo leveduras, plantas e animais.
Várias famílias diferentes de transcrição evolutivamente relacionadas
factores foram descobertos. Nos últimos anos, o molecular
estruturas de proteínas de factor de transcrição tornaram-se um
área de intensa pesquisa. Proteínas fator de transcrição conter
regiões, domínios, chamadas que têm funções específicas.
Por exemplo, um domínio de um factor de transcrição pode ter
uma função de ligação do ADN, e outra pode fornecer uma ligação
local para uma pequena molécula efectora. Quando um domínio ou parte
de um domínio tem uma estrutura muito semelhante em muitos diferente
proteínas, uma estrutura deste tipo é chamado um motivo.


Figure 15.3 depicts several different domain structures
found in transcription factor proteins. The protein secondary
structure known as an α helix is frequently found in transcription
factors. Why is the α helix common in such proteins? The
explanation is that the α helix is the proper width to bind into
the major groove of the DNA double helix. In helix-turn-helix
and helix-loop-helix motifs, an α helix called the recognition
helix makes contact with and recognizes a base sequence along
the major groove of the DNA (Figure 15.3a and b). Recall that
the major groove is a region of the DNA double helix where the
bases contact the surrounding water in the cell. Hydrogen bonding
between an α helix and nucleotide bases is one way that a
transcription factor can bind to a specific DNA sequence. In
addition, the recognition helix often contains many positively
charged amino acids (e.g., arginine and lysine) that favorably
interact with the DNA backbone, which is negatively charged.
Such basic domains are a common feature of many DNA-binding
proteins.
A zinc finger motif is composed of one α helix and two
β-sheet structures that are held together by a zinc (Zn2+) metal
ion (Figure 15.3c). The zinc finger also can recognize DNA
sequences within the major groove.
A second interesting feature of certain motifs is that they
promote protein dimerization. The leucine zipper (Figure 15.3d)
and helix-loop-helix motif (see Figure 15.3b) mediate protein
dimerization. For example, Figure 15.3d depicts the dimerization
and DNA binding of two proteins that have several leucine amino
acids (a zipper). Alternating leucines in both proteins interact
(“zip up”), resulting in protein dimerization. Two identical transcription
factor proteins come together to form a homodimer, or
two different transcription factors can form a heterodimer. As
discussed later, the dimerization of transcription factors can be an
important way to modulate their function.

Regulatory Transcription Factors Recognize
Regulatory Elements That Function
as Enhancers or Silencers

Figura 15.3 descreve várias estruturas de domínio diferentes
encontrado em proteínas de factores de transcrio. A proteína secundária
estrutura conhecida como uma hélice α é freqüentemente encontrado na transcrição
factores. Porque é que a hélice α comum em tais proteínas? o
explicação é que a hélice α é a largura adequada para se ligar em
sulco principal da dupla hélice do DNA. Em hélice-volta-hélice
e motivos hélice-laço-hélice, uma hélice α chamado o reconhecimento
hélice faz contato com e reconhece uma sequência de bases ao longo
o sulco principal do ADN (Figura 15.3a e b). Lembre-se que
o sulco maior é uma região da dupla hélice de ADN, onde o
bases contactar a água circundante na célula. Ligação de hidrogênio
entre uma hélice e nucleótidos alfa bases é uma maneira que um
factor de transcrição pode ligar-se a uma sequência de ADN específica. Dentro
Adicionalmente, a hélice de reconhecimento frequentemente contém muitos positivamente
aminoácidos carregados (por exemplo, arginina e lisina) que favoravelmente
interagir com a estrutura de ADN, que está carregado negativamente.
Tais domínios básicas são uma característica comum de muitos de ligação de ADN
proteínas.
Um motivo de dedo de zinco é composto de uma hélice α e dois
estruturas que são unidas por uma folha de zinco β-(Zn2 +) de metal
de iões (Figura 15.3c). O dedo de zinco também pode reconhecer DNA
sequências dentro do sulco maior.
Uma segunda característica interessante de certos motivos é que eles
promover a dimerização da proteína. O fecho de leucina (Figura 15.3d)
e hélice-alça-hélice motivo (veja a Figura 15.3b) mediar proteína
dimerização. Por exemplo, a Figura 15.3d descreve a dimerização
e ligação de DNA de duas proteínas que têm vários amino leucina
ácidos (um fecho de correr). Leucinas alternadas em ambas as proteínas interagem
("Zíper"), resultando em dimerização da proteína. Dois transcrição idênticos
factor de proteínas juntam-se para formar um homodímero ou
dois factores de transcrição diferentes pode formar um heterodímero. Como
discutido mais tarde, a dimerização de factores de transcrição pode ser um
forma importante para modular a sua função.

Fatores de Transcrição reguladoras Reconhecer
Elementos reguladores que funcionam
como potenciadores ou silenciadores

As mentioned previously, when the binding of a regulatory transcription
factor to a regulatory element increases transcription,
the regulatory element is known as an enhancer. Such elements
can stimulate transcription 10- to 1000-fold, a phenomenon
known as up regulation. Alternatively, regulatory elements that
serve to inhibit transcription are called silencers, and their action
is called down regulation.
Many regulatory elements are orientation-independent,
or bidirectional. This means that the regulatory element can
function in the forward or reverse direction. For example, if the
forward orientation of an enhancer is
5ʹ–GATA–3ʹ
3ʹ–CTAT–5ʹ
this enhancer is also bound by a regulatory transcription factor
and enhances transcription even when it is oriented in the
reverse direction:
5ʹ–TATC–3ʹ
3ʹ–ATAG–5ʹ
Striking variation is also found in the location of regulatory
elements relative to a gene’s promoter. Regulatory elements
are often located in a region within a few hundred base pairs
(bp) upstream from the promoter site. However, they can be quite
distant from the promoter, even 100,000 bp away, yet exert strong
effects on the ability of RNA polymerase to initiate transcription
at the core promoter! Regulatory elements were first discovered
by Susumu Tonegawa and coworkers in the 1980s. While studying
genes that play a role in immunity, they identified a region that
is far away from the core promoter, but is needed for high levels
of transcription to take place. In some cases, regulatory elements
are located downstream from the promoter site and may even be
found within introns, the noncoding parts of genes. As you may
imagine, the variation in regulatory element orientation and location
profoundly complicates the efforts of geneticists to identify the
regulatory elements that affect the expression of any given gene.

Como mencionado anteriormente, quando a ligação de um regulador de transcrição
factor a um elemento regulador da transcrição aumenta,
o elemento regulador é conhecido como um melhorador. Tais elementos
pode estimular a transcrição de 10 a 1000 vezes, um fenómeno
conhecida como a regulação. Alternativamente elementos, que reguladoras
servem para inibir a transcrição são chamados silenciadores, e sua ação
é chamado para baixo regulamento.
Muitos elementos de regulação são independentes de orientação,
ou bidirecional. Isto significa que o elemento regulador pode
função na frente ou para trás. Por exemplo, se o
orientação para a frente de um potenciador está
5'-GATA-3'
3'-5'-CTAT
este potenciador também está vinculado por um fator de transcrição de regulamentação
e aumenta a transcrição mesmo quando ele está orientado na
direção oposta:
5'-TATC-3'
3'-5'-ATAG
Variação notável também é encontrado no local do regulador
elementos relativos ao promotor de um gene. Elementos reguladores
são muitas vezes localizados em uma região dentro de algumas centenas de pares de bases
(pb) a montante do local do promotor. No entanto, elas podem ser bastante
distante do promotor, mesmo 100.000 pb de distância, ainda exercem forte
efeitos sobre a capacidade de ARN-polimerase para iniciar a transcrição
o promotor nuclear! Elementos reguladores foram descobertos
por Susumu Tonegawa e colegas de trabalho na década de 1980. Enquanto estudava
genes que desempenham um papel na imunidade, que identificaram uma região que
é longe do promotor-núcleo, mas é necessário para níveis elevados
de transcrição ocorra. Em alguns casos, os elementos reguladores
estão localizados a jusante do local do promotor e pode até mesmo ser
encontrado dentro de intrões, as partes não codificantes dos genes. Como você pode
imaginar, a variação da orientação e localização elemento regulador
complica profundamente os esforços dos geneticistas para identificar a
elementos de regulação que influenciam a expressão de qualquer gene.


Regulatory Transcription Factors May Exert
Their Effects Through TFIID and Mediator
Different mechanisms have been discovered that explain how a
regulatory transcription factor can bind to a regulatory element
and thereby affect gene transcription. For most genes, more than
one mechanism is involved. The net effect of a regulatory transcription
factor is to influence the ability of RNA polymerase
to transcribe a given gene. However, most regulatory transcription
factors do not bind directly to RNA polymerase. How then
do most regulatory transcription factors exert their effects? For
structural genes in eukaryotes, regulatory transcription factors
commonly influence the function of RNA polymerase II by interacting
with other proteins that directly bind to RNA polymerase
II. Two protein complexes that communicate the effects of regulatory
transcription factors are TFIID and mediator.
Some regulatory transcription factors bind to a regulatory
element and then influence the function of TFIID. As discussed
in Chapter 12 , TFIID is a general transcription factor that binds
to the TATA box and is needed to recruit RNA polymerase II
to the core promoter. Activator proteins are expected to enhance
the ability of TFIID to initiate transcription. One possibility is
that activator proteins could help recruit TFIID to the TATA box
or they could enhance the function of TFIID in a way that facilitates
its ability to bind RNA polymerase II. In some cases, activator
proteins exert their effects by interacting with coactivators —
proteins that increase the rate of transcription but do not directly
bind to the DNA itself. This type of activation is shown in Figure
15.4a . In contrast, repressors inhibit the function of TFIID.
They could exert their effects by preventing the binding of TFIID
to the TATA box (Figure 15.4b) or by inhibiting the ability of
TFIID to recruit RNA polymerase II to the core promoter.
A second way that regulatory transcription factors control
RNA polymerase II is via mediator—a protein complex discovered
by Roger Kornberg and colleagues in 1990. The term mediator
refers to the observation that it mediates the interaction
between RNA polymerase II and regulatory transcription factors.
As discussed in Chapter 12 , mediator controls the ability of RNA
polymerase II to progress to the elongation stage of transcription.
Transcriptional activators stimulate the ability of mediator to
facilitate the switch between the initiation and elongation stages,
whereas repressors have the opposite effect. In the example
shown in Figure 15.5 , an activator binds to a distant enhancer
element. The activator protein and mediator are brought together
by the formation of a loop within the intervening DNA.

Fatores de Transcrição reguladoras podem exercer
Seus efeitos através TFIID e Mediador
Diferentes mecanismos têm sido descoberto que explicam como um
factor de transcrição de regulação pode ligar-se a um elemento regulador
e, assim, afectar a transcrição do gene. Para a maioria dos genes, mais do que
um mecanismo está envolvido. O efeito líquido de uma transcrição de regulamentação
fator é influenciar a capacidade de ARN polimerase
para transcrever um determinado gene. No entanto, a maior parte reguladora de transcrição
factores não se ligam directamente ao ARN polimerase. Como, então,
que a maioria dos fatores de transcrição regulatórios exercem os seus efeitos? Para
genes estruturais em eucariotas, factores de transcrição reguladoras
normalmente influenciam a função da RNA polimerase II, interagindo
com outras proteínas que se ligam directamente ao ARN polimerase
II. Dois complexos proteicos que se comunicam os efeitos de regulação
são factores de transcrição TFIID e mediador.
Alguns factores de transcrição ligam-se a uma regulação regulamentar
elemento e, em seguida, influenciar a função de TFIID. Como discutido
no Capítulo 12, TFIID é um fator de transcrição geral que se liga
a caixa TATÁ e é necessária para recrutar RNA polimerase II
ao promotor-núcleo. Proteínas activadoras são esperados para melhorar
a capacidade de TFIID para iniciar a transcrição. Uma possibilidade é
que as proteínas ativadoras poderia ajudar a recrutar TFIID para a caixa TATA
ou eles podem melhorar a função de TFIID de uma maneira que facilita
a sua capacidade de se ligar RNA polimerase II. Em alguns casos, activador
proteínas exercem os seus efeitos através da interação com coactivators -
proteínas que aumentam a taxa de transcrição, mas não fazer directamente
ligar-se ao próprio DNA. Este tipo de activação é mostrado na figura
15.4a. Em contraste, repressores inibir a função de TFIID.
Eles podem exercer os seus efeitos, impedindo a ligação de TFIID
a caixa TATÁ (Figura 15.4b) ou através da inibição da capacidade de
TFIID para recrutar a RNA polimerase II para o promotor nuclear.
A segunda maneira que a transcrição regulamentar fatores de controle
ARN polimerase II é mediador através de um complexo proteína-descoberto
Roger Kornberg e por colegas em 1990. O termo mediador
refere-se à observação de que medeia a interacção
entre a ARN polimerase II e factores de transcrição reguladoras.
Como discutido no Capítulo 12, mediador controla a capacidade de RNA
polimerase II de progredir para a fase de alongamento de transcrição.
Activadores da transcrição estimular a capacidade de mediador para
facilitar a transição entre as fases de iniciação e alongamento,
Considerando repressores ter o efeito oposto. No exemplo
mostrado na Figura 15.5, um activador liga-se a um intensificador distante
elemento. A proteína ativadora e mediador são reunidos
através da formação de um laço no ADN interveniente.

A third way that regulatory transcription factors can influence
transcription is by recruiting proteins to the promoter
region that affect nucleosome positions and compositions. For
example, certain transcriptional activators can recruit proteins to
the promoter region that promote the conversion of chromatin
from a closed to an open conformation. We will return to this
topic later in this chapter.
The Function of Regulatory Transcription Factor
Proteins Can Be Modulated in Three Ways
Thus far, we have considered the structures of regulatory transcription
factors and the molecular mechanisms that account for
their abilities to control transcription. The functions of the regulatory
transcription factors themselves must also be modulated.
Why is this necessary? The answer is that the genes they control
must be turned on at the proper time, in the correct cell type,
and under the appropriate environmental conditions. Therefore,
eukaryotes have evolved different ways to modulate the functions
of these proteins.
The functions of regulatory transcription factor proteins
are controlled in three common ways: through (1) the binding of
a small effector molecule, (2) protein–protein interactions, and
(3) covalent modifications. Figure 15.6 depicts these three mechanisms
of modulating regulatory transcription factor function.
Usually, one or more of these modulating effects are important
in determining whether a transcription factor can bind to the
DNA or influence transcription by RNA polymerase. For example,
a small effector molecule may bind to a regulatory transcription
factor and promote its binding to DNA (Figure 15.6a). We
will see that steroid hormones function in this manner. Another
important way is via protein–protein interactions (Figure 15.6b).
The formation of homodimers and heterodimers is a fairly common
means of controlling transcription. Finally, the function
of a regulatory transcription factor can be affected by covalent
modifications such as the attachment of a phosphate group (Figure
15.6c). As discussed later, the phosphorylation of activators
can control their ability to stimulate transcription.
Steroid Hormones Exert Their Effects by Binding
to a Regulatory Transcription Factor
Now that we have a general understanding of the structure and
function of transcription factors, let’s turn our attention to specific
examples that illustrate how regulatory transcription factors carry
out their roles within living cells. Our first example is a category
that responds to steroid hormones. This type of regulatory transcription
factor is known as a steroid receptor, because the steroid
hormone binds directly to the protein.

Uma terceira maneira de que factores de transcrição podem influenciar regulamentação
transcrição é através do recrutamento de proteínas para o promotor
região que afetam posições nucleossomos e composições. Para
exemplo, certos activadores da transcrição pode recrutar a proteínas
região do promotor que promovem a conversão de cromatina
a partir de uma conformação fechada para uma aberta. Voltaremos a este
tópico mais adiante neste capítulo.
A função do fator de transcrição Regulatory
As proteínas podem ser modulados de três maneiras
Até o momento, nós consideramos as estruturas de transcrição de regulamentação
fatores e os mecanismos moleculares que são responsáveis ​​por
a sua capacidade para controlar a transcrição. As funções do regulador
factores de transcrição, também eles, devem ser modulados.
Por que isso é necessário? A resposta é que os genes que controlam
deve ser ativado no momento adequado, no tipo de célula correta,
e sob as condições ambientais apropriadas. Portanto,
eucariotas desenvolveram diferentes formas de modular as funções
destas proteínas.
As funções das proteínas factor de transcrição de regulamentação
são controladas em três maneiras comuns: através de (1) a ligação de
uma pequena molécula efectora, (2) interacções proteína-proteína, e
(3) modificações covalentes. A Figura 15.6 ilustra estes três mecanismos
de modulação da função do factor de transcrição de regulamentação.
Normalmente, um ou mais destes efeitos moduladores são importantes
para determinar se um factor de transcrição pode ligar-se ao
ADN ou influência de transcrição por ARN-polimerase. Por exemplo,
uma pequena molécula efectora pode ligar-se a um regulador de transcrição
fator e promover a sua ligação ao ADN (Figura 15,6). Nós
vai ver que os hormônios esteróides funcionar dessa maneira. Outro
maneira importante é através de interacções proteína-proteína (Figura 15.6b).
A formação de homodímeros e heterodímeros é bastante comum
Os meios de controlo da transcrição. Finalmente, a função
de um factor de transcrição de regulação pode ser afectada pela covalente
modificações tais como a ligação de um grupo fosfato (Figura
15.6c). Conforme discutido mais tarde, a fosforilação de activadores
pode controlar a sua capacidade de estimular a transcrição.
Hormonas esteróides exercem os seus efeitos através da ligação
de um factor de transcrição de regulamentação
Agora que temos uma compreensão geral da estrutura e
função de fatores de transcrição, vamos voltar nossa atenção para específico
exemplos que ilustram como regulamentar fatores de transcrição carregam
seus papéis dentro de células vivas. O nosso primeiro exemplo é uma categoria
que responde a esteróide hormônios. Este tipo de regulação da transcrição
factor é conhecido como um receptor de esteróides, porque o esteróide
hormona se liga directamente à proteína.


The ultimate action of a steroid hormone is to affect gene
transcription. In animals, steroid hormones act as signaling molecules
that are synthesized by endocrine glands and secreted into
the bloodstream. The hormones are then taken up by cells that
can respond to the hormones in different ways. For example,
glucocorticoid hormones influence nutrient metabolism in most
body cells. Other steroid hormones, such as estrogen and testosterone,
are called gonadocorticoids because they influence the
growth and function of the gonads.
Figure 15.7 shows the stepwise action of glucocorticoid
hormones, which are produced in mammals. In this example,
the hormone enters the cytosol of a cell by diffusing through the
plasma membrane. Once inside, the hormone specifically binds
to glucocorticoid receptors. Prior to hormone binding, the glucocorticoid
receptor is complexed with proteins known as heat
shock proteins (HSP), one example being HSP90. After the hormone
binds to the glucocorticoid receptor, HSP90 is released.
This exposes a nuclear localization signal (NLS)—a signal that
directs a protein into the nucleus. Two glucocorticoid receptors
form a homodimer and then travel through a nuclear pore into
the nucleus. How does the glucocorticoid receptor regulate the expression
of particular genes? In the nucleus, the glucocorticoid receptor
homodimer binds to DNA sites with the following consensus
sequence:
5ʹ–AGRACA–3ʹ
3ʹ–TCYTGT–5ʹ
where R is a purine and Y is pyrimidine. A glucocorticoid
response element (GRE) contains two of these sequences in
opposite directions (Figure 15.7). A GRE is found next to many
genes and functions as an enhancer. The binding of the glucocorticoid
receptor homodimer to a GRE activates the transcription
of the nearby gene, eventually leading to the synthesis of the
encoded protein.
Mammalian cells usually have a large number of glucocorticoid
receptors within the cytoplasm. Because GREs are located
near dozens of different genes, the uptake of many hormone
molecules can activate many glucocorticoid receptors, thereby
stimulating the transcription of many different genes. For this
reason, a cell can respond to the presence of the hormone in a
very complex way. Glucocorticoid hormones stimulate many
genes that encode proteins involved in several different cellular
processes, including the synthesis of glucose, the breakdown of
proteins, and the mobilization of fats. Although the genes are not
physically adjacent to each other, the regulation of multiple genes
via glucocorticoid hormones is much like the ability of bacterial
operons to simultaneously control the expression of several genes.

A ação final de um hormônio esteróide é afetar gene
transcrição. Em animais, hormônios esteróides atuam como moléculas sinalizadoras
que são sintetizados pelas glândulas endócrinas e segregada para
a corrente sanguínea. As hormonas são então absorvidos pelas células que
pode responder às hormonas de maneiras diferentes. Por exemplo,
hormonas glucocorticóides influenciar o metabolismo dos nutrientes na maioria
células do corpo. Outros hormônios esteróides, como estrogênio e testosterona,
são chamados gonadocorticoids porque influenciam a
crescimento e função das gônadas.
Figura 15.7 mostra a acção de glicocorticóide gradual
hormonas, que são produzidos em mamíferos. Neste exemplo,
a hormona entra no citosol de uma célula por difusão através da
Membrana Plasmática. Uma vez lá dentro, o hormônio se liga especificamente
para glicocorticóide receptores. Antes Hormone Binding, o glucocorticóide
receptor é complexado com proteínas conhecidas como calor
As proteínas de choque (HSP), sendo um exemplo HSP90. Após a hormona
liga-se ao receptor de glucocorticóides, a HSP90 é libertado.
Isso expõe um sinal de localização nuclear (NLS) sinal de que -a
dirige a proteína para dentro do núcleo. Dois receptores de glucocorticóides
formar um homodímero e, em seguida, viajar através de um poro nuclear em
o núcleo. Como o receptor de glucocorticóides regulam a expressão
de genes particulares? No núcleo, o receptor de glucocorticóide
homodímero liga-se a locais do ADN com a sequência de consenso
sequência:
5'-AGRACA-3'
3'-5'-TCYTGT
em que R é uma purina e Y é pirimidina. Um glucocorticóide
elemento de resposta (GRE) contém duas destas sequências em
sentidos opostos (Figura 15.7). A GRE é encontrado ao lado de muitos
genes e funciona como um intensif icador. A ligação do glucocorticóide
homodimero receptor para um GRE activa a transcrição
do gene próximo, levando à síntese do
proteína codificada.
As células de mamíferos têm geralmente um grande número de glucocorticóide
receptores dentro do citoplasma. Porque GRE estão localizados
perto de dezenas de diferentes genes, a absorção de muitos hormônio
moléculas pode ativar muitos receptores de glicocorticóides, assim,
estimulação da transcrição de muitos genes diferentes. Por esta
motivo, uma célula pode responder à presença da hormona numa
maneira muito complexa. Hormônios glicocorticóides estimulam muitos
genes que codificam proteínas envolvidas em vários celulares diferentes
processos, incluindo a síntese de glicose, a repartição dos
proteínas e a mobilização de gorduras. Embora os genes que não são
fisicamente adjacentes uns aos outros, a regulação de vários genes
via hormônios glicocorticóides é muito parecido com a capacidade dos bacteriana
operões para controlar simultaneamente a expressão de vários genes.


The CREB Protein Is an Example
of a Regulatory Transcription Factor
Modulated by Covalent Modification
As we have just seen, steroid hormones function as signaling molecules
that bind directly to regulatory transcription factors to alter
their function. This enables a cell to respond to a hormone by
up-regulating a particular set of genes. Most extracellular signaling
molecules, however, do not enter the cell or bind directly to
transcription factors. Instead, most signaling molecules must bind
to receptors in the plasma membrane. This binding activates the
receptor and may lead to the synthesis of an intracellular signal
that causes a cellular response. One type of cellular response is to
affect the transcription of particular genes within the cell.
As our second example of regulatory transcription factor
function within living cells, we will examine the cAMP response
element-binding protein (CREB protein). The CREB protein is a
regulatory transcription factor that becomes activated in response
to cell-signaling molecules that cause an increase in the cytoplasmic
concentration of the molecule cyclic adenosine monophosphate
(cAMP). This transcription factor recognizes a DNA site
that has two adjacent copies of the following consensus sequence.
5ʹ–TGACGTCA–3ʹ
3ʹ–ACTGCAGT–5ʹ
This response element, which is found near many different genes,
has been termed a cAMP response element (CRE).
Figure 15.8 shows the steps leading to the activation of
the CREB protein. A wide variety of hormones, growth factors,
neurotransmitters, and other signaling molecules can bind to
plasma membrane receptors to initiate an intracellular response. In
this case, the response involves the production of a second messenger,
cAMP. The extracellular signaling molecule itself is considered
the primary messenger. When the signaling molecule binds to
the receptor, it activates a G protein that subsequently activates the
enzyme adenylyl cyclase. The activated adenylyl cyclase catalyzes
the synthesis of cAMP. The cAMP molecule then binds to a second
enzyme, protein kinase A, and activates it. This enzyme travels into
the nucleus and phosphorylates several different cellular proteins,
including CREB proteins. When phosphorylated, CREB proteins
stimulate transcription. In contrast, unphosphorylated CREB proteins
can still bind to CREs but do not activate RNA polymerase.

A proteína é um exemplo de CREB
de um factor de transcrição de regulamentação
Modulado por Covalente Modificação
Como acabamos de ver, hormonas esteróides funcionam como moléculas de sinalização
que se ligam diretamente a fatores de transcrição regulatórios para alterar
a sua função. Isso permite que uma célula para responder a uma hormona pela
up-regulação de um determinado conjunto de genes. Sinalização mais extracelular
moléculas, no entanto, não entram na célula ou para se ligar directamente
factores de transcrição. Em vez disso, a maioria das moléculas de sinalização deve ligar
a receptores na membrana plasmática. Esta ligação activa o
do receptor e pode conduzir à síntese de um sinal intracelular
que provoca uma resposta celular. Um tipo de resposta celular é a
afectam a transcrição de genes específicos dentro da célula.
Como nosso segundo exemplo de fator de transcrição de regulamentação
função dentro de células vivas, vamos examinar a resposta cAMP
proteína (proteína CREB) de ligação do elemento. A proteína é uma CREB
factor regulador da transcrição que torna-se activado em resposta
a moléculas de sinalização de células que causam um aumento na citoplasmática
concentração do monofosfato cíclico de adenosina molécula
(acampar). Este factor de transcrição de ADN reconhece um local
que tem duas cópias adjacentes da seguinte sequência de consenso.
5'-TGACGTCA-3'
3'-5'-ACTGCAGT
Este elemento de resposta, que é encontrada próximo de muitos genes diferentes,
foi denominado um elemento de resposta a cAMP (CRE).
Figura 15.8 mostra os passos que levam à ativação de
a proteína CREB. Uma grande variedade de hormonas, factores de crescimento,
neurotransmissores, e outras moléculas de sinalização pode se ligam aos
receptores de membrana plasmática para iniciar uma resposta intracelular. Dentro
Neste caso, a resposta envolve a produção de um segundo mensageiro,
acampar. A molécula de sinalização extracelular si é considerado
o mensageiro primário. Quando a molécula se liga a sinalização
do receptor, que activa uma proteína G que activa a subsequentemente
enzima adenilil-ciclase. Os catalisa adenilil ciclase activada
a síntese de cAMP. A molécula de cAMP, em seguida, liga-se a uma segunda
enzima, proteína quinase A, e activa-o. Esta enzima viaja para dentro
o núcleo e fosforila várias proteínas celulares diferentes,
incluindo proteínas CREB. Quando fosforilada, proteínas CREB
estimular a transcrição. Em contraste, as proteínas CREB fosforilado
pode ainda ligar para CREs mas não ativar RNA polimerase.

15.2 CHROMATIN REMODELING,
HISTONE VARIATION, AND HISTONE
MODIFICATION
The term ATP-dependent chromatin remodeling, or simply chromatin
remodeling, refers to dynamic changes in the structure
of chromatin that occur during the life of a cell. These changes
nucleosomes to larger changes that affect chromatin structure
over a longer distance. Chromatin remodeling is carried out by
ATP-dependent chromatin-remodeling complexes, which are a
set of diverse multiprotein machines that reposition and restructure
nucleosomes.
In eukaryotes, changes in nucleosome position and histone
composition are key features of gene regulation. The regulation
of transcription depends not only on the activity of regulatory
transcription factors that influence RNA polymerase via TFIID
and mediator to turn genes on or off, but must also involve
changes in chromatin structure that affect the ability of transcription
factors to gain access to and bind their target sequences
in the promoter region. If the chromatin is in a closed conformation,
transcription may be difficult or impossible. By comparison,
chromatin that is in an open conformation is more
easily accessible to transcription factors and RNA polymerase
so that transcription can occur. Although the closed and open
conformations may be affected by the relative compaction of a
chromosomal region, researchers have recently determined that
histone composition and the precise positioning of nucleosomes
at or near promoters often play a key role in eukaryotic gene
regulation. In this section, we examine molecular mechanisms
that explain how changes in chromatin structure can control the
regulation of eukaryotic genes.
Chromatin Remodeling Complexes Alter the
Positions and Compositions of Nucleosomes
In recent years, geneticists have been trying to identify the steps
that promote the interconversion between the closed and open
conformations of chromatin. Nucleosomes have been shown to
change position in cells that normally express a particular gene
compared with cells in which the gene is inactive. For example,
in reticulocytes that express the β-globin gene, an alteration
in nucleosome positioning occurs in the promoter region
from nucleotide –500 to +200. This alteration is thought to be
an important step in gene activation. Based on the analysis of
many genes, researchers have discovered that a key role of some
transcriptional activators is to orchestrate changes in chromatin
structure from the closed to the open conformation by altering
nucleosomes.

15,2 CROMATINA remodelação,
VARIAÇÃO HISTONA, E HISTONA
MODIFICAÇÃO
O termo remodelação da cromatina dependente de ATP, ou simplesmente cromatina
remodelação, refere-se a mudanças dinâmicas na estrutura
da cromatina que ocorrem durante a vida de uma célula. Estas alterações
nucleossomas para maiores alterações que afectam a estrutura da cromatina
ao longo de uma distância mais longa. Remodelação da cromatina é levada a cabo pela
Os complexos de remodelação da cromatina dependentes de ATP, que são um
conjunto de diversas máquinas multiprotein que reposicionar e reestruturar
nucleossomos.
Em eucariotos, as mudanças na posição nucleosome e histona
composição são as principais características da regulação genética. O regulamento
de transcrição depende não só na actividade de regulação
factores de transcrição de ARN polimerase que influenciam por meio de TFIID
e mediador para ligar genes ligado ou desligado, mas deve envolver também
alterações na estrutura da cromatina que afectam a capacidade de transcrição
fatores para o acesso e vincular suas sequências alvo
na região promotora. Se a cromatina é numa conformação fechada,
transcrição pode ser difícil ou impossível. Por comparação,
cromatina que está em uma conformação aberta é mais
facilmente acessível para factores de transcrição e de ARN-polimerase
de modo que a transcrição pode ocorrer. Apesar de o aberta e fechada
conformações podem ser afectados pela compactação relativa de um
região cromossómica, os investigadores determinaram que recentemente
composição de histona e o posicionamento preciso de nucleossomas
na ou perto promotores muitas vezes desempenham um papel chave em genes eucarióticos
regulamento. Nesta seção, examinamos mecanismos moleculares
que explicam como as mudanças na estrutura da cromatina pode controlar o
regulação de genes eucarióticos.
Cromatina remodelação Complexos de Alter do
Posições e composições de Nucleosomes
Nos últimos anos, os geneticistas têm tentado identificar os passos
que promovem a interconversão entre o fechado e aberto
conformações de cromatina. Nucleossomos demonstraram
mudam de posição em células que normalmente expressam um determinado gene
em comparação com as células em que o gene está inactivo. Por exemplo,
em reticulócitos que expressam o gene da globina β, uma alteração
no posicionamento dos nucleossomas ocorre na região promotora
desde o nucleótido -500 a +200. Esta alteração é provavelmente
um passo importante na activação de genes. Com base na análise de
muitos genes, os investigadores descobriram que um papel fundamental de alguns
activadores da transcrição é de orquestrar mudanças na cromatina
estrutura de a conformação fechada para a aberta, alterando
nucleossomos.


One way to change chromatin structure is through ATPdependent
chromatin remodeling. In this process, the energy
of ATP hydrolysis is used to drive a change in the locations and/
or compositions of nucleosomes, thereby making the DNA more
or less amenable to transcription. Therefore, chromatin remodeling
is important for both the activation and repression of
transcription.
The remodeling process is carried out by a protein complex
that recognizes nucleosomes and uses ATP to alter their configuration.
All remodeling complexes have a catalytic ATPase subunit
that is similar to other motor proteins, called DNA translocases ,
that move along the DNA. Eukaryotes have multiple families of
chromatin remodelers. Though their names may differ depending
on the species, common chromatin-remodeling complex
families are referred to as the SWI/SNF-family, the ISWI- family,
the INO80-family, and the Mi-2-family. The names of these
remodelers sometimes refer to the effects of mutations in genes
that encode remodeling proteins. For example, the abbreviations
SWI and SNF refer to the effects that occur in yeast when these
remodeling enzymes are defective. SWI mutants are defective in
mating-type switching, and SNF mutations create a sucrose nonfermenting
phenotype.
How do chromatin remodelers change chromatin structure?
Three effects are possible. One result of ATP-dependent
chromatin remodeling is a change in the location of nucleosomes
(Figure 15.9a ). This may involve a shift in nucleosomes to a
new location or a change in the relative spacing of nucleosomes
over a long stretch of DNA. A second effect is that remodelers
may evict histones from the DNA, thereby creating gaps where
nucleosomes are not found (Figure 15.9b). A third possibility
is that remodelers may change the composition of nucleosomes
by removing standard histones and replacing them with histone
variants (Figure 15.9c). The functions of histone variants are
described next.
Histone Variants Play Specialized Roles
in Chromatin Structure and Function
As discussed in Chapter 10 , the five histone genes, which encode
histones H1, H2A, H2B, H3, and H4, are moderately repetitive.
The total number of histone genes varies from species to species.
As an example, the human genome contains over 70 histone
genes that have been produced by gene duplication events during
evolution. Most of the histone genes encode standard histone
proteins. However, a few have accumulated mutations that
change the amino acid sequence of the histone proteins. These
are called histone variants . Among eukaryotic species, histone
variants have been identified for histone H1, H2A, H2B, and H3
genes, but not for the H4 gene.

Uma maneira de alterar a estrutura da cromatina é através da ATP dependente
remodelação da cromatina. Neste processo, a energia
hidrólise de ATP é utilizado para accionar uma mudança nos locais e /
ou composições de nucleossomas, tornando o DNA mais
ou menos propícios a transcrição. Portanto, a remodelação da cromatina
é importante tanto para a activação e de repressão
transcrição.
O processo de remodelação é levada a cabo por um complexo proteico
que reconhece nucleossomas e utiliza ATP para alterar a sua configuração.
Todos os complexos de remodelação tem uma subunidade catalítica ATPase
que é semelhante a outras proteínas do motor, chamado translocases ADN,
que se movem ao longo do DNA. Eukaryotes ter várias famílias de
remodelers cromatina. Embora seus nomes podem variar de acordo
da espécie, complexo-remodelamento da cromatina comum
famílias são referidos como o / SNF-família SWI, a família ISWI-,
o INO80-família, ea família-2-Mi. Os nomes destes
remodelers às vezes se referem aos efeitos das mutações em genes
que codificam proteínas de remodelação. Por exemplo, as abreviaturas
SWI SNF e referem-se aos efeitos que ocorrem em levedura quando estes
enzimas de remodelação estão com defeito. Mutantes SWI estão com defeito em
tipo de acasalamento de comutação, e mutações SNF criar um não-fermentadoras de sacarose
fenótipo.
Como fazer remodelers cromatina alterar a estrutura da cromatina?
Três efeitos são possíveis. Um dos resultados da ATP-dependente
remodelação da cromatina é uma alteração no local de nucleossomas
(Figura 15.9a). Isto pode envolver uma mudança de nucleossomas para uma
novo local ou uma mudança no espaçamento relativo de nucleossomas
durante um longo trecho de DNA. Um segundo efeito é que as empresas de reestruturação
pode expulsar histonas do DNA, criando lacunas onde
nucleossomos não são encontrados (Figura 15.9b). Uma terceira possibilidade
é que remodelers pode alterar a composição do nucleosomes
removendo histonas padrão e substituí-los por histona
variantes (Figura 15.9c). As funções de histonas são variantes
descrito a seguir.
Histona variantes desempenham missões específicas
em Chromatin Estrutura e Função
Como discutido no Capítulo 10, os cinco genes de histonas, que codificam
histonas H1, H2A, H2B, H3, e H4, são moderadamente repetitivos.
O número total de genes de histona varia de espécie para espécie.
Como um exemplo, o genoma humano contém mais de 70 histona
os genes que tenham sido produzidos por acontecimentos da duplicação de genes durante
evolução. A maioria dos genes de histona codificar histona padrão
proteínas. Mutações no entanto, alguns têm acumulado que
alterar a sequência de aminoácidos das proteínas histona. Estes
são denominadas variantes de histona. Entre as espécies eucarióticas, histona
variantes foram definidos para a histona H1, H2A, H2B, H3 e
genes, mas não para o gene H4.


What are the consequences of histone variation? Research
over the past two decades has shown that certain histone variants
play specialized roles in chromatin structure and function.
In all eukaryotes, histone variants are incorporated into a subset
of nucleosomes to create functionally specialized regions of chromatin.
In most cases, the standard histones are incorporated into
the nucleosomes while new DNA is synthesized during S phase
of the cell cycle. Later, some of the standard histones are replaced
by histone variants via chromatin-remodeling complexes.
Table 15.1 describes the standard histones and a few histone
variants that are found in humans. A key role of many histone
variants is to regulate the structure of chromatin, thereby influencing
gene transcription. Such variants can have opposite effects.
The incorporation of histone H2A.Bbd into a chromosomal region
where a particular gene is found favors gene activation. In contrast,
the incorporation of histone H10 represses gene expression.
Although our focus in this chapter is on gene regulation,
it is worth noting that histone variants play other important
roles. For example, histone cenH3, which is a variant of histone
H3, is found at the centromeres of each chromosome and functions
in the binding of kinetochore proteins. Histone cenH3 is
required for the proper segregation of eukaryotic chromosomes.
Other histone variants are primarily found at specialized sites in
certain cells. Histone macroH2A is found along the inactivated
X chromosome in female mammals, whereas spH2B is found
at the telomeres in sperm cells. Finally, certain histone variants
appear to play a role in DNA repair. For example, histone H2A.X
becomes phosphorylated where a double-stranded DNA break
occurs. This phosphorylation is thought to be important for the
proper repair of that break.
The Histone Code Also Controls
Gene Transcription
As described in Chapter 10 , each of the core histone proteins
consists of a globular domain and a flexible, charged amino terminus
called an amino-terminal tail (refer back to Figure 10.14a ).
The DNA wraps around the globular domains, and the aminoterminal
tails protrude from the chromatin. In recent years,
researchers have discovered that particular amino acids in the
amino- terminal tails of standard histones and histone variants
are subject to several types of covalent modifications, including
acetylation, methylation, and phosphorylation. Over 50 different
enzymes have been identified in mammals that selectively modify
amino-terminal tails of histones.

Quais são as conseqüências da variação da histona? Pesquisa
ao longo das últimas duas décadas tem mostrado que certas variantes de histonas
desempenhar funções especializadas na estrutura e função da cromatina.
Em todos os eucariotas, as variantes de histona são incorporados num subconjunto
de nucleossomos para criar regiões funcionalmente especializadas de cromatina.
Na maioria dos casos, as histonas padrão são incorporados
os nucleossomos enquanto novo DNA é sintetizada durante a fase S
do ciclo celular. Mais tarde, algumas das histonas padrão são substituídos
por histona variantes via complexos de cromatina remodelação.
Tabela 15.1 descreve as histonas standard e alguns histona
variantes que são encontradas em humanos. Um papel-chave de muitos histona
variantes é a de regular a estrutura da cromatina, influenciando assim
transcrição do gene. Tais variantes podem ter efeitos opostos.
A incorporação de histona H2A.Bbd numa região cromossómica
em que um determinado gene é encontrado favorece a activação do gene. Em contraste,
a incorporação de histona H10 reprime a expressão do gene.
Embora nosso foco neste capítulo é sobre a regulação do gene,
vale a pena notar que as variantes de histonas jogar outro importante
papéis. Por exemplo, histona cenH3, que é uma variante de histona
H3, é encontrado nos centrómeros de cada cromossoma e funções
na ligação de proteínas cinetócoro. Histona é cenH3
requerido para a correcta segregação dos cromossomas eucarióticos.
Outras variantes de histonas são encontrados principalmente em sites especializados em
certas células. Histona macroH2A é encontrada ao longo da inativada
Cromossoma X em fêmeas de mamíferos, enquanto que spH2B é encontrado
nos telômeros em células de esperma. Finalmente, certa histona variantes
parecem desempenhar um papel na reparação do ADN. Por exemplo, H2A.X histona
torna-se fosforilada onde uma quebra de cadeia dupla de ADN
ocorre. Esta fosforilação é pensado ser importante para o
reparação adequada desse intervalo.
O Código também controla Histone
Gene Transcrição
Tal como descrito no Capítulo 10, cada uma das proteínas principais de histonas
consiste de um domínio globular e um flexível, terminal amino carregada
chamado de cauda amino-terminal (consultar a Figura 10.14a).
O DNA envolve os domínios globulares, eo aminoterminal
caudas salientes da cromatina. Nos últimos anos,
os investigadores descobriram que os aminoácidos específicos no
caudas terminais amino das histonas padrão e variantes de histona
são sujeitos a vários tipos de modificações covalentes, incluindo
acetilação, metilação, fosforilação e. Mais de 50 diferentes
enzimas têm sido identificados em mamíferos que modificam selectivamente
caudas amino-terminal de histonas.

Figure 15.10a shows examples of
sites in the tails of H2A, H2B, H3, and H4 that can be modified.
How do histone modifications affect the level of transcription?
First, they may directly influence interactions between
nucleosomes. For example, positively charged lysines within
the core histone proteins can be acetylated by enzymes called
histone acetyltransferases. The attachment of the acetyl group
(—COCH3) eliminates the positive charge on the lysine side
chain, thereby disrupting the electrostatic attraction between the
histone protein and the negatively charged DNA backbone (Figure
15.10b).
In addition, histone modifications occur in patterns that
are recognized by proteins. According to the histone code
hypothesis, proposed by Brian Strahl, C. David Allis, and Bryan
Turner in 2000, the pattern of histone modification acts much
like a language or code in specifying alterations in chromatin
structure. For example, one pattern might involve phosphorylation
of the serine at the first position in H2A and acetylation of
the fifth and eighth amino acids in H4, which are lysines. A different
pattern could involve acetylation of the fifth amino acid,
a lysine, in H2B and methylation of the third amino acid in H4,
which is an arginine.
The pattern of covalent modifications to the aminoterminal
tails provides binding sites for proteins that subsequently
affect the degree of transcription. One pattern of histone
modification may attract proteins that inhibit transcription,
which would silence the transcription of genes in the region. A
different combination of histone modifications may attract proteins,
such as chromatin-remodeling enzymes, which would serve
to alter the positions of nucleosomes in a way that promotes gene
transcription. For example, the acetylation of histones attracts
certain chromatin remodelers that can shift or evict nucleosomes,
thereby aiding in the transcription of genes. Overall, the
histone code is thought to play an important role in determining
whether the information within the genomes of eukaryotic species
is accessed. Researchers are trying to decipher the effects of
the covalent modifications that make up the histone code.

Figura 15.10a mostra exemplos de
sites nos rabos de H2A, H2B, H3, H4 e que podem ser modificados.
Como histonas modificações afetam o nível de transcrição?
Primeiro, eles podem influenciar diretamente as interações entre
nucleossomos. Por exemplo, dentro de lisinas carregadas positivamente
as proteínas do núcleo de histona pode ser acetilada por enzimas denominadas
acetiltransferases histonas. A ligação do grupo acetilo
(-OCH3) Elimina a carga positiva no lado lisina
cadeia, interrompendo assim a atração eletrostática entre a
proteína histona e a espinha dorsal do ADN negativamente carregado (Figura
15.10b).
Além disso, ocorrem modificações de histonas em padrões que
são reconhecidas por proteínas. De acordo com o código de histonas
hipótese, proposta por Brian Strahl, C. David Allis, e Bryan
Turner em 2000, o padrão de modificação da histona age muito
como uma linguagem ou código na especificação alterações na cromatina
estrutura. Por exemplo, um padrão de fosforilação pode envolver
da serina na primeira posição em H2A e acetilação de
O quinto e oitavo aminoácidos em H4, que são lisinas. Diferente
padrão pode envolver a acetilação do quinto aminoácido,
uma lisina, em H2B e metilação do terceiro aminoácido no H4,
que é uma arginina.
O padrão de modificações covalentes do aminoterminal
caudas fornece locais de ligação para as proteínas que posteriormente
afectar o grau de transcrição. Um padrão de histona
modificação pode atrair as proteínas que inibem a transcrição,
que silenciar a transcrição dos genes na região. UMA
diferente combinação de modificações de histonas pode atrair proteínas,
tais como enzimas de remodelação da cromatina, o que iria servir
para alterar as posições dos nucleossomas numa forma que promove gene
transcrição. Por exemplo, a acetilação das histonas atrai
certas empresas de reestruturação de cromatina que pode mudar ou expulsar nucleosomes,
auxiliando assim na transcrição de genes. Em geral, o
código histona é pensada para desempenhar um papel importante na determinação
se a informação dentro dos genomas de espécies eucarióticas
é acessado. Os pesquisadores estão tentando decifrar os efeitos da
as modificações covalentes que constituem o código de histona.

Chromatin Immunoprecipitation Sequencing Has
Enabled Researchers to Determine the Precise
Locations of Nucleosomes Throughout Entire
Genomes
Thus far, we have learned that nucleosomes can vary in three
ways. First, their locations can be altered along a DNA molecule.
Second, histones exist in different variants that play specialized
roles. And third, histones are subject to covalent modifications at
their amino-terminal tails.
Within the last 10 years researchers have been able to
map the locations of specific nucleosomes within a genome.
This allows for the determination of (1) where nucleosomes
are located, (2) where histone variants are found, and (3) where
covalent modifications of histones occur. This amazing achievement
has been possible in large part by using an approach called
chromatin immunoprecipitation sequencing (ChIP-Seq) .
As shown in Figure 15.11 , ChIP-Seq begins with living
cells. The cells are treated with formaldehyde, which covalently
crosslinks proteins to the DNA. Next, the cells are broken open,
and the chromatin is exposed to a high concentration of micrococcal
nuclease (MNase), which is an enzyme that digests DNA.
MNase digests the linker regions between nucleosomes, but
it is unable to cleave DNA that is attached to the core histone
proteins. Following this digestion, what remains is millions of
nucleosomes that have DNA attached to them.
The nucleosomes can be removed from this mixture
using antibodies that specifically recognize histone proteins. All
nucleosomes can be removed if the antibody recognizes a histone
such as H4, which is found in all nucleosomes and does not
exist as a histone variant. Alternatively, specific types of nucleosomes
can be removed from this mixture using antibodies that
recognize particular histones. For example, an antibody could
be added that recognizes a variant histone. It is also possible to
use antibodies that recognize a histone that has been covalently
modified in a certain way. For example, a researcher could use an
antibody that recognizes an acetylated histone.

Cromatina imunoprecipitação Tem Sequencing
Os pesquisadores habilitados para determinar o Precise
Locais de Nucleosomes durante todo
Genomas
Até agora, nós aprendemos que nucleossomos podem variar em três
maneiras. Em primeiro lugar, as suas localizações podem ser alteradas ao longo de uma molécula de ADN.
Em segundo lugar, as histonas existir em diferentes variantes especializadas que desempenham
papéis. E em terceiro lugar, histonas estão sujeitas a modificações covalentes na
suas caudas amino-terminal.
Nos últimos 10 anos os investigadores foram capazes de
mapear os locais de nucleosomes específicos dentro de um genoma.
Isto permite a determinação de (1) em que nucleossomas
situam-se, (2) onde se encontram as variantes de histona, e (3) onde
modificações covalentes das histonas ocorrer. Essa conquista incrível
foi possível, em grande parte, usando uma abordagem chamada
seqüenciamento imunoprecipitação da cromatina (ChIP-Seq).
Como mostrado na Figura 15.11, ChIP-Seq começa com a vida
células. As células são tratadas com formaldeído, que covalentemente
proteínas de ligações cruzadas para o ADN. Em seguida, as células são quebradas aberta,
e a cromatina está exposta a uma elevada concentração de microcócica
a nuclease (MNase), que é uma enzima que digere o ADN.
MNase digere as regiões ligantes entre nucleossomas, mas
ele é incapaz de clivar o ADN que está ligado ao núcleo de histona
proteínas. Na sequência desta digestão, o que resta é milhões de
nucleosomes que têm DNA que lhes são inerentes.
Os nucleossomas pode ser removido a partir desta mistura
utilizando anticorpos que reconhecem especificamente proteínas histona. Todos
nucleossomas pode ser removido se o anticorpo reconhece uma histona
tais como H4, que é encontrado em todos os nucleossomas e não faz
existir como uma variante de histona. Em alternativa, tipos específicos de nucleossomas
pode ser removido a partir desta mistura, utilizando anticorpos que
reconhecer particulares histonas. Por exemplo, um anticorpo poderia
se acrescentar que reconhece uma variante histona. É também possível
Utilização anticorpos que reconhecem uma histona que foi covalentemente
modificado de uma determinada maneira. Por exemplo, uma pode utilizar um pesquisador
anticorpo que reconhece um histona acetilada.


After the addition of a particular type of antibody, the
antibodies recognize specific nucleosomes and cause them to
aggregate and precipitate out of solution. This process is called
immunoprecipitation. Following this step, the crosslinks
between the histones and DNA are broken, and the DNA is separated
from the core histones. The DNA is then subjected to gel
electrophoresis. Only those DNA fragments that are about 150 bp
in length are saved. This is the length of DNA that wraps around
one nucleosome. At this stage, the researcher has thousands or
millions of DNA fragments that are about 150 bp in length. Short
oligonucleotides, also called linkers, are added to the ends of the
DNA fragments, which facilitates their ability to be amplified by
the process of polymerase chain reaction (PCR) and subjected to
DNA sequencing. (PCR and DNA sequencing are described in
Chapter 18 ).
How are the DNA sequences analyzed? The ChIP-Seq
method is used on species in which the entire genome has already
been sequenced, such as yeast, Drosophila, humans, and Arabidopsis.
A genome map describes the locations of DNA sequences
along each chromosome in a genome. Using computer software,
the sequences obtained via ChIP-Seq can be matched to identical
sequences on a genome map. Because the genome map also
shows the locations of genes, this method allows researchers to
determine the relative positions of nucleosomes from the beginning
of a gene to the end, as described next.
Eukaryotic Genes Are Flanked by Nucleosome-Free
Regions and Well-Positioned Nucleosomes
Over the last 10 years or so, researchers have used ChIP-Seq to
analyze the genomes of various species, including yeast, Drosophila,
humans, and other eukaryotic species. These studies have
revealed that many eukaryotic genes show a common pattern
of nucleosome organization (Figure 15.12 ). For active genes or
those genes that can be activated, the core promoter is found at
a nucleosome-free region (NFR) , which is a site that is missing
histones. The NFR is typically 150 bp in length. Although
the NFR may be required for transcription, it is not, by itself,
sufficient for gene activation. At any given time in the life of a
cell, many genes that contain an NFR are not being actively
transcribed.

Após a adição de um tipo particular de anticorpo, o
anticorpos reconhecem nucleosomes específicas e levá-los a
agregado e precipitar para fora da solução. Este processo é chamado
imunoprecipitação. Seguindo esta etapa, as ligações cruzadas
entre as histonas e o ADN são quebrados, e o ADN é separado
das histonas nucleares. O ADN é então submetido a gel
electroforese. Apenas os fragmentos de ADN que são cerca de 150 pb
em comprimento são salvos. Este é o comprimento do ADN que circunda
um nucleosome. Nesta fase, o pesquisador tem milhares ou
milhões de fragmentos de ADN que são cerca de 150 pb de comprimento. Baixo
oligonucleótidos, também chamados ligantes, são adicionados às extremidades da
Os fragmentos de ADN, o que facilita a sua capacidade para ser amplificado pela
o processo de reacção em cadeia da polimerase (PCR) e submeteu-se
A sequenciação de ADN. (PCR e sequenciação de ADN estão descritos em
Capítulo 18).
Como são as sequências de DNA analisadas? O chip-Seq
método é utilizado na espécie em que todo o genoma tem já
foram sequenciados, tal como levedura, Drosophila, os seres humanos, e Arabidopsis.
Um mapa do genoma descreve os locais de sequências de ADN
ao longo de cada cromossoma em um genoma. Usando o software de computador,
as sequências obtidas via ChIP-Seq podem ser correspondidas com idêntica
seqüências em um mapa do genoma. Porque o mapa do genoma também
mostra as localizações dos genes, este método permite aos pesquisadores
determinar as posições relativas dos nucleossomas desde o início
de um gene para o fim, tal como descrito em seguida.
Genes eucarióticas são acompanhadas por Nucleosome-Free
Regiões e Nucleosomes Bem posicionado
Ao longo dos últimos 10 anos ou assim, os pesquisadores usaram ChIP-Seq para
analisar os genomas de várias espécies, incluindo as leveduras, Drosophila,
seres humanos e outras espécies eucarióticas. Estes estudos têm
revelou que muitos genes eucarióticos apresentam um padrão comum
de organização nucleosome (Figura 15.12). Para genes ativos ou
os genes que podem ser activados, o promotor-núcleo é encontrado em
uma região livre de nucleosome (NFR), que é um site que está faltando
histonas. A NFR é tipicamente de 150 pb de comprimento. Embora
NFR podem ser necessários para a transcrição, não é, por si só,
suficiente para a activação do gene. Em um determinado momento na vida de um
de células, muitos genes que contêm uma NFR não estão a ser activamente
transcritas.


The NFR is flanked by two well-positioned nucleosomes
that are termed the –1 and +1 nucleosomes. In yeast, the transcriptional
start site (TSS) is usually at the boundary between the
NFR and the +1 nucleosome. However, in animals, the TSS is
about 60 bp farther upstream into the NFR. The +1 nucleosome
typically contains histone variants H2A.Z and H3.3. Depending
on the species and the gene, these variants may also be found in
the –1 nucleosome and in some of the nucleosomes that immediately
follow the +1 nucleosome in the transcribed region. For
example, the +2 nucleosome is likely to contain H2A.Z but not
as likely as the +1 nucleosome. Similarly, the +3 nucleosome is
likely to contain H2A.Z, but not as likely as the +2 nucleosome.
The nucleosomes downstream from the +1 nucleosome
tend to be evenly spaced near the beginning of a eukaryotic gene,
but their spacing becomes less regular farther downstream. The
ends of many eukaryotic genes appear to have a well-positioned
nucleosome that is followed by an NFR. This arrangement at the
ends of genes may be important for transcriptional termination.
Transcriptional Activation Involves Changes in
Nucleosome Locations, Composition, and Histone
Modifications
A key role of certain transcriptional activators is to recruit
chromatin-remodeling enzymes and histone-modifying enzymes
to the promoter region. Though the order of recruitment may
differ among specific transcriptional activators, this appears to be
critical for transcriptional initiation and elongation. Figure 15.13
presents a general scheme for how transcriptional activators may
facilitate transcription in a eukaryotic gene, such as a gene found
in yeast.
As discussed earlier, a gene that is able to be activated has
an NFR at the transcriptional start site. In the scenario shown in
Figure 15.13, a transcriptional activator binds to the NFR. The
activator then recruits chromatin-remodeling complexes and
histone-modifying enzymes to this region. The chromatin remodelers
may shift nucleosomes or temporarily evict nucleosomes
from the promoter region. Nucleosomes containing the histone
variant H2A.Z, which are typically found at the +1 nucl eosome,
are thought to be more easily removed from the DNA than
those containing the standard histone H2A. Histone-modifying
enzymes, such as histone acetyltransferase, covalently modify
histone proteins and may affect nucleosome contact with the
DNA. The actions of chromatin remodelers and histone-modifying
enzymes facilitate the binding of general transcription factors
and RNA polymerase II to the core promoter, thereby allowing
the formation of a preinitiation complex (see Figure 15.13).

A NFR é flanqueado por duas nucleosomes bem posicionados
que são denominados os nucleossomas -1 e +1. Em levedura, a transcrição
local de início (TSS) é normalmente no limite entre o
NFR ea uma nucleosome. No entanto, em animais, o TSS é
cerca de 60 pb mais a montante no NFR. A uma nucleosome
tipicamente contém histona H3.3 e variantes H2A.Z. Dependendo
com a espécie e o gene, estas variantes podem também ser encontrados em
-1 o nucleossoma e em alguns dos nucleossomas que imediatamente
seguir a um nucleossoma na região transcrita. Para
exemplo, o 2 nucleosome é susceptível de conter H2A.Z mas não
tão provável quanto a uma nucleosome. Da mesma forma, o nucleossoma é +3
susceptíveis de conter H2A.Z, mas não tão provável quanto a dois nucleosome.
Os nucleossomos jusante do 1 nucleosome
tendem a ser uniformemente espaçados perto do início de um gene eucariótico,
mas o seu espaçamento se torna menos regular mais a jusante. o
extremidades de muitos genes eucarióticos parecem ter um bem posicionado
nucleossoma que é seguido por um NFR. Este arranjo no
extremidades dos genes podem ser importantes para a terminação da transcrição.
Ativação de transcrição envolve mudanças na
Locais nucleossomos, Composição, e Histone
Modificações
Um papel chave de certos activadores de transcrição é recrutar
enzimas e enzimas modificadoras de histona-remodelação da cromatina
a região do promotor. Embora a ordem de recrutamento pode
diferem entre activadores de transcrição específicos, isto parece ser
crítica para a iniciação da transcrição e alongamento. Figura 15.13
apresenta um esquema geral para ativadores de transcrição como pode
facilitar a transcrição em um gene eucariótico, tal como um gene encontrado
em levedura.
Como discutido anteriormente, um gene que é capaz de ser activado possui
um NFR no local de início da transcrição. No cenário mostrado na
Figura 15.13, um activador transcricional se liga ao NFR. o
ativador então recruta complexos de cromatina remodelação e
enzimas para esta região de modificação de histona. Os remodelers cromatina
pode mudar nucleosomes ou temporariamente expulsar nucleosomes
da região de promotor. Nucleossomos contendo a histona
H2A.Z variante, que são encontrados tipicamente no 1 Nucl eosome,
são pensados ​​para ser mais facilmente removido a partir do ADN de
os que contenham o padrão da histona H2A. Histona-modificando
enzimas, tais como histona-acetiltransferase, modificar covalentemente
proteínas histonas e pode afetar o contato com o nucleosome
ADN. As ações de empresas de reestruturação de cromatina e histonas modificando-
enzimas facilitam a ligação de factores de transcrição gerais
e RNA polimerase II para o promotor-núcleo, permitindo assim
a formação de um complexo de pré-iniciação (ver figura 15.13).


Further changes in chromatin structure are necessary for
elongation to occur. RNA polymerase II cannot transcribe DNA
that is tightly wrapped in nucleosomes. For transcription to
occur, histones are evicted, partially displaced, or destabilized
so that RNA polymerase II can pass. Evicted histones are transferred
to histone chaperones, which are proteins that bind histones
and aid in the assembly of histones. Assembled histones
are then placed back on the DNA behind the moving RNA polymerase
II (see Figure 15.13).
Histone-modifying enzymes also play a key role in histone
removal and replacement during the elongation phase of transcription.
Histone-modifying enzymes have been found to travel
with RNA polymerase II during the elongation phase of transcription.
These include enzymes that carry out histone acetylation, H3
methylation, and H2B ubiquitination. These modifications facilitate
histone removal ahead of the traveling RNA polymerase II.
Behind RNA polymerase II, histone deacetylase removes the acetyl
groups, thereby favoring the binding of histones to the DNA
to form nucleosomes. The re-formation of nucleosomes behind
RNA polymerase II is thought to be critical to maintaining the
fidelity of transcription. If nucleosome re-formation did not occur
properly, transcriptional initiation might occur at multiple points
in a gene, thereby producing faulty transcripts.
Changes in the relative amounts of histone variants also
occur within actively transcribed genes. For example, histone
variant H3.3 is often found in the transcribed regions of genes,
but is less common in silent genes. H3.3 may facilitate the eviction
and replacement of nucleosomes ahead and behind RNA
polymerase II, respectively. Also, genes with very high levels of
transcription may be largely devoid of nucleosomes, because
multiple RNA polymerases are transcribing the gene.

Outras alterações na estrutura da cromatina são necessárias para
alongamento para ocorrer. RNA polimerase II não pode transcrever DNA
que é embrulhado em nucleossomas. Para a transcrição
ocorrer, histonas são despejados, parcialmente deslocados, ou desestabilizado
de modo que a ARN-polimerase II pode passar. Histonas despejadas são transferidos
a chaperonas de histonas, que são proteínas que se ligam histonas
e auxiliar na montagem das histonas. Histonas montados
são então colocados de volta no ADN por trás da polimerase de ARN movendo
II (veja a Figura 15.13).
Enzimas modificadoras da histona desempenham igualmente um papel chave na histona
a remoção e substituição durante a fase de alongamento de transcrição.
Enzimas modificadoras de histonas foram encontrados para viajar
com a RNA polimerase II durante a fase de alongamento de transcrição.
Estes incluem enzimas que realizam acetilação das histonas, H3
metilação, ubiquitinação e H2B. Estas modificações facilitar
remoção histona frente da polimerase de ARN II itinerante.
Atrás de RNA polimerase II, histona desacetilase remove o acetilo
grupos, favorecendo, assim, a ligação de histonas ao DNA
para formar nucleossomas. A re-formação de nucleossomos atrás
RNA polimerase II é pensado para ser crítico para a manutenção da
fidelidade da transcrição. Se re-formação do nucleossoma não ocorreu
adequadamente, de iniciação da transcrição pode ocorrer em múltiplos pontos
num gene, produzindo assim transcritos defeituosos.
Alterações nas quantidades relativas de variantes também histona
ocorrer dentro dos genes activamente transcritos. Por exemplo, histona
H3.3 variante é freqüentemente encontrado nas regiões transcritas de genes,
mas é menos comum em genes silenciosos. H3.3 pode facilitar o despejo
e substituição dos nucleossomos à frente e atrás RNA
polimerase II, respectivamente. Além disso, os genes com níveis muito elevados de
transcrição podem ser em grande parte desprovidos de nucleossomas, porque
várias polimerases de ARN são a transcrição do gene.


15.3 DNA METHYLATION
We now turn our attention to a regulatory mechanism that usually
silences gene expression. DNA structure can be modified by
the covalent attachment of methyl groups, a mechanism called
DNA methylation. This process is common in some but not all
eukaryotic species. For example, yeast and Drosophila have little
or no detectable methylation of their DNA, whereas DNA methylation
in vertebrates and plants is relatively abundant. In mammals,
approximately 2 to 7% of the DNA is methylated. In this
section, we will examine how DNA methylation occurs and how
it can control gene expression. DNA Methylation Occurs on the Cytosine Base and
Usually Inhibits Gene Transcription
As shown in Figure 15.14 , eukaryotic DNA methylation occurs
via an enzyme called DNA methyltransferase, which attaches
a methyl group to the number 5 position of the cytosine base,
forming 5-methylcytosine. The sequence that is methylated is
shown here.
CH3
|
5ʹ–CG–3ʹ
3ʹ–GC–5ʹ
|
CH3
Note that this sequence contains cytosines in both strands. Methylation
of the cytosine in both strands is termed full methylation,
whereas methylation of only one strand is called hemimethylation .
DNA methylation usually inhibits the transcription of
eukaryotic genes, particularly when it occurs in the vicinity of
the promoter. In vertebrates and plants, CpG islands occur near
many promoters of genes. (Note: CpG refers to a dinucleotide
of C and G in DNA that is connected by a phosphodiester linkage.)

METILAÇÃO 15,3 DNA
Agora voltamos nossa atenção para um mecanismo regulador que normalmente
silencia a expressão do gene. Estrutura de ADN pode ser modificada pela
a ligação covalente de grupos metilo, um mecanismo chamado
Metilação de DNA. Este processo é comum em alguns, mas não todos
espécies eucarióticas. Por exemplo, de levedura e Drosophila têm pouco
ou não detectável metilação do seu DNA, enquanto que a metilação do DNA
em vertebrados e plantas é relativamente abundante. Em mamíferos,
cerca de 2 a 7% do ADN é metilado. Nisso
seção, vamos examinar como a metilação do DNA ocorre e como
pode controlar a expressão do gene. A metilação do DNA ocorre na Base de Dados de citosina e
Normalmente Inibe Gene Transcrição
Como mostrado na Figura 15,14, ocorre a metilação do DNA eucariótico
por meio de uma enzima chamada DNA metiltransferase, que atribui
um grupo metil para a posição número 5 da base citosina,
formando 5-metilcitosina. A sequência que é metilado é
mostrado aqui.
CH3
|
5'-CG-3 '
3'-5'-CG
|
CH3
Note-se que esta sequência contém citosina em ambas as vertentes. A metilação
da citosina em ambas as cadeias é denominado metilação completa,
Considerando que a metilação de apenas uma vertente é chamado hemimethylation.
Metilação do DNA normalmente inibe a transcrição de
genes eucariotas, particularmente quando ocorre nas imediações
o promotor. Em vertebrados e plantas, ilhas CpG ocorrem perto
muitos promotores de genes. (Nota: refere-se a um CpG dinucleótido
de C e G no ADN que está ligado por uma ligação fosfodiéster.)



These CpG islands are commonly 1000 to 2000 bp in length
and contain a high number of CpG sites. In the case of housekeeping
genes—genes that encode proteins required in most
cells of a multicellular organism—the cytosine bases in the CpG
islands are unmethylated. Therefore, housekeeping genes tend to
be expressed in most cell types. By comparison, other genes are
highly regulated and may be expressed only in a particular cell
type. These are tissue-specific genes. In some cases, it has been
found that the expression of such genes may be silenced by the
methylation of CpG islands. Unmethylated CpG islands are correlated
with active genes, whereas suppressed genes contain methylated
CpG islands. In this way, DNA methylation is thought to
play an important role in the silencing of tissue-specific genes to
prevent them from being expressed in the wrong tissue.
Methylation can affect transcription in two general ways.
First, methylation of CpG islands may prevent or enhance the
binding of regulatory transcription factors to the promoter region.
For example, methylated CG sequences could prevent the binding
of an activator protein to an enhancer element, presumably by
the methyl group protruding into the major groove of the DNA
(Figure 15.15a ). The inability of an activator protein to bind to
the DNA would inhibit the initiation of transcription. However,
CG methylation does not slow down the movement of RNA polymerase
along a gene. In vertebrates and plants, coding regions
downstream from the core promoter usually contain methylated
CG sequences, but these do not hinder the elongation phase of
transcription. This suggests that methylation must occur in the
vicinity of the promoter to have an effect on transcription.
A second way that methylation inhibits transcription is via
proteins known as methyl-CpG-binding proteins, which bind
methylated sequences (Figure 15.15b). These proteins contain a
domain called the methyl-binding domain that specifically recognizes
a methylated CG sequence. Once bound to the DNA,
the methyl-CpG-binding protein recruits other proteins to the
region that inhibit transcription. For example, methyl-CpGbinding
proteins may recruit histone deacetylase to a methylated
CpG island near a promoter. Histone deacetylation removes acetyl
groups from the histone proteins, which makes it more difficult
for nucleosomes to be removed from the DNA. In this way,
deacetylation tends to inhibit transcription.

Estas ilhas CpG são geralmente de 2000 para 1000 pb de comprimento
e contêm um elevado número de locais de CpG. No caso de arrumação
os genes que codificam genes de proteínas necessária na maioria
As células de um organismo multicelular as bases de citosina do CpG
ilhas são não metilado. Por conseguinte, tendem a genes housekeeping
ser expresso na maioria dos tipos de células. Em comparação, outros genes são
altamente regulado e apenas pode ser expresso numa célula particular
tipo. Estes são os genes específicos do tecido. Em alguns casos, tem sido
descobriu que a expressão de tais genes pode ser silenciado pelo
metilação de ilhas CpG. CpG não metiladas são ilhas correlacionada
com genes activos, ao passo que os genes suprimidos conter metilado
Ilhas de CpG. Deste modo, a metilação do ADN é provavelmente
desempenham um papel importante no silenciamento de genes específicos de tecido para
impedi-los de serem expressos em tecido errado.
A metilação pode afectar a transcrição de duas formas gerais.
Em primeiro lugar, a metilação de ilhas CpG podem prevenir ou melhorar o
ligação de factores reguladores da transcrição para a região do promotor.
Por exemplo, sequências de CG metilados poderia impedir a ligação
um activador de proteína a um elemento potenciador, presumivelmente pela
o grupo metilo saliente dentro da ranhura maior do ADN
(Figura 15.15a). A incapacidade de um activador de proteína para se ligar a
o ADN que inibem a iniciação da transcrição. Contudo,
CG metilação não abrandar o movimento da RNA polimerase
ao longo de um gene. Nos vertebrados e plantas, regiões codificantes
a jusante do promotor do núcleo geralmente contêm metilado
Sequências de CG, mas estas não impedem a fase de alongamento
transcrição. Isto sugere que a metilação deve ocorrer no
vizinhança do promotor para ter um efeito na transcrição.
Uma segunda maneira que a metilação inibe a transcrição é através
proteínas conhecidas como proteínas metil-CpG vinculativo, que se ligam
sequências metiladas (Figura 15.15b). Estas proteínas contêm um
domínio denominado o domínio de ligação de metilo que reconhece especificamente
uma sequência CG metilado. Uma vez ligado ao ADN,
a proteína de metil-CpG de ligação recruta outras proteínas para o
região que inibem a transcrição. Por exemplo, metil-CpGbinding
proteínas podem recrutar uma histona-desacetilase para metilado
Ilha CpG perto de um promotor. Histona deacetilação remove acetil
os grupos de proteínas histona, o que torna mais difícil
para nucleossomas para ser removido a partir do ADN. Nesse caminho,
desacetilação tende a inibir a transcrição.


DNA Methylation Is Heritable
Methylated DNA sequences are inherited during cell division.
Experimentally, if fully methylated DNA is introduced into a plant
or vertebrate cell, the DNA will remain fully methylated even
in subsequently produced daughter cells. However, if the same
sequence of nonmethylated DNA is introduced into a cell, it will
remain nonmethylated in the daughter cells. These observations
indicate that the pattern of methylation is retained following DNA
replication and, therefore, is inherited in future daughter cells.
How can methylation be inherited from cell to cell? Figure
15.16 illustrates a molecular model that explains this process,
which was originally proposed by Arthur Riggs, Robin Holliday,
and J. E. Pugh. The DNA in a particular cell may become methylated
by de novo methylation—the methylation of DNA that
was previously unmethylated. When a fully methylated segment
of DNA replicates in preparation for cell division, the newly
made daughter strands contain unmethylated cytosines. Because
only one strand is methylated, such DNA is said to be hemimethylated.
This hemimethylated DNA is efficiently recognized by
DNA methyltransferase, which makes it fully methylated. This
process is called maintenance methylation, because it preserves
the methylated condition in future cells. However, maintenance
methylation does not act on unmethylated DNA. Overall, maintenance
methylation appears to be an efficient process that routinely
occurs within vertebrate and plant cells. By comparison, de
novo methylation and demethylation are infrequent and highly
regulated events. According to this view, the initial methylation
or demethylation of a given gene can be regulated so that it
occurs in a specific cell type or stage of development. Once methylation
has occurred, it can then be transmitted from mother to
daughter cells via maintenance methylation.

A metilação do DNA é hereditária
Seqüências de DNA metiladas são herdados durante a divisão celular.
Experimentalmente, o ADN totalmente metilado se for introduzido numa planta
ou de células de vertebrados, o DNA permanecerá totalmente metilado mesmo
em células filhas, subsequentemente produzidos. No entanto, se a mesma
sequência de ADN não metilado é introduzido numa célula, ele vai
permanecer não metilado nas células filhas. Estas observações
indicam que o padrão de metilação do ADN é retido seguinte
replicação e, por conseguinte, é herdada de células filhas futuras.
Como metilação pode ser herdada de uma célula para outra? Figura
15.16 ilustra um modelo molecular que explica este processo,
que foi originalmente proposto por Arthur Riggs, Robin Holliday,
e J. E. Pugh. O ADN numa célula particular pode tornar-se metilados
por metilação de novo, a metilação de ADN que
foi anteriormente não metilado. Quando um segmento totalmente metilado
de DNA duplica em preparação para a divisão celular, a recém-
fios filha fez conter citosinas não metiladas. porque
apenas um fio é metilado, tal DNA é dito para ser hemimethylated.
Este ADN hemimethylated é eficientemente reconhecida pelos
Metiltransferase de ADN, o que o torna totalmente metilado. este
processo é chamado de metilação de manutenção, uma vez que preserva
a condição metilado em células futuras. No entanto, a manutenção
metilação não age no DNA não metilado. Em geral, a manutenção
metilação parece ser um processo eficiente que rotineiramente
ocorre dentro de células de vertebrados e plantas. A título de comparação, de
novo metilação e demetilação são pouco frequentes e altamente
eventos regulamentadas. De acordo com este ponto de vista, a metilação inicial
ou a desmetilação de um dado gene pode ser regulado de maneira a que ele
ocorre em um tipo específico de célula ou fase de desenvolvimento. Uma vez que a metilação
Ocorreu, ele pode então ser transmitido da mãe para o
células filhas através de metilação de manutenção.

The methylation mechanism shown in Figure 15.16 can
explain the phenomenon of genomic imprinting, which is
described in Chapter 7 . In this case, specific genes are methylated
during oogenesis or spermatogenesis, but not both. Following
fertilization, the pattern of methylation is maintained in the
offspring. For example, if a gene is methylated only during sperma
togenesis, the allele that is inherited from the father will be
methylated in the somatic cells of the offspring, but the maternal
allele will remain unmethylated. Along these lines, geneticists
are also eager to determine how variations in DNA methylation
patterns may be important for cell differentiation. It may be a key
way to silence genes in different cell types. However, additional
research is necessary to understand how specific genes may be
targeted for de novo methylation or demethylation during different
developmental stages or in specific cell types.
15.4 INSULATORS
Thus far, we have considered how regulatory transcription factors,
chromatin remodeling, and DNA methylation can regulate
gene transcription. As we have seen, eukaryotic gene regulation
involves changes in chromatin structure that may occur
over a relatively long distance. In addition, gene regulation often
involves regulatory elements such as enhancers that are far away
from the promoters they regulate.
In eukaryotes, adjacent genes usually exhibit different patterns
of gene regulation. Because eukaryotic gene regulation can
occur over long distances, a bewildering aspect of such regulation
is its ability to control a particular gene but not affect neighboring
genes. How are the effects of chromatin remodeling and histone
modifications constrained so they only affect a particular
gene and not its neighbors? How is an enhancer prevented from
controlling multiple genes?
An insulator is a segment of DNA that functions as a
boundary between two genes. An insulator is so named because
it protects, or “insulates,” a gene from the regulatory effects of a
neighboring gene. In this section, we will consider how insulators
are able to carry out this critical function.

O mecanismo de metilação mostrado na figura 15.16 pode
explicar o fenômeno de imprinting genômico, que é
descrito no Capítulo 7. Neste caso, os genes específicos estão metilado
durante a oogênese ou espermatogênese, mas não ambos. Segue
fertilização, o padrão de metilação é mantido na
prole. Por exemplo, se um gene é metilado apenas durante a espermatogênese, o alelo que é herdado do pai será
metilado nas células somáticas da prole, mas o maternal
alelo permanecerá não metilado. Ao longo destas linhas, os geneticistas
também estão ansiosos para determinar como as variações na metilação do DNA
padrões podem ser importantes para a diferenciação das células. Pode ser uma tecla
caminho para silenciar genes em diferentes tipos de células. No entanto, adicional
pesquisas são necessárias para entender como os genes específicos podem ser
alvo de metilação de novo ou diferente durante demethylation
estádios de desenvolvimento ou em tipos de células específicos.
15.4 INSULATORS
Até o momento, nós consideramos como fatores reguladores da transcrição,
remodelação da cromatina, e metilação de ADN pode regular
transcrição do gene. Como vimos, o regulamento do gene eucariótica
envolve alterações na estrutura da cromatina que podem ocorrer
sobre uma distância relativamente longa. Além disso, o regulamento do gene frequentemente
envolve elementos reguladores, tais como potenciadores que estão longe
dos promotores que regulam.
Em eucariotas, geralmente genes adjacentes apresentam padrões diferentes
de regulação gênica. Porque regulação gênica pode eucariótica
ocorrem em longas distâncias, um aspecto desconcertante de tal regulamento
é a sua capacidade para controlar um gene em particular, mas não afectam vizinha
genes. Como são os efeitos da remodelação da cromatina e histonas
modificações constrangidos para que eles só afetam um determinado
gene e não os seus vizinhos? Como é um potenciador impedido de
controlar múltiplos genes?
Um isolador é um segmento de DNA que funciona como um
fronteira entre dois genes. Um isolante é assim chamado porque
protege-lo, ou "isola", um gene a partir dos efeitos de um reguladoras
gene vizinho. Nesta seção, vamos considerar como isoladores
são capazes de realizar esta função crítica.

Insulators May Act as a Barrier to Changes
in Chromatin Structure or Block the Effects
of Neighboring Enhancers
Insulators typically perform two roles. Some insulators act as a
barrier to chromatin-remodeling or histone-modifying enzymes.
As an example, let’s consider the effects of histone deacetylase,
which removes acetyl groups from core histones, thereby favoring
a closed chromatin conformation that is transcriptionally
silent. Histone deacetylase may act over a long region of chromatin.
How is the action of histone deacetylase controlled so
that certain genes in a chromosomal region are not silenced? In
the example of Figure 15.17a , a gene is found in a chromosomal
region in which most of the histones are not acetylated due to
the action of histone deacetylase. However, this gene is flanked
by two insulators that allow the region where the gene is located to
be highly acetylated and transcriptionally activated. In this example,
the insulators act as barriers to the action of histone deacetylase.
The mechanisms that enable insulators to act as barriers are
not well understood. However, such insulators often bind proteins
that recruit histone-modifying enzymes or chromatin- remodeling
enzymes to the region. For example, an insulator could bind a
protein that recruits histone acetyltransferase, which would favor
the acetylation of core histones.
A second role of insulators is to block the effects of enhancers
that exert their effects on neighboring genes. As discussed
earlier in this chapter, enhancers may stimulate the expression
of genes that are relatively far away. To prevent an enhancer of
one gene from activating the expression of an adjacent gene, an
insulator may be located in between them. In the example shown
in Figure 15.17b, the enhancer can activate the expression of
gene A but the insulator prevents it from exerting its effects on
gene B. In other words, gene B is insulated from the effects of
this enhancer. How does this occur? Although the mechanism of
enhancer blocking may vary among different genes, one mechanism
is chromosome looping, which is described next.

Isoladores pode agir como uma barreira para Mudanças
Estrutura em Chromatin ou bloquear os efeitos
realçadores de vizinhos
Isoladores normalmente executam duas funções. Alguns isoladores actuar como um
barreira para a cromatina-remodelação ou enzimas modificadoras de histonas.
Como exemplo, vamos considerar os efeitos da histona deacetilase,
que remove grupos acetil de histonas nucleares, favorecendo
uma conformação que é fechado cromatina transcricionalmente
silencioso. Histona deacetilase pode actuar durante um longo região de cromatina.
Como é a ação de histona deacetilase controlada de forma
que determinados genes numa região cromossómica não são silenciados? Dentro
o exemplo da Figura 15.17a, um gene é encontrado em um cromossómico
região na qual a maioria das histonas são não acetilada devido ao
a acção de histona desacetilase. No entanto, este gene é flanqueado
por dois isoladores que permitem que a região em que o gene está localizado a
ser altamente acetilada e transcricionalmente activado. Neste exemplo,
os isoladores funcionam como barreiras à ação da histona deacetilase.
Os mecanismos que permitem agir como isoladores que são barreiras
não é bem compreendida. No entanto, tais isoladores frequentemente ligar proteínas
que recruta enzimas ou remodelação chromatin- modificando-histona
enzimas para a região. Por exemplo, um isolante poderia vincular um
proteína que recruta histona acetiltransferase, o que favoreceria
a acetilação de histonas nucleares.
Uma segunda função é de isoladores para bloquear os efeitos de potenciadores
que exercem os seus efeitos sobre os genes vizinhos. Como discutido
no início deste capítulo, os estimuladores podem estimular a expressão
de genes que são relativamente longe. Para evitar que um intensificador de
um gene de activar a expressão de um gene adjacente, um
isolador pode ser localizado entre eles. No exemplo mostrado
na Figura 15.17b, o intensificador pode activar a expressão de
Um gene, mas o elemento de isolamento impede de exercer os seus efeitos sobre
gene B. Por outras palavras, o gene B é isolado a partir dos efeitos de
este potenciador. Como isso ocorre? Embora o mecanismo de
bloqueio potenciador pode variar entre os diferentes genes, um mecanismo
é ciclo cromossoma, o qual é descrito a seguir.

Insulators May Promote the Formation of Loops
That Block the Effects of Nearby Enhancers
How do insulators block the regulatory effects of enhancers? The
mechanisms of insulator function are still being actively investigated,
but one way they may block the activity of enhancers
is by a looping mechanim. This type of mechanism is thought
to operate with regard to an insulator that affects the Igf2 gene,
which is discussed in Chapter 5 (see Figure 5.11 ). Furthermore,
the insulator plays a role in imprinting. Figure 15.18 shows a
simplified mechanism for the effects of an insulator (also called
the imprinting control region, or ICR) that is located between the
H19 and Igf2 genes. An enhancer is found next to the H19 gene.
To prevent this enhancer from also stimulating the Igf2 gene,
a loop is formed. For this to occur, a protein called the CTCbinding
factor, or CTCF, binds to both the insulator and to a site
that follows the Igf2 gene called a differentially methylated region
(DMR). The CTCFs bound to these sites then bind to each other
to form a loop in the DNA. This loop blocks the ability of the
enhancer to stimulate the Igf2 gene.
Alternatively, if the insulator and DMR are methylated,
which occurs during sperm formation, CTCF is unable to bind
to the DNA (see bottom right of Figure 15.18). This prevents
loop formation, which allows the enhancer to stimulate the Igf2
gene. Therefore, the paternally inherited Igf2 gene is transcriptionally
activated. By comparison, the maternally inherited Igf2
gene, which is not methylated, is transcriptionally silent due to
the looping mechanism shown in Figure 15.18.


Isoladores podem promover a constituição de Loops
Que bloqueiam os efeitos de promotores nas proximidades
Como isoladores bloquear os efeitos reguladores de potenciadores? o
mecanismos de função isolante ainda estão sendo ativamente investigados,
mas uma maneira que eles podem bloquear a atividade de promotores
é por um mechanim looping. Esse tipo de mecanismo é pensado
para operar no que diz respeito a um isolador que afecta o gene Igf2,
que é discutido no capítulo 5 (ver Figura 5.11). Além disso,
o isolador desempenha um papel na impressão. A Figura mostra um 15.18
mecanismo simplificado para os efeitos de um isolador (também chamada
a região de controlo de impressão, ou ICR) que está localizado entre o
Genes H19 e IGF2. Um potenciador é encontrado ao lado do gene H19.
Para evitar que esse estimulador de também estimular o gene Igf2,
um circuito é formado. Para que isto aconteça, uma proteína de ligação a chamada CTCF
factor de, ou CTCF, liga-se tanto a camada isolante e a um site
que segue o gene Igf2 chamada uma região diferencialmente metilada
(DMR). O ligamento CTCF a estes locais, em seguida, se ligam uns aos outros
para formar um laço no ADN. Este blocos de loop a capacidade do
potenciador para estimular o gene Igf2.
Em alternativa, se o elemento de isolamento e DMR são metilados,
que ocorre durante a formação de esperma, CTCF é incapaz de se ligar
ao DNA (ver parte inferior direita da Figura 15.18). Isto impede
formação da laçada, o que permite que o intensificador de estimular a Igf2
gene. Portanto, o gene Igf2 herdada do pai é transcriptionally
activado. Por comparação, o Igf2 herdados maternalmente
gene, que não é metilado, é transcricionalmente silencioso devido
o mecanismo de loop mostrado na Figura 15.18.


15.5 REGULATION OF RNA
PROCESSING, RNA STABILITY,
AND TRANSLATION
Thus far, we have considered a variety of mechanisms that regulate
the level of gene transcription. These mechanisms control
the amount of RNA transcribed from a given gene. In addition,
eukaryotic gene expression is commonly regulated after the
RNA is made (Table 15.2 ). One mechanism is pre-mRNA processing.
Following transcription, a pre-mRNA transcript is processed
before it becomes a functional mRNA. These processing
events, which include splicing, capping, polyA tailing, and RNA
editing, were described in Chapter 12 . We begin this section by
examining how the process of alternative splicing is regulated at
the RNA level.
Another strategy for regulating gene expression is to influence
the concentration of mRNA. This can be accomplished by
regulating the rate of transcription. When the transcription of a
gene is increased, a higher concentration of the corresponding
RNA results. In addition, RNA concentration is greatly affected
by the stability or half-life of a particular RNA. Factors that
increase RNA stability are expected to raise the concentration
of that RNA molecule. We will explore how sequences within
mRNA molecules greatly affect their stability.
We also consider a newly discovered mechanism of mRNA
silencing, known as RNA interference, which involves doublestranded
RNAs that may direct the breakdown of specific RNAs
or inhibit their translation. In addition to RNA interference, the
process of mRNA translation may be regulated at the level of the
translational machinery such as ribosomes. In eukaryotes, this
can occur by directly controlling the function of translational
initiation factors. Also, RNA-binding proteins can prevent ribosomes
from initiating the translation process for specific mRNAs.
In this section, we will examine these interesting mechanisms for
regulating mRNA translation.

15,5 REGULAMENTO DO RNA
PROCESSAMENTO, RNA ESTABILIDADE,
E TRADUÇÃO
Até agora, foram considerados uma variedade de mecanismos que regulam
o nível de transcrição do gene. Estes mecanismos de controle
a quantidade de ARN transcrito a partir de um determinado gene. Além,
a expressão de genes eucarióticos está geralmente regulada após o
ARN é feita (Tabela 15.2). Um mecanismo é o processamento de pré-mRNA.
Após a transcrição, um transcrito de ARNm de pré-processado é
antes que se torne um mRNA funcional. Estes transformação
eventos, que incluem splicing, tampando, poli-tailing e RNA
edição, foram descritos no Capítulo 12. Começamos esta seção
examinar a forma como o processo de splicing alternativo é regulada a
o nível de ARN.
Outra estratégia para a regulação da expressão do gene é influenciar
a concentração de ARNm. Isto pode ser conseguido pela
regulando a velocidade de transcrição. Quando a transcrição de um
gene é aumentada, uma concentração mais elevada do que corresponde
Resultados RNA. Além disso, a concentração de RNA é grandemente afectada
por a estabilidade ou a semi-vida de um determinado ARN. Os factores que
aumentar a estabilidade do ARN são esperados para elevar a concentração de
dessa molécula de ARN. Vamos explorar como as seqüências dentro
moléculas de mRNA afetar significativamente a sua estabilidade.
Também consideramos um mecanismo recém-descoberta de mRNA
silenciamento, conhecido como RNA de interferência, que envolve doublestranded
RNAs que podem direcionar a repartição dos RNAs específicos
ou inibir a sua tradução. Além disso a interferência de ARN, o
processo de tradução do mRNA pode ser regulada ao nível da
maquinaria de tradução, tais como ribossomas. Nos eucariotas, esta
pode ocorrer através do controlo directamente a função de translação
fatores de iniciação. Além disso, as proteínas de ligação a ARN pode impedir ribossomas
de iniciar o processo de tradução para mRNAs específicos.
Nesta seção, vamos examinar esses mecanismos interessantes para
que regula a tradução do mRNA.

Alternative Splicing Regulates Which Exons
Occur in an RNA Transcript, Allowing Different
Polypeptides to Be Made from the Same
Structural Gene
When it was first discovered, the phenomenon of splicing seemed
like a rather wasteful process. During transcription, energy is
used to synthesize intron sequences. Likewise, energy is also
used to remove introns via a large spliceosome complex. This
observation intrigued many geneticists, because natural selection
tends to eliminate wasteful processes. Therefore, instead of
simply viewing splicing as a wasteful process, many geneticists
expected to find that pre-mRNA splicing has one or more important
biological roles. In recent years, one very important biological
advantage has become apparent. This is alternative splicing,
which refers to the phenomenon that a pre-mRNA can be spliced
in more than one way.
What is the advantage of alternative splicing? To understand
the biological effects of alternative splicing, remember that
the sequence of amino acids within a polypeptide determines the
structure and function of a protein. Alternative splicing produces
two or more polypeptides with differences in their amino acid
sequences, leading to possible changes in their functions. In most
cases, the alternative versions of the protein have similar functions,
because most of their amino acid sequences are identical to
each other. Nevertheless, alternative splicing produces differences
in amino acid sequences that provide each polypeptide with its
own unique characteristics. Because alternative splicing allows
two or more different polypeptide sequences to be derived from
a single gene, some geneticists have speculated that an important
advantage of this process is that it allows an organism to carry
fewer genes in its genome.

Splicing alternativo Regula Quais Exons
Ocorrer em um RNA transcrito, permitindo que diferentes
Polipeptídeos a ser feito a partir do mesmo
Gene Estrutural
Quando foi descoberto pela primeira vez, o fenômeno da emenda parecia
como um processo bastante dispendioso. Durante a transcrição, a energia é
utilizado para sintetizar sequências de intrão. Da mesma forma, a energia é também
usado para remover intrões através de um grande complexo spliceosome. este
observação intrigado muitos geneticistas, porque a seleção natural
tende a eliminar processos de desperdício. Portanto, em vez de
simplesmente visitar a emenda como um processo de desperdício, muitos geneticistas
Espera-se que encontrar splicing pré-ARNm de uma ou mais importante
papéis biológicos. Nos últimos anos, um muito importante biológica
vantagem tornou-se aparente. Este é splicing alternativo,
refere-se ao fenómeno de que um pré-ARNm pode ser spliced
em mais de uma maneira.
Qual é a vantagem de splicing alternativo? Entender
os efeitos biológicos de splicing alternativo, que se lembrar
a sequência de aminoácidos dentro de um polipéptido determina o
a estrutura e a função de uma proteína. O splicing alternativo produz
dois ou mais polipéptidos com diferenças na sua aminoácido
sequências, levando a possíveis mudanças em suas funções. Na maioria
casos, as versões alternativas da proteína têm funções semelhantes,
porque a maioria das suas sequências de aminoácidos são idênticas às
entre si. No entanto, o splicing alternativo produz diferenças
em sequências de aminoácidos que proporcionam cada um com o seu polipéptido
características únicas próprios. Porque splicing alternativo permite
duas ou mais sequências polipeptídicas diferentes para ser derivada a partir de
um único gene, alguns geneticistas têm especulado que uma importante
vantagem deste processo é que ele permite que um organismo para transportar
menos genes no seu genoma.

The degree of splicing and alternative splicing varies greatly
among different species. Baker’s yeast (Saccharomyces cerevisiae),
for example, contains about 6300 genes and approximately 300
(i.e., approximately 5%) encode pre-mRNAs that are spliced. Of
these, only a few have been shown to be alternatively spliced.
Therefore, in this unicellular eukaryote, alternative splicing is not
a major mechanism for generating protein diversity. In comparison,
complex multicellular organisms seem to rely on alternative
splicing to a great extent. Humans have approximately 20,000 to
25,000 different genes, and most of these contain one or more
introns. Recent estimates suggest that about 70% of all human
pre-mRNAs are alternatively spliced. Furthermore, certain premRNAs
are alternatively spliced to an extraordinary extent.
Some pre-mRNAs can be alternatively spliced to produce dozens
of different mRNAs. This provides a much greater potential for
human cells to create protein diversity.
Figure 15.19 considers an example of alternative splicing
for a gene that encodes a protein known as α-tropomyosin.
This protein functions in the regulation of cell contraction. It is
located along the thin filaments found in smooth muscle cells,
such as those in the uterus and small intestine, and in striated
muscle cells that are found in cardiac and skeletal muscle. Alphatropomyosin
is also synthesized in many types of nonmuscle cells
but in lower amounts. Within a multicellular organism, different
types of cells must regulate their contractibility in subtly different
ways. One way this may be accomplished is by the production of
different forms of α-tropomyosin.
The intron–exon structure of the rat α-tropomyosin premRNA
and two alternative ways that the pre-mRNA can be
spliced are described in Figure 15.19. The pre-mRNA contains
14 exons, 6 of which are constitutive exons (shown in red),
which are always found in the mature mRNA from all cell types.

O grau de splicing e splicing alternativo varia muito,
entre espécies diferentes. Fermento de padeiro (Saccharomyces cerevisiae),
por exemplo, contém cerca de 6300 e cerca de 300 genes
(ou seja, cerca de 5%) codificar pré-ARNm que são emendados. De
Destes, apenas alguns foram mostrados para ser alternativamente emendados.
Portanto, neste eucariota unicelular, splicing alternativo não é
um mecanismo importante para a geração da diversidade de proteínas. Em comparação,
organismos multicelulares complexos parecem confiar em alternativa
splicing, em grande medida. Os seres humanos têm cerca de 20.000 a
25.000 genes diferentes, ea maioria deles contêm uma ou mais
íntrons. Estimativas recentes sugerem que cerca de 70% de todos os humanos
são pré-ARNm de splicing alternativo. Além disso, certos pré mRNAs
são alternativamente, dividida em medida extraordinária.
Alguns pré-ARNm pode ser alternativamente emendados para produzir dezenas
de diferentes ARNm. Isto proporciona um potencial muito maior para
células humanas para criar diversidade de proteínas.
Figura 15.19 considera um exemplo de splicing alternativo
para um gene que codifica uma proteína conhecida como α-tropomiosina.
Este funções de proteínas na regulação da contração celular. isto é
localizada ao longo dos filamentos finos encontrados em células do músculo liso,
tais como aqueles no útero e do intestino delgado, e no estriado
células musculares que são encontrados no músculo cardíaco e esquelético. Alphatropomyosin
também é sintetizada em muitos tipos de células nonmuscle
mas em quantidades inferiores. Dentro de um organismo multicelular, diferente
tipos de células devem regular a sua contratilidade em sutilmente diferente
maneiras. Uma forma como isto pode ser conseguido é através da produção de
diferentes formas de α-tropomiosina.
A estrutura intrão-exão do α-tropomiosina rato premRNA
e duas formas alternativas que a pré-ARNm pode ser
splicing estão descritos na Figura 15.19. O pré-ARNm contém
14 exons, 6 dos quais são constitutivas exons (mostrados em vermelho),
que são sempre encontrados no mRNA maduro de todos os tipos de células.

Presumably, constitutive exons encode polypeptide segments
of the α-tropomyosin protein that are necessary for its general
structure and function. By comparison, alternative exons
(shown in green) are not always found in the mRNA after splicing
has occurred. The polypeptide sequences encoded by alternative
exons may subtly change the function of α-tropomyosin to
meet the needs of the cell type in which it is found. For example,
Figure 15.19 shows the predominant splicing products found in
smooth muscle cells and striated muscle cells. Exon 2 encodes
a segment of the α-tropomyosin protein that alters its function
to make it suitable for smooth muscle cells. By comparison, the
α-tropomyosin mRNA found in striated muscle cells does not
include exon 2. Instead, this mRNA contains exon 3, which is
more suitable for that cell type.
Alternative splicing is not a random event. Rather, the
specific pattern of splicing is regulated in any given cell. The
molecular mechanism for the regulation of alternative splicing
involves proteins known as splicing factors. Such splicing factors
play a key role in the choice of particular splice sites. SR
proteins are an example of a type of splicing factor. SR proteins
contain a domain at their carboxyl-terminal end that is rich in
serines (S) and arginines (R) and is involved in protein–protein
recognition. They also contain an RNA-binding domain at their
amino- terminal end.
As discussed in Chapter 12 , components of the spliceosome
recognize the 5ʹ and 3ʹ splice sites and then remove the intervening
intron. The key effect of splicing factors is to modulate the
ability of the spliceosome to choose 5ʹ and 3ʹ splice sites. This
can occur in two ways. Some splicing factors act as repressors
that inhibit the ability of the spliceosome to recognize a splice
site. In Figure 15.20a , a splicing repressor binds to a 3ʹ-splice site
and prevents the spliceosome from recognizing the site. Instead,
the spliceosome binds to the next available 3ʹ-splice site. The
splicing repressor causes exon 2 to be spliced out of the mature
mRNA, an event called exon skipping. Alternatively, other splicing
factors enhance the ability of the spliceosome to recognize
particular splice sites. In Figure 15.20b, splicing enhancers bind
to the 3ʹ- and 5ʹ-splice sites that flank exon 3, which results in
the inclusion of exon 3 in the mature mRNA.

Presumivelmente, constitutivos exões codificam segmentos polipeptídicos
da proteína α-tropomiosina que são necessárias para o seu geral
estrutura e função. Em comparação, os exões alternativos
(mostrado em verde) nem sempre são encontradas no ARNm após splicing
ocorreu. As sequências de polipéptidos codificados pelos alternativa
exons pode sutilmente alterar a função de α-tropomiosina para
satisfazer as necessidades do tipo de célula em que se encontra. Por exemplo,
Figura 15.19 mostra os produtos de splicing predominantes encontrados em
células de músculo liso e células do músculo estriado. Exon 2 codifica
um segmento da proteína α-tropomiosina que altera a sua função
para torná-lo adequado para as células de músculo liso. Por comparação, o
α-tropomiosina ARNm encontrado em células do músculo estriado não faz
incluem exão 2. Em vez disso, este ARNm contém o exão 3, que é
mais adequado para esse tipo de célula.
O splicing alternativo não é um acontecimento aleatório. Em vez disso, o
padrão específico de splicing é regulado em qualquer célula. o
mecanismo molecular para a regulação do splicing alternativo
envolve proteínas conhecidas como factores de splicing. Tais factores de splicing
desempenham um papel fundamental na escolha de determinados locais de splicing. SR
proteínas são um exemplo de um tipo de factor de splicing. SR proteínas
contêm um domínio na sua extremidade carboxi-terminal que é rica em
serinas (S) e argininas (R) e está envolvido em proteína-proteína
reconhecimento. Eles também contêm um domínio de ligação a ARN-na sua
extremidade do terminal amino.
Como discutido no Capítulo 12, os componentes do spliceosome
reconhecer os locais 5'e 3'emenda e remova a intervir
intron. O efeito dos factores chave de splicing é a modular a
capacidade do spliceossoma escolher 5'e locais de splicing 3 '. este
pode ocorrer de dois modos. Alguns factores de splicing actuar como repressores
que inibem a capacidade de reconhecer o spliceosome uma tala
local. Na Figura 15.20a, um repressor de splicing liga a um local de splicing 3'-
e impede o spliceosome de reconhecer o local. Ao invés,
spliceossoma liga-se ao local seguinte disponível 3'-splicing. o
splicing repressor provoca exão 2 para ser emendados fora do maduro
mRNA, um evento chamado o salto de exon. Alternativamente, outro splicing
factores aumentam a capacidade de reconhecer o spliceosome
em particular locais de splicing. Na Figura 15.20b, intensificadores de splicing ligar
para os 3'- e 5'-splice sites que flanqueiam o exão 3, o que resulta em
a inclusão do exão 3 do ARNm maduro.


Alternative splicing in different tissues is thought to occur
because each cell type has its own characteristic concentration
of many kinds of splicing factors. Furthermore, much like transcription
factors, splicing factors may be regulated by the binding
of small effector molecules, protein–protein interactions, and
covalent modifications. Overall, the differences in the composition
of splicing factors and the regulation of their activities form
the basis for alternative splicing decisions.
The Stability of mRNA Influences
mRNA Concentration
In eukaryotes, the stability of mRNAs can vary considerably.
Certain mRNAs have very short half-lives, such as several minutes,
whereas others can persist for many days or even months.
In some cases, the stability of an mRNA can be regulated so that
its half-life is shortened or lengthened. A change in the stability
of mRNA can greatly influence the cellular concentration of that
mRNA molecule. In this way, mechanisms that control mRNA
stability can dramatically affect gene expression.
Various factors play a role in mRNA stability. One important
structural feature is the length of the polyA tail. As you
may recall from Chapter 12 , most newly made mRNAs contain
a polyA tail that averages 200 nucleotides in length. The polyA
tail is recognized by the polyA-binding protein. The binding
of this protein enhances RNA stability. However, as an mRNA
ages, its polyA tail tends to be shortened by the action of cellular
exo nucleases. Once it becomes less than 10 to 30 adenosines in
length, the polyA-binding protein can no longer bind, and the
mRNA is rapidly degraded by exo- and endonucleases.
Certain mRNAs, particularly those with short half-lives,
contain sequences that act as destabilizing elements. Although
these destabilizing elements can be located anywhere within the
mRNA, they are most commonly located near the 3ʹ end between
the stop codon and the polyA tail. This region of the mRNA is
known as the 3ʹ-untranslated region (3ʹ-UTR). An example of a
destabilizing element is the AU-rich element (ARE) that is found
in many short-lived mRNAs (Figure 15.21 ). This element, which
contains the consensus sequence AUUUA, is recognized by cellular
proteins that bind to the ARE, thereby influencing whether
or not the mRNA is rapidly degraded.

Splicing alternativo em diferentes tecidos é pensado para ocorrer
porque cada tipo de célula tem a sua própria característica de concentração
de muitos tipos de factores de splicing. Além disso, muito parecida com a transcrição
fatores, fatores de splicing pode ser regulamentada pela ligação
de pequenas moléculas efectoras, interacções proteína-proteína, e
Modificações covalentes. Em geral, a diferenças na composição
de factores de splicing e a regulação da sua forma atividades
a base para as decisões de splicing alternativo.
A estabilidade do mRNA de influências
Concentração mRNA
Em eucariotas, a estabilidade de ARNm pode variar consideravelmente.
Certos mRNAs têm meia-vida muito curta, tais como vários minutos,
enquanto outros podem persistir por vários dias ou mesmo meses.
Em alguns casos, a estabilidade de um ARNm pode ser regulada de modo que
sua meia-vida é reduzido ou aumentado. Uma alteração na estabilidade
de ARNm pode influenciar grandemente a concentração celular de que
molécula de ARNm. Deste modo, os mecanismos que controlam o ARNm
estabilidade pode afetar drasticamente a expressão do gene.
Vários factores desempenham um papel na estabilidade do mRNA. Um importante
característica estrutural é o comprimento da cauda poliA. Como você
pode recordar a partir do capítulo 12, a maioria recém-feitos mRNAs conter
uma cauda poli que as médias de 200 nucleótidos de comprimento. O poliA
cauda é reconhecida pela proteína de ligação de poliA. A ligação
desta proteína aumenta a estabilidade de ARN. No entanto, como um ARNm
idades, a cauda poliA tende a ser reduzido pela acção de celular
exo nucleases. Uma vez que torna-se menos do que 10 a 30 em adenosinas
comprimento, a proteína poli-ligação não pode mais ligar, ea
mRNA é rapidamente degradada por exo- e endonucleases.
Certos ARNm, particularmente aqueles com meias-vidas curtas,
contêm sequências que actuam como elementos desestabilizadores. Embora
estes elementos desestabilizadores podem ser localizados em qualquer lugar dentro do
ARNm, eles são mais comumente localizado perto da extremidade 3 'entre
o codão de paragem e a cauda poliA. Esta região do ARNm é
conhecida como a região 3 'não traduzida (3'-UTR). Um exemplo de um
elemento desestabilizador é o elemento rico em AU (ARE), que é encontrado
em muitos mRNAs de vida curta (Figura 15.21). Este elemento, que
AUUUA contém a sequência de consenso, é reconhecido por celular
proteínas que se ligam ao ARE, contribuindo deste modo para se
ou o ARNm não é rapidamente degradado.


Double-Stranded RNA Can Silence
the Expression of mRNA
Another way that specific RNAs can be targeted for degradation
or translational inhibition is via a recently discovered mechanism
involving double-stranded RNA. Research in plants and the
nematode Caenorhabditis elegans led to the discovery that doublestranded
RNA can silence the expression of particular genes.
Studies of plant viruses were one avenue of research that identified
this mechanism of gene regulation. Certain plant viruses
produce double-stranded RNA as part of their life cycle. In addition,
these plant viruses may carry genes very similar to genes 
that already exist in the genome of the plant cell. When such
viruses infect plant cells, they silence the expression of the plant
gene that is similar to the viral gene.
Plant research that involved the production of transgenic
plants also supported the idea that double-stranded RNA can
cause mRNA to be degraded or inhibited. Using molecular techniques
described in Chapter 19 , cloned genes can be introduced
into the genome of plants. Surprisingly, researchers observed
that when cloned genes were introduced in multiple copies, the
expression of the gene was often silenced. How were these results
explained? We now know that this may be due to the formation
of double-stranded RNA. When a cloned gene randomly inserts
into a genome, it may, as a matter of random chance, happen to
insert itself next to a promoter for a plant gene that is already
present in the genome (Figure 15.22 ). The cloned gene itself
has a promoter to make a copy of the sense strand. If it randomly
inserts next to a plant gene promoter that is oriented in
the opposite direction, both strands of the cloned gene would
be transcribed, thereby generating double-stranded RNA.

Double-stranded RNA pode silenciar
a expressão de ARNm
Outra forma que RNAs específicos podem ser direccionados para a degradação
ou inibição da translação é através de um mecanismo recentemente descoberto
envolvendo RNA de cadeia dupla. Investigação em plantas e o
Caenorhabditis elegans nemátodo levou à descoberta de que a cadeia dupla
ARN pode silenciar a expressão de genes particulares.
Estudos de vírus de plantas eram uma avenida de pesquisa que identificou
este mecanismo de regulação gênica. Alguns vírus de plantas
produzir RNA de cadeia dupla como parte de seu ciclo de vida. Além,
estes vírus de plantas podem transportar genes muito semelhantes aos genes
que já existem no genoma da célula da planta. Quando tais
vírus infectam células de plantas, eles silenciar a expressão da planta
gene que é semelhante ao do gene viral.
Plant Research que envolveu a produção de transgénica
plantas também apoiou a idéia de que o RNA de cadeia dupla pode
causar mRNA a ser degradado ou inibida. Utilizando técnicas moleculares
descrito no Capítulo 19, genes clonados podem ser introduzidos
no genoma de plantas. Surpreendentemente, os investigadores observaram
que, quando foram introduzidos os genes clonados em múltiplas cópias, o
a expressão do gene foi frequentemente silenciado. Como foram esses resultados
explicado? Sabemos agora que isto pode ser devido à formação
de RNA de cadeia dupla. Quando um gene clonado insere aleatoriamente
no genoma, pode, como uma questão de acaso, acontecerá a
inserir-se ao lado de um promotor para um gene de planta que é já
presentes no genoma (Figura 15.22). O próprio gene clonado
tem um promotor para fazer uma cópia da cadeia com sentido. Se aleatoriamente
insere ao lado de um promotor de gene vegetal que é orientada em
na direcção oposta, ambas as cadeias do gene clonado
ser transcrito, gerando assim RNA de cadeia dupla.

As
more copies of a cloned gene are introduced into a genome, the
likelihood is greater that the scenario described in Figure 15.22
will occur. This event silences the expression of the cloned gene
even though it is present in multiple copies. Furthermore, if the
cloned gene is homologous to a plant gene that is already present
in the plant cell, this phenomenon will also silence the endogenous
plant gene. Therefore, the curious observation made by
researchers was that increasing the number of copies of a cloned
gene frequently led to gene silencing.

Como
mais cópias de um gene clonado são introduzidos num genoma, o
probabilidade é maior do que o cenário descrito na Figura 15.22
vai acontecer. Este evento silencia a expressão do gene clonado
mesmo que está presente em cópias múltiplas. Além disso, se o
gene clonado é homólogo a um gene de planta que já está presente
na célula da planta, este fenómeno também silenciar o endógena
gene da planta. Por conseguinte, a observação feita por curioso
investigadores era que o aumento do número de cópias de uma clonado
gene freqüentemente levou ao silenciamento do gene.


GENE MUTATION AND DNA REPAIR

T he primary function of DNA is to store information for the synthesis
of cellular proteins. A key aspect of the gene expression process
is that the DNA itself does not normally change. This allows
DNA to function as a permanent storage unit. However, on relatively
rare occasions, a mutation can occur. The term mutation
refers to a heritable change in the genetic material. This means
that the structure of DNA has been changed permanently, and this
alteration can be passed from mother to daughter cells during cell
division. If a mutation occurs in reproductive cells, it may also be
passed from parent to offspring.
The topic of mutation is centrally important in all fields of
genetics, including molecular genetics, Mendelian inheritance, and
population genetics. Mutations provide the allelic variation that we
have discussed throughout this textbook. For example, phenotypic
differences, such as tall versus dwarf pea plants, are due to mutations
that alter the expression of particular genes. With regard to
their phenotypic effects, mutations can be beneficial, neutral, or
detrimental. On the positive side, mutations are essential to the
continuity of life. They provide the variation that enables species to
change and adapt to their environment. Mutations are the foundation
for evolutionary change. On the negative side, however, new
mutations are much more likely to be harmful rather than beneficial
to the individual. The genes within each species have evolved to
work properly. They have functional promoters, coding sequences,
terminators, and so on, that allow the genes to be expressed. Random
mutations are more likely to disrupt these sequences rather
than improve their function. For example, many inherited human
diseases result from mutated genes. In addition, diseases such as
skin and lung cancer can be caused by environmental agents that
are known to cause DNA mutations. For these and many other reasons,
understanding the molecular nature of mutations is a deeply
compelling area of research. In this chapter, we will consider the
nature of mutations and their consequences on gene expression at
the molecular level.

Mutação genética e reparo de DNA

T ele função primária de DNA é armazenar informações para a síntese
de proteínas celulares. Um aspecto fundamental do processo de expressão gênica
é que o próprio DNA normalmente não mudam. Isso permite
ADN para funcionar como uma unidade de armazenamento permanente. No entanto, em relativamente
raras ocasiões, uma mutação pode ocorrer. A mutação termo
refere-se a uma mudança hereditária no material genético. Isso significa
que a estrutura de ADN foi alterada de forma permanente, e esta
alteração pode ser transmitido da mãe para as células filhas durante celular
divisão. Se uma mutação ocorre em células reprodutivas, pode também ser
passou de pais para filhos.
O tema da mutação é centralmente importante em todas as áreas de
genética, incluindo a genética molecular, herança mendeliana, e
genética de populações. Mutações proporcionar a variação alélica que nós
ter discutido ao longo deste livro. Por exemplo, fenotípica
diferenças, como a altura contra plantas de ervilha anões, são devidos a mutações
que alteram a expressão de genes particulares. No que diz respeito aos
seus efeitos fenotípicos, as mutações podem ser benéficos, neutro, ou
prejudicial. No lado positivo, as mutações são essenciais para o
continuidade da vida. Eles fornecem o que permite a variação de espécies
mudar e se adaptar ao seu ambiente. As mutações são a base
para a mudança evolutiva. No lado negativo, no entanto, novos
mutações são muito mais propensos a ser prejudicial ao invés de benéfico
para o indivíduo. Os genes dentro de cada espécie evoluíram para
trabalhe corretamente. Eles têm promotores funcionais, sequências codificantes,
terminadores, e assim por diante, que permitem que os genes a ser expressos. aleatório
mutações são mais susceptíveis de perturbar estas sequências em vez
de melhorar a sua função. Por exemplo, muitos humana herdada
doenças resultam de genes mutados. Além disso, doenças tais como a
da pele e o cancro do pulmão pode ser causada por agentes ambientais que
são conhecidos por causar mutações de ADN. Por estas e muitas outras razões,
compreensão da natureza molecular das mutações é um profundamente
área de obrigação da pesquisa. Neste capítulo, vamos considerar o
natureza das mutações e suas conseqüências sobre a expressão gênica em
a nível molecular.

Because mutations can be quite harmful, organisms have
developed several ways to repair damaged DNA. DNA repair systems
reverse DNA damage before it results in a mutation that could
potentially have negative consequences. DNA repair systems have
been studied extensively in many organisms, particularly Escherichia
coli, yeast, mammals, and plants. A variety of systems repair
different types of DNA lesions. In this chapter, we will examine the
ways that several of these DNA repair systems operate.
16.1 CONSEQUENCES OF MUTATION
How do mutations affect phenotype? To answer this question, we
must appreciate how changes in DNA structure can ultimately
affect DNA function. Much of our understanding of mutation
has come from the study of experimental organisms, such as bacteria,
yeast, and Drosophila. Researchers can expose these organisms
to environmental agents that cause mutation and then study
the consequences of the induced mutations. In addition, because
these organisms have a short generation time, researchers can
investigate the effects of mutation when they are passed from cell
to cell and from parent to offspring.
As discussed in Chapter 8 , changes in chromosome structure
and number are important occurrences within natural
populations of eukaryotic organisms. These types of changes
are considered to be mutations because the genetic material has
been altered in a way that can be inherited. In comparison, a
gene mutation is a relatively small change in DNA structure that
affects a single gene. In this section, we will be primarily concerned
with the ways that mutations may affect the molecular
and phenotypic expression of single genes. We will also consider
how the timing of mutations during an organism’s development
has important consequences.

Porque as mutações pode ser bastante prejudicial, organismos têm
desenvolvidas várias maneiras de reparar o DNA danificado. Sistemas de reparo de DNA
reverter o dano de ADN antes que resulta em uma mutação que poderia
potencialmente ter consequências negativas. Sistemas de reparo de DNA têm
sido extensivamente estudada em muitos organismos, especialmente Escherichia
coli, levedura, mamíferos e plantas. Uma variedade de sistemas de reparação
diferentes tipos de lesões do ADN. Neste capítulo, vamos examinar a
maneiras que vários destes sistemas de reparo de DNA operam.
16.1 CONSEQUÊNCIAS DE MUTAÇÃO
Como fazer mutações afetam o fenótipo? Para responder a esta pergunta, nós
deve apreciar como as mudanças na estrutura do DNA pode, em última instância
afetar a função do DNA. Muito da nossa compreensão da mutação
veio do estudo de organismos experimentais, tais como bactérias,
levedura e Drosophila. Pesquisadores podem expor esses organismos
a agentes ambientais que provocam a mutação e depois estudar
as consequências das mutações induzidas. Além disso, porque
estes organismos têm um tempo de geração curto, os pesquisadores podem
investigar os efeitos da mutação quando são passados ​​a partir de células
para celular e de pais para filhos.
Como discutido no Capítulo 8, as mudanças na estrutura dos cromossomas
e número de ocorrências são importantes dentro naturais
populações de organismos eucarióticos. Estes tipos de mudanças
são considerados mutações, pois o material genético tem
foi alterado de forma que podem ser herdadas. Em comparação, uma
mutação genética é relativamente pequena mudança na estrutura de DNA que
afecta um único gene. Nesta seção, nós estaremos principalmente preocupados
com os modos que as mutações podem afectar a moleculares
e expressão fenotípica de genes individuais. Também vamos estudar
como a temporização de mutações durante o desenvolvimento de um organismo
tem consequências importantes.


Gene Mutations Are Molecular Changes
in the DNA Sequence of a Gene
A gene mutation occurs when the sequence of the DNA within a
gene is altered in a permanent way. A gene mutation can involve
a base substitution in the sequence within a gene or a removal or
addition of one or more base pairs.
A point mutation is a change in a single base pair within
the DNA. For example, the DNA sequence shown here has been
altered by a base substitution, in which one base is substituted
for another.
↓
5ʹ–AACGCTAGATC–3ʹ→5ʹ–AACGCGAGATC–3ʹ
3ʹ–TTGCGATCTAG–5ʹ 3ʹ–TTGCGCTCTAG–5ʹ
A change of a pyrimidine to another pyrimidine, such as C to
T, or a purine to another purine, such as A to G, is called a transition.
This type of mutation is more common than a transversion,
in which purines and pyrimidine are interchanged. The example
just shown is a transversion (a T to G change), not a transition.
Besides base substitutions, a short sequence of DNA may
be deleted from or added to the chromosomal DNA:
↓
5ʹ–AACGCTAGATC–3ʹ→5ʹ–AACGCTC–3ʹ
3ʹ–TTGCGATCTAG–5ʹ 3ʹ–TTGCGAG–5ʹ
(Deletion of 4 bp)
__↓_
5ʹ–AACGCTAGATC–3ʹ→5ʹ–AACAGTCGCTAGATC–3ʹ
3ʹ–TTGCGATCTAG–5ʹ 3ʹ–TTGTCAGCGATCTAG–5'
(Addition of 4 bp)
As we will see next, small deletions or additions to the sequence of
a gene can significantly affect the function of the encoded protein.

As mutações do gene são alterações moleculares
na sequência de ADN de um gene
A mutação do gene ocorre quando a sequência de ADN dentro de um
gene está alterado de uma forma permanente. Uma mutação genética pode envolver
uma substituição de base na sequência de um gene ou dentro de um ou remoção
adição de um ou mais pares de bases.
Uma mutação de ponto é uma alteração em um único par de bases dentro
o ADN. Por exemplo, a sequência de ADN mostrada aqui tem sido
alterada por uma substituição de base, em que uma base é substituído
para outro.
↓
5'-AACGCTAGATC-3'-5'→ AACGCGAGATC-3'
3'-5'TTGCGATCTAG-3'-5'-TTGCGCTCTAG
Uma alteração de uma pirimidina, à outra pirimidina, tais como a C
T, ou uma purina de purina para outro, tal como A a G, é chamado de transição.
Este tipo de mutação é mais comum do que um transversion,
em que as purinas e das pirimidinas são trocadas entre si. O exemplo
apenas é mostrado um transversion (a T para G mudança), e não uma transição.
Além substituições de base, uma pequena sequência de DNA pode
ser excluído ou adicionado ao DNA cromossômico:
↓
5'-AACGCTAGATC-3'-5'→ AACGCTC-3'
3'-5'TTGCGATCTAG-3'-5'-TTGCGAG
(Supressão de 4 pb)
__ _ ↓
5'-AACGCTAGATC-3'-5'→ AACAGTCGCTAGATC-3'
3'-5'-TTGCGATCTAG 3'-TTGTCAGCGATCTAG-5 '
(Adição de 4 pb)
Como veremos a seguir, pequenas deleções ou adições à sequência de
um gene pode afectar significativamente a função da proteína codificada.



Gene Mutations Can Alter the
Coding Sequence Within a Gene
How might a mutation within the coding sequence of a structural
gene affect the amino acid sequence of the polypeptide that
is encoded by the gene? Table 16.1 describes the possible effects
of point mutations. Silent mutations are those that do not alter
the amino acid sequence of the polypeptide even though the
nucleotide sequence has changed. Because the genetic code is
degenerate, silent mutations can occur in certain bases within a
codon, such as the third base, so the specific amino acid is not
changed. In contrast, missense mutations are base substitutions
in which an amino acid change does occur. An example
of a missense mutation occurs in the human disease known as
sickle cell anemia. This disease involves a mutation in the β-
globin gene, which alters the polypeptide sequence so the sixth
amino acid is changed from a glutamic acid to valine. This single
amino acid substitution alters the structure and function of the
hemoglobin protein. One consequence of this alteration is that
the red blood cells assume a sickle shape under conditions of low
oxygen (Figure 16.1 ). In this case, a single amino acid substitution
has a profound effect on the phenotype of cells and even
causes a serious disease.
Nonsense mutations involve a change from a normal
codon to a stop codon. This terminates the translation of the
polypeptide earlier than expected, producing a truncated polypeptide
(see Table 16.1). When a nonsense mutation occurs in
a bacterial operon, it may also inhibit the expression of downstream
genes. This phenomenon, termed polarity, is described
in solved problem S4 at the end of this chapter. Finally, frameshift
mutations involve the addition or deletion of a number
of nucleotides that is not divisible by three. Because the codons
are read in multiples of three, this shifts the reading frame. The
translation of the mRNA then results in a completely different
amino acid sequence downstream from the mutation.

As mutações genéticas podem alterar a
Sequência de codificação dentro de um gene
Como pode uma mutação na sequência de codificação de um estrutural
gene afecta a sequência de aminoácidos do polipéptido que
é codificado pelo gene? Tabela 16.1 descreve os possíveis efeitos
de mutações pontuais. Mutações silenciosas são aquelas que não alteram
a sequência de aminoácidos do polipéptido, embora o
sequência de nucleótidos foi alterado. Uma vez que o código genético é
degenerados, mutações silenciosas pode ocorrer em determinadas bases numa
codão, tal como a terceira base, de modo que o amino ácido não é específico
mudado. Em contraste, as mutações são substituições de bases missense
em que ocorre uma alteração de um aminoácido. Um exemplo
missense de uma mutação ocorre na doença humana conhecida como
anemia falciforme. Esta doença envolve uma mutação no β-
do gene da globina, que altera a sequência de polipéptido de modo que o sexto
de aminoácidos é alterado a partir de um ácido glutâmico por valina. Este single
substituição de aminoácidos altera a estrutura e a função do
proteína hemoglobina. Uma das consequências desta alteração é que
as células vermelhas do sangue assumir uma forma de foice, em condições de baixo
oxigénio (Figura 16.1). Neste caso, uma única substituição de aminoácido
tem um efeito profundo sobre o fenótipo das células e inclusive
provoca uma doença grave.
Mutações nonsense envolver uma mudança a partir de uma normais
codão para um codão de paragem. Isto termina a tradução do
polipéptido mais cedo do que o esperado, a produção de um polipeptídeo truncado
(ver Tabela 16.1). Quando uma mutação sem sentido no ocorre
um operão bacteriano, que também podem inibir a expressão de jusante
genes. Este fenómeno, chamado de polaridade, é descrito
no problema resolvido S4 no final deste capítulo. Finalmente, frameshift
mutações envolvem a adição ou supressão de um número
de nucleotídeos que não é divisível por três. Porque os codões
são lidos em múltiplos de três, este desloca a estrutura de leitura. o
a tradução do mRNA resulta então num completamente diferente
a sequência de aminoácidos a jusante da mutação.


Except for silent mutations, new mutations are more likely
to produce polypeptides that have reduced rather than enhanced
function. For example, when nonsense mutations produce polypeptides
that are substantially shorter, the shorter polypeptides
are unlikely to function properly. Likewise, frameshift mutations
dramatically alter the amino acid sequence of polypeptides and
are thereby likely to disrupt function. Missense mutations are less
likely to alter function because they involve a change of a single
amino acid within polypeptides that typically contain hundreds
of amino acids. When a missense mutation has no detectable
effect on protein function, it is referred to as a neutral mutation.
A missense mutation that substitutes an amino acid with a
similar chemistry as the original amino acid is likely to be neutral
or nearly neutral. For example, a missense mutation that substitutes
a glutamic acid for an aspartic acid is likely to be neutral
because both amino acids are negatively charged and have similar
side chain structures. Silent mutations are also considered a
type of neutral mutation.
Mutations can occasionally produce a polypeptide with an
enhanced ability to function. Although these favorable mutations
are relatively rare, they may result in an organism with a greater
likelihood to survive and reproduce. If this is the case, natural
selection may cause such a favorable mutation to increase in frequency
within a population. This topic will be discussed later in
this chapter and also in Chapter 24 .

Excepto para as mutações silenciosas, as novas mutações são mais propensos
para produzir polipeptídeos que reduziram em vez de melhoradas
função. Por exemplo, quando mutações nonsense produzir polipeptídeos
que são substancialmente mais curtos, os polipéptidos mais curtos
não são susceptíveis de funcionar corretamente. Do mesmo modo, as mutações frameshift
alterar drasticamente a sequência de aminoácidos de polipéptidos e
são, assim, susceptíveis de perturbar função. Mutações missense são menos
susceptível de alterar a função porque envolvem uma mudança de um único
aminoácido dentro polipéptidos que geralmente contêm centenas
de aminoácidos. Quando uma mutação sem sentido não tem detectável
efeito sobre a função da proteína, que é referido como uma mutação neutra.
Uma mutação sem sentido que substitui um aminoácido com um
química semelhante como o aminoácido inicial é susceptível de ser neutro
ou quase neutro. Por exemplo, uma mutação sem sentido que substitui
um ácido glutâmico por um ácido aspártico é provável que seja neutro
porque ambos os aminoácidos são carregadas negativamente e têm semelhante
estruturas de cadeia lateral. Mutações silenciosas são também considerados um
tipo de mutação neutra.
As mutações podem ocasionalmente produzir um polipéptido com um
capacidade aumentada para funcionar. Embora estas mutações favoráveis
são relativamente raras, que pode resultar em um organismo com uma maior
probabilidade de sobreviver e reproduzir. Se este for o caso, naturais
selecção pode causar uma mutação tão favorável para aumentar em frequência
dentro de uma população. Este tópico será discutido mais tarde em
este capítulo e também no capítulo 24.


Gene Mutations Can Occur Outside of the Coding
Sequence and Still Influence Gene Expression
Thus far, we have focused our attention on mutations in the
coding regions of genes and their effects on polypeptide structure
and protein function. In previous chapters, we learned how
various sequences outside the coding sequence play important
roles during the process of gene expression. A mutation
can occur within noncoding sequences and thereby affect gene
expres​sion(Table 16.2 ). For example, a mutation may alter the
sequence within the core promoter of a gene. Promoter mutations
that increase transcription are termed up promoter mutations.
Mutations that make a sequence more like the consensus
sequence are likely to be up promoter mutations. In contrast, a
down promoter mutation causes the promoter to become less
like the consensus sequence, decreasing its affinity for regulatory
factors and decreasing the transcription rate.
In Chapter 14 , we considered how mutations could affect
regulatory elements. For example, mutations in the lac operator
site, called lacOC mutations, prevent the binding of the lac
repressor protein. This causes the lac operon to be constitutively
expressed even in the absence of lactose. Bacteria strains with
lacOC mutations are at a selective disadvantage compared with
wild-type E. coli strains because they waste their energy expressing
the lac operon even when these proteins are not needed. As
noted in Table 16.2, mutations can also occur in other noncoding
regions of a gene and alter gene expression in a way that may
affect phenotype. For example, mutations that affect the untranslated
regions of mRNA—the 5ʹ-UTR and 3ʹ-UTR—may affect
gene expression if they alter its ability to be translated or its stability.
In addition, mutations in eukaryotic genes can alter splice
junctions and affect the order or number of exons contained
within mRNA.

As mutações genéticas podem ocorrer fora do Coding
Sequência e ainda influenciam Gene Expression
Até agora, temos focado a nossa atenção sobre as mutações no
regiões de genes e os seus efeitos sobre a estrutura de codificação de polipéptido
e a função da proteína. Nos capítulos anteriores, nós aprendemos como
várias sequências exteriores à sequência de codificação importante jogo
papéis durante o processo de expressão genética. Uma mutação
pode ocorrer dentro de seqüências não codificadoras e, assim, afetar gene
expressão (Tabela 16.2). Por exemplo, uma mutação pode alterar o
sequência dentro do promotor nuclear de um gene. Mutações de promotor
aumento da transcrição que são denominadas mutações acima promotor.
As mutações que tornam a uma sequência de consenso o mais parecido
sequência são susceptíveis de ser de mutações do promotor. Em contraste, uma
baixo mutação faz com que o promotor o promotor de se tornar menos
como a sequência de consenso, diminuindo a sua afinidade para regulamentar
factores e diminuindo a taxa de transcrição.
No Capítulo 14, foram considerados como as mutações podem afetar
elementos reguladores. Por exemplo, as mutações no operador lac
local, chamadas mutações lacOC, evitar a ligação do lac
proteína repressora. Isto faz com que o operão lac ser constitutivamente
expresso, mesmo na ausência da lactose. Estirpes com bactérias
mutações lacOC estão em desvantagem em comparação com seletivo
de tipo selvagem E. coli porque eles perdem sua energia expressando
o operão lac, mesmo quando estas proteínas não são necessários. Como
observado na Tabela 16.2, as mutações também pode ocorrer em outros não codificante
regiões de um gene de expressão do gene e alterar de uma maneira que pode
afetam o fenótipo. Por exemplo, as mutações que afectam a não traduzida
regiões de ARNm-a 5'-UTR e 3? -UTR pode afectar-
a expressão do gene que se alterar a sua capacidade de ser traduzida ou a sua estabilidade.
Além disso, as mutações em genes eucarióticos pode alterar splicing
entroncamentos e afetam a ordem ou o número de exons contido
dentro de ARNm.

Gene Mutations Are Also Given Names
That Describe How They Affect the
Wild-Type Genotype and Phenotype
Thus far, several genetic terms have been introduced that
describe the molecular effects of mutations. Genetic terms are
also used to describe the effects of mutations relative to a wildtype
genotype or phenotype. In a natural population, the wild
type is a relatively prevalent genotype. Many or most genes exist
as multiple alleles so that a population may have two or more
wild-type alleles. A mutation may change a wild-type genotype
by altering the DNA sequence of a gene. When such a mutation
is rare in a population, it is generally referred to as a mutant
allele. A reverse mutation, more commonly called a reversion,
changes a mutant allele back to a wild-type allele.
Another way to describe a mutation is based on its influence
on the wild-type phenotype. Mutants are often characterized
by their differential ability to survive. As mentioned, a
neutral mutation does not alter protein function, so it does not
affect survival or reproductive success. A deleterious mutation,
however, decreases the chances of survival and reproduction.
The extreme example of a deleterious mutation is a lethal mutation,
which results in death to the cell or organism. On the other
hand, a beneficial mutation enhances the survival or reproductive
success of an organism. In some cases, an allele may be either
deleterious or beneficial depending on the genotype and/or the
environmental conditions. An example is the sickle cell allele. In
the homozygous state, the sickle cell allele lessens the chances
of survival. However, an individual who is heterozygous for the
sickle cell allele and wild-type allele has an increased chance of
survival due to malarial resistance .
Finally, some mutations are called conditional mutants
because they affect the phenotype only under a defined set of
conditions. Geneticists often study conditional mutants in microorganisms;
a common example is a temperature-sensitive (ts)
mutant. A bacterium that has a ts mutation grows normally in
one temperature range—the permissive temperature range—but
exhibits defective growth at a different temperature range—the
nonpermissive range. For example, an E. coli strain carrying a ts
mutation may be able to grow from 33 to 38°C but not between
40 to 42°C, whereas the wild-type strain can grow at either temperature
range.

Mutações genéticas também são dadas Names
Que descrevem como eles afetam o
Wild-Tipo de genótipo e fenótipo
Até agora, vários termos genéticos que foram introduzidas
descrevem os efeitos moleculares de mutações. Termos genéticos são
também usado para descrever os efeitos de mutações em relação ao tipo selvagem
genótipo ou fenótipo. Em uma população natural, o selvagem
tipo é um genótipo relativamente prevalente. Existem muitos ou a maioria dos genes
como múltiplos alelos de modo que uma população podem ter dois ou mais
de tipo selvagem alelos. A mutação pode alterar um genótipo de tipo selvagem
através da alteração da sequência de ADN de um gene. Quando uma mutação tal
é raro na população, é geralmente referido como um mutante
alelo. Uma mutação reversa, mais comumente chamado de reversão,
muda de um alelo mutante de volta para um alelo de tipo selvagem.
Outra maneira de descrever é uma mutação com base na sua influência
no fenótipo do tipo selvagem. Mutantes são frequentemente caracterizados
pela sua capacidade diferencial para sobreviver. Como mencionado, uma
mutação neutra não altera a função da proteína, por isso não faz
afetar a sobrevivência ou sucesso reprodutivo. Uma mutação deletéria,
no entanto, diminui as chances de sobrevivência e reprodução.
O exemplo extremo de uma mutação é deletério uma mutação letal,
o que resulta na morte da célula ou organismo. No outro
lado, uma mutação benéfica aumenta a sobrevivência ou reprodutiva
o sucesso de um organismo. Em alguns casos, um alelo pode ser tanto
deletério ou benéfico, dependendo do genótipo e / ou o
condições ambientais. Um exemplo é o alelo falciforme. Dentro
o estado homozigótico, o alelo falciforme diminui as possibilidades
de sobrevivência. No entanto, um indivíduo que é heterozigótico para o
alelo falciforme e alelo selvagem tem uma chance maior de
sobrevivência devido à resistência da malária.
Finalmente, algumas mutações são chamados mutantes condicionais
porque eles afetam o fenótipo somente sob um conjunto definido de
condições. Geneticistas, muitas vezes estudar mutantes condicionais em microorganismos;
Um exemplo comum é uma sensíveis à temperatura (ts)
mutante. Uma bactéria que tem uma mutação ts cresce normalmente na
uma temperatura gama-a temperatura permissiva gama-mas
apresenta crescimento defeituoso a uma temperatura diferente gama-o
intervalo não permissivo. Por exemplo, uma estirpe de E. coli carregando um ts
mutação pode ser capaz de crescer a partir de 33 a 38 ° C, mas não entre
40 a 42 ° C, ao passo que a estirpe de tipo selvagem podem crescer em qualquer temperatura
alcance.


Suppressor Mutations Reverse the Phenotypic
Effects of Another Mutation
A second mutation sometimes affects the phenotypic expression
of a first mutation. As an example, let’s consider a mutation
that causes an organism to grow very slowly. A second mutation
at another site in the organism’s DNA may restore the normal
growth rate, converting the mutant back to the wild-type phenotype.
Geneticists call these second-site mutations suppressors,
or suppressor mutations. This name is meant to indicate that
a suppressor mutation acts to suppress the phenotypic effects of
another mutation. A suppressor mutation differs from a reversion,
because it occurs at a DNA site that is distinct from the first
mutation. Suppressor mutations are classified according to their relative
locations with regard to the mutation they suppress (Table
16.3 ). When the second mutant site is within the same gene as
the first, the mutation is termed an intragenic suppressor. This
type of suppressor often involves a change in protein structure
that compensates for an abnormality in protein structure caused
by the first mutation. Researchers often isolate suppressor mutations
to obtain information about protein structure and function.
For example, Robert Brooker and colleagues have isolated
many intragenic suppressors in the lacY gene of E. coli, which
encodes the lactose permease described in Chapter 15 . This protein
must undergo conformational changes to transport lactose
across the cell membrane. They began with single mutations that
altered amino acids on transmembrane regions, which inhibited
this conformational change, thereby preventing growth on media
containing lactose . Suppressor mutations were then isolated
that allowed growth on lactose by restoring transport function.
By analyzing the locations of these suppressor mutations, the
researchers were able to determine that certain transmembrane
regions in the protein are critical for conformational changes
required for lactose transport.

Mutações supressoras Inverta a fenotípica
Efeitos de uma outra mutação
Uma segunda mutação, por vezes afecta a expressão fenotípica
de uma primeira mutação. Como exemplo, vamos considerar uma mutação
que faz com que um organismo a crescer muito lentamente. A segunda mutação
em outro local no DNA do organismo pode restaurar a normalidade
taxa de crescimento, a conversão do mutante de volta para o fenótipo de tipo selvagem.
Os geneticistas chamam essas segunda-site de mutações supressores,
ou mutações supressoras. Este nome serve para indicar que
uma mutação supressora actua para suprimir os efeitos fenotípicos de
outra mutação. Uma mutação supressora difere de uma reversão,
porque ocorre num local de ADN que é distinta da primeira
mutação. Mutações supressoras são classificados de acordo com seu parente
locais no que diz respeito à mutação (Tabela eles suprimem
16.3). Quando o segundo sítio mutante está dentro do mesmo gene que
a primeira, a mutação é denominado um supressor intragénica. este
tipo de supressor muitas vezes envolve uma mudança na estrutura da proteína
que compensa a uma anomalia na estrutura da proteína causada
por a primeira mutação. Pesquisadores muitas vezes isolar mutações supressoras
para obter informações sobre a estrutura e função da proteína.
Por exemplo, Robert Brooker e colegas isolaram
muitos supressores intragênicos no gene Lacy de E. coli, que
codifica a lactose permease descrito no Capítulo 15. Esta proteína
devem ser submetidos a mudanças de conformação para o transporte de lactose
através da membrana celular. Eles começaram com mutações simples que
aminoácidos alterados nas regiões transmembranares, que inibiram
esta alteração conformacional, impedindo desse modo o crescimento em meios
contendo lactose. Supressores de mutações foram então isolados
que permitiu o crescimento em lactose, restaurando função de transporte.
Ao analisar os locais destas mutações supressoras, o
os pesquisadores foram capazes de determinar que certos transmembranar
em regiões da proteína são críticos para modificações conformacionais
necessária para o transporte lactose.

Alternatively, a suppressor mutation can be in a different
gene from the first mutation—an intergenic suppressor.
Researchers often study intergenic suppressors as a way to gain
information about proteins that have similar or redundant functional
roles, proteins that participate in a common pathway,
multi meric proteins with two or more subunits, and the regulation
of protein expression by transcription factors. An example
of an intergenic suppressor analysis in Drosophila is described in
Chapter 4 (see Figure 4.25).
How do intergenic suppressors work? These suppressor
mutations usually involve a change in the expression of one
gene that compensates for a loss-of-function mutation affecting
another gene (see Table 16.3). For example, a first mutation
may cause one protein to be partially or completely defective.
An intergenic suppressor mutation in a different structural gene
might overcome this defect by altering the structure of a second
protein so that it could take over the functional role the first protein
cannot perform. Alternatively, intergenic suppressors may
involve proteins that participate in a common cellular pathway.
When a first mutation affects the activity of a protein, a suppressor
mutation could alter the function of a second protein involved
in this pathway, thereby overcoming the defect in the first.
In some cases, intergenic suppressors involve multimeric
proteins, with each subunit encoded by a different gene. A
mutation in one subunit that inhibits function may be compensated
for by a mutation in another subunit. Another type of
intergenic suppressor is one that involves mutations in genetic
regulatory proteins such as transcription factors. When a first
mutation causes a protein to be defective, a suppressor mutation
may occur in a gene that encodes a transcription factor. The
mutant transcription factor transcriptionally activates another
gene that can compensate for the loss-of-function mutation in
the first gene.

Alternativamente, uma mutação supressora pode ser de uma forma diferente
a mutação do gene a partir de um primeiro-supressor intergénica.
Pesquisadores estudam frequentemente supressores intergênicos como uma forma de ganhar
informações sobre proteínas que têm similar ou redundante funcional
papéis, proteínas que participam de um caminho comum,
proteínas meric múltiplos com duas ou mais subunidades, ea regulamentação
de expressão da proteína por factores de transcrição. Um exemplo
de uma análise de supressão intergénica em Drosophila está descrito em
Capítulo 4 (veja a Figura 4.25).
Como supressores intergênicos trabalhar? Estes supressor
mutações geralmente envolvem uma mudança na expressão de um
gene que compensa uma mutação de perda de função que afecta
outro gene (ver Tabela 16.3). Por exemplo, uma primeira mutação
podem causar uma proteína para ser parcialmente ou completamente com defeito.
Uma mutação supressora intergénica de um gene estrutural diferente
pode ultrapassar este defeito ao alterarem a estrutura de uma segunda
proteína de modo a poder assumir o papel funcional da proteína primeiro
não pode executar. Em alternativa, pode supressores intergênicos
envolver proteínas que participam em uma via celular comum.
Quando uma primeira mutação afecta a actividade de uma proteína, um supressor
mutação pode alterar a função de uma segunda proteína envolvida
nesta via, superando, assim, o defeito no primeiro.
Em alguns casos, os supressores intergênicos envolver multim�ica
proteínas, com cada subunidade codificada por um gene diferente. UMA
mutação em uma subunidade que inibe a função pode ser compensada
para por uma mutação em outra subunidade. Outro tipo de
supressor intergénica é aquele que envolve mutações em genética
proteínas reguladoras, tais como fatores de transcrição. Quando um primeiro
mutação faz com que uma proteína seja defeituoso, uma mutação supressora
pode ocorrer num gene que codifica um factor de transcrição. o
fator de transcrição mutante ativa transcriptionally outro
gene que pode compensar a mutação de perda de função em
o primeiro gene.


Less commonly, intergenic suppression involves mutations
in nonstructural genes that alter the translation of particular
codons. Examples are suppressor tRNA mutants, which have
been identified in microorganisms (see solved problem S1). Suppressor
tRNA mutants have a change in the anticodon region
that causes the tRNA to behave contrary to the genetic code.
Nonsense suppressors are mutant tRNAs that recognize a stop
codon, and instead of stopping translation, put an amino acid
into the growing polypeptide chain. This type of mutant tRNA
can suppress a nonsense mutation in the mRNA from a structural
gene. However, such bacterial strains grow poorly because
they may also suppress stop codons in the mRNAs from normal
genes.
Changes in Chromosome Structure
Can Affect the Expression of a Gene
Thus far, we have considered small changes in the DNA sequence
of particular genes. A change in chromosome structure can
also be associated with an alteration in the expression of specific
genes. Quite commonly, an inversion or translocation has
no obvious phenotypic consequence. However, in 1925, Alfred
Sturtevant was the first to recognize that chromosomal rearrangements
in Drosophila melanogaster can influence phenotypic
expres​sion(namely, eye morphology). In some cases, a chromosomal
rearrangement may affect a gene because a chromosomal
breakpoint—the region where two chromosome pieces break
and rejoin with other chromosome pieces—occurs within a gene.
A breakpoint within the middle of a gene is very likely to inhibit
gene function because it separates the gene into two pieces.
In other cases, a gene may be left intact, but its expression
may be altered when it is moved to a new location.

Menos comumente, a supressão intergenic envolve mutações
em genes não estruturais que alteram a tradução de particular
códons. Exemplos são os mutantes supressores de ARNt, que têm
foram identificados em microrganismos (ver problema resolvido S1). Supressor
ARNt mutantes tem uma alteração na região do anticodão
que faz com que o ARNt se comportar contrário ao código genético.
Supressores sem sentido são ARNt mutantes que reconhecem uma parada
códon, e ao invés de parar tradução, colocar um aminoácido
para a cadeia polipeptídica em crescimento. Este tipo de mutante de ARNt
pode suprimir uma mutação sem sentido no mRNA a partir de um estrutural
gene. No entanto, essas cepas de bactérias crescem mal porque
Eles também podem suprimir a codões de terminação no ARNm do normal
genes.
Mudanças na estrutura dos cromossomas
Pode afetar a expressão de um gene
Pequenas alterações, até agora, temos considerados na seqüência do DNA
de genes particulares. Uma alteração da estrutura dos cromossomas pode
também estar associado com uma alteração na expressão de específica
genes. Muito comumente, uma inversão ou translocação tem
nenhuma conseqüência fenotípica óbvio. No entanto, em 1925, Alfred
Sturtevant foi o primeiro a reconhecer que rearranjos cromossômicos
em Drosophila melanogaster pode influenciar fenotípica
expressão (ou seja, a morfologia do olho). Em alguns casos, um cromossómico
rearranjo pode afectar um gene cromossómico porque um
ponto de interrupção-a região onde duas peças cromossómicas quebrar
e voltar com outro cromossomo peças-ocorre dentro de um gene.
Um ponto de interrupção no interior do meio de um gene é muito provável para inibir
a função do gene, pois separa o gene em duas partes.
Em outros casos, um gene pode ser deixado intacto, mas a sua expressão
pode ser alterada quando é movido para um novo local.


When this
occurs, the change in gene location is said to have a position
effect. How do position effects alter gene expression? Researchers
have discovered two common explanations. Figure 16.2 depicts a
schematic example in which a piece of one chromosome has been
inverted or translocated to a different chromosome. One possibility
is that a gene may be moved next to regulatory sequences
for a different gene, such as silencers or enhancers, that influence
the expression of the relocated gene (Figure 16.2a). Alternatively,
a chromosomal rearrangement may reposition a gene from a less
condensed or euchromatic chromosome to a very highly condensed
or heterochromatic chromosome. When the gene is moved
to a heterochromatic region, its expression may be turned off
(Figure 16.2b). This second type of position effect may produce a
variegated phenotype in which the expression of the gene is variable.
For genes that affect pigmentation, this produces a mottled
appearance rather than an even color. Figure 16.3 shows a position
effect that alters eye color in Drosophila. Figure 16.3a depicts
a normal red-eyed fruit fly, and Figure 16.3b shows a mutant fly
that has inherited a chromosomal rearrangement in which a gene
affecting eye color has been relocated to a heterochromatic chromosome.
The variegated appearance of the eye occurs because
the degree of heterochromatin formation varies across different
regions of the eye. In cells where heterochromatin formation has
turned off the eye color gene, a white phenotype occurs, but other
cells allow this same region to remain euchromatic and produce a
red phenotype. Mutations Can Occur in Germ-Line
or Somatic Cells
In this section, we have considered many different ways that
mutations affect gene expression. For multicellular organisms,
the timing of mutations also plays an important role. A mutation
can occur very early in life, such as in a gamete or a fertilized
egg, or it may occur later in life, such as in the embryonic
or adult stages. The exact time when mutations occur can be
important with regard to the severity of the genetic effect and
whether they are passed from parent to offspring.

Quando esta
ocorre, a mudança de localização do gene diz-se ter uma posição
efeito. Como efeitos da posição de alterar a expressão genética? Pesquisadores
descobriram duas explicações comuns. A Figura 16.2 ilustra uma
exemplo esquemático no qual uma parte de um cromossoma foi
invertido ou translocados num cromossoma diferente. Uma possibilidade
é um gene que pode ser movido para próximo sequências reguladoras
para um gene diferente, tais como potenciadores, silenciadores ou que influência
a expressão do gene realocada (Figura 16.2a). Alternativamente,
um rearranjo cromossómico pode reposicionar um gene a partir de um menos
cromossoma condensado ou euchromatic a um muito altamente condensada
ou cromossomo heterochromatic. Quando o gene é movido
a uma região heterochromatic, sua expressão pode ser desligado
(Figura 16.2b). Este segundo tipo de efeito pode produzir uma posição
fenótipo variegada em que a expressão do gene é variável.
Para genes que afectam a pigmentação, isto produz um mosqueado
aparência ao invés de uma cor uniforme. A Figura 16.3 ilustra uma posição
efeito que altera a cor dos olhos em Drosophila. Figura 16.3 retrata
uma mosca de olhos vermelhos normais fruto, e Figura 16.3b mostra uma mosca mutante
que herdou um rearranjo cromossómico no qual um gene
que afeta a cor dos olhos foi transferido para um cromossomo heterochromatic.
A aparência variegada do olho ocorre porque
o grau de formação de heterocromatina varia entre os diferentes
regiões do olho. Nas células onde a formação tem heterochromatin
desligou o gene cor dos olhos, um fenótipo branco ocorre, mas outros
células permitir que esta mesma região para permanecer e produzir um euchromatic
fenótipo vermelho. As mutações podem ocorrer em linha germinal
ou Células Somáticas
Nesta seção, nós consideramos muitas maneiras diferentes que
mutações afetam a expressão do gene. Para os organismos multicelulares,
o tempo de mutações também desempenha um papel importante. Uma mutação
pode ocorrer muito cedo na vida, tal como num gâmeta ou um fertilizado
ovo, ou pode ocorrer mais tarde na vida, tal como no embrionário
ou estágios adultos. A hora exata em que as mutações ocorrem pode ser
importante no que respeita ao efeito da gravidade e genética
se eles são passados ​​de pais para filhos.


Geneticists classify the cells of animals into two types—the
germ line and the somatic cells. The term germ line refers to cells
that give rise to the gametes such as eggs and sperm. A germ-line
mutation can occur directly in a sperm or egg cell, or it can occur
in a precursor cell that produces the gametes. If a mutant gamete
participates in fertilization, all cells of the resulting offspring will
contain the mutation (Figure 16.4a ). Likewise, when an individual
with a germ-line mutation produces gametes, the mutation may be
passed along to future generations of offspring.
The somatic cells comprise all cells of the body excluding
the germ-line cells. Examples include muscle cells, nerve
cells, and skin cells. Mutations can also happen within somatic
cells at early or late stages of development. Figure 16.4b illustrates
the consequences of a mutation that took place during
the embryonic stage. In this example, a somatic mutation has
occurred within a single embryonic cell. As the embryo grows,
this single cell is the precursor for many cells of the adult organism.
Therefore, in the adult, a portion of the body contains the
mutation. The size of the affected region depends on the timing
of the mutation. In general, the earlier the mutation occurs during
development, the larger the region. An individual that has
somatic regions that are genotypically different from each other
is called a genetic mosaic.
Figure 16.5 illustrates an individual who had a somatic
mutation occur during an early stage of development. In this
case, the person has a patch of white hair, but the rest of the hair
is pigmented. Presumably, this individual initially had a single
mutation occur in an embryonic cell that ultimately gave rise to a
patch of scalp that produced the white hair. Although a patch of
white hair is not a harmful phenotypic effect, mutations during
early stages of life can be quite detrimental, especially if they disrupt
essential developmental processes. Therefore, even though
it is smart to avoid environmental agents that cause mutations
during all stages of life, the possibility of somatic mutations is
a rather compelling reason to avoid them during the very early
stages of life such as fetal development, infancy, and early childhood.
For example, the possibility of somatic mutations in an
embryo is a reason why women are advised to avoid getting
X-rays during pregnancy. 


Geneticistas classificam as células de animais em dois tipos-o
germinal e as células somáticas. A linha germinal termo refere-se a células
que dão origem aos gametas, como ovos e espermatozóides. A linha germinal
mutação pode ocorrer directamente em uma célula de esperma ou ovo, ou pode ocorrer
em uma célula precursora que produz os gâmetas. Se um gameta mutante
participa de fertilização, todas as células da descendência será
conter a mutação (Figura 16.4a). Do mesmo modo, quando um indivíduo
com uma mutação de linha germinal produz gâmetas, a mutação pode ser
repassada para as futuras gerações de descendentes.
As células somáticas compreendem todas as células do corpo excluindo
as células da linha de germes. Exemplos incluem células de músculo, nervo
As células, e células da pele. As mutações também pode acontecer dentro somática
células em estágios precoces ou tardias do desenvolvimento. Figura 16.4b ilustra
as consequências de uma mutação que ocorreu durante
a fase embrionária. Neste exemplo, uma mutação somática tem
ocorreu dentro de uma única célula embrionária. À medida que o embrião cresce,
esta única célula é o precursor para muitas células do organismo adulto.
Portanto, no adulto, uma parte do corpo contém o
mutação. O tamanho da região afectada depende da temporização
da mutação. Em geral, quanto mais cedo a mutação ocorre durante
desenvolvimento, a maior da região. Um indivíduo que tenha
regiões somáticos que são genotipicamente diferentes uns dos outros
é chamado um mosaico genética.
Figura 16.5 ilustra um indivíduo que tinha uma somática
mutação ocorrer durante uma fase inicial de desenvolvimento. Nisso
caso, a pessoa tem um remendo de cabelos brancos, mas o resto do cabelo
é pigmentado. Presumivelmente, este indivíduo tinha inicialmente um único
mutação ocorrer em uma célula embrionária que, em última análise deu origem a um
remendo de couro cabeludo que produziu o cabelo branco. Apesar de um patch de
cabelo branco não é um efeito prejudicial fenotípica, mutações durante
estágios iniciais de vida pode ser bastante prejudicial, especialmente se elas perturbam
processos de desenvolvimento essenciais. Portanto, embora
é inteligente para evitar a agentes ambientais que causam mutações
durante todas as fases da vida, a possibilidade de mutações somáticas é
uma razão convincente em vez de evitá-los durante o muito cedo
fases da vida, como o desenvolvimento fetal, infância e primeira infância.
Por exemplo, a possibilidade de mutações somáticas em um
embrião é uma razão pela qual as mulheres são aconselhadas a evitar
Raios-X durante a gravidez.

16.2 OCCURRENCE AND CAUSES
OF MUTATION
As we have seen, mutations can have a wide variety of effects
on the phenotypic expression of genes. For this reason, geneticists
have expended a great deal of effort identifying the causes
of mutations. This task has been truly challenging, because a
staggering number of agents can alter the structure of DNA and
thereby cause mutation. Geneticists categorize the cause of mutation
in one of two ways. Spontaneous mutations are changes in
DNA structure that result from abnormalities in biological processes,
whereas induced mutations are caused by environmental
agents (Table 16.4 ).
Many causes of spontaneous mutations are examined in
other chapters throughout this textbook. As discussed in Chapter
8 , abnormalities in crossing over can produce mutations such as
deletions, duplications, translocations, and inversions. In addition,
aberrant segregation of chromosomes during meiosis can cause
changes in chromosome number. In Chapter 11 , we learned that
DNA polymerase can make a mistake during DNA replication by
putting the wrong base in a newly synthesized daughter strand.
Errors in DNA replication are usually infrequent except in certain
viruses, such as HIV, that have relatively high rates of spontaneous
mutations. Also, normal metabolic processes may produce
chemicals within the cell that can react directly with the DNA and
alter its structure. As discussed in Chapter 17 , transposable genetic
elements can alter gene sequences by inserting themselves into
genes. In this section, we will examine how spontaneous changes
in nucleotide structure, such as depurination, deamination, and
tautomeric shifts, can cause mutation. Overall, a distinguishing
feature of spontaneous mutations is that their underlying cause
originates within the cell. By comparison, the cause of induced
mutations originates outside the cell. Induced mutations are produced
by environmental agents, either chemical or physical, that
enter the cell and lead to changes in DNA structure. Agents known
to alter the structure of DNA which lead to mutations are called
mutagens.

16,2 ocorrência e as causas
Da mutação
Como vimos, as mutações podem ter uma ampla variedade de efeitos
na expressão fenotípica dos genes. Por esta razão, os geneticistas
gastaram uma grande quantidade de esforço identificar as causas
de mutações. Esta tarefa tem sido verdadeiramente um desafio, porque uma
número impressionante de agentes pode alterar a estrutura do DNA e
assim, causar mutação. Geneticistas categorizar a causa da mutação
em uma de duas maneiras. As mutações espontâneas são as mudanças no
Estrutura de ADN que resultam de anormalidades em processos biológicos,
mutações induzidas ao passo que são causadas por fatores ambientais
agentes (Quadro 16.4).
Muitas causas de mutações espontâneas são examinados
outros capítulos em todo este livro. Como discutido no Capítulo
8, anormalidades na travessia pode produzir mutações tais como
deleções, duplicações, translocações e inversões,. Além,
aberrante segregação dos cromossomas durante a meiose pode causar
mudanças no número de cromossomos. No Capítulo 11, aprendemos que
DNA polimerase pode cometer um erro durante a replicação do DNA por
colocando a base de errado em um fio filha recém-sintetizados.
Os erros na replicação do DNA são geralmente pouco freqüentes, exceto em certos
vírus, tais como HIV, que têm relativamente elevadas taxas de espontânea
mutações. Além disso, os processos metabólicos normais podem produzir
produtos químicos no interior da célula que pode reagir directamente com o ADN e
alterar a sua estrutura. Como discutido no Capítulo 17, transponível genética
elementos podem alterar sequências de genes, inserindo-se em
genes. Nesta seção, vamos examinar as mudanças como espontâneas
na estrutura de nucleótidos, tais como despurinação, desaminação, e
turnos tautoméricas, pode causar mutação. No geral, um distintivo
O recurso de mutações espontâneas é que a sua causa subjacente
origina no interior da célula. Por comparação, a causa de Induzida
mutações tem origem fora da célula. Mutações induzidas são produzidos
por agentes ambientais, quer químicos ou físicos, que
entrar na célula e levar a mudanças na estrutura do ADN. Agentes conhecidos
para alterar a estrutura de ADN que conduzem a mutações são chamados
mutagénicos.


We begin by examining the random nature of spontaneous
mutations and general features of the mutation rate. Then
we will explore several mechanisms by which mutagens can alter
the structure of DNA. Finally, laboratory tests that can identify
potential mutagens will be described.
Spontaneous Mutations Are Random Events
For a couple of centuries, biologists had questioned whether
heritable changes occur purposefully as a result of behavior or
exposure to particular environmental conditions or whether
they are spontaneous events that may happen randomly. In the
nineteenth century, the naturalist Jean-Baptiste Lamarck proposed
that physiological events—such as the use or disuse of
muscles—determine whether traits are passed along to offspring.
For example, his hypothesis suggested that an individual who
practiced and became adept at a physical activity and developed
muscular legs would pass that characteristic on to the next generation.
The alternative point of view is that genetic variation
exists in a population as a matter of random chance, and natural
selection results in the differential reproductive success of
organisms that are better adapted to their environments. Those
individuals who, by chance, happen to have beneficial mutations
will be more likely to survive and pass these genes to their offspring.
These opposing ideas of the nineteenth century—one
termed physiological adaptation and the other termed random
mutation—were tested in bacterial studies in the 1940s and
1950s, two of which are described here.
Salvadore Luria and Max Delbrück were interested in the
ability of bacteria to become resistant to infection by a bacteriophage
called T1. When a population of E. coli cells is exposed
to T1, a small percentage of bacteria are found to be resistant to
T1 infection and pass this trait to their progeny. Luria and Delbrück
were interested in whether such resistance, called tonr
(T one resistance), is due to the occurrence of random mutations
or whether it is a physiological adaptation that occurs at a low
rate within the bacterial population.

Vamos começar examinando a natureza aleatória de espontânea
mutações e características gerais da taxa de mutação. depois
vamos explorar vários mecanismos pelos quais agentes mutagénicos pode alterar
a estrutura de ADN. Finalmente, exames laboratoriais que podem identificar
potenciais agentes mutagénicos será descrito.
As mutações espontâneas são eventos aleatórios
Para um par de séculos, os biólogos tinham questionado se
mudanças hereditárias ocorrem propositadamente como resultado de comportamento ou
a exposição a condições ambientais particulares ou se
eles são eventos espontâneos que podem acontecer de forma aleatória. no
século XIX, o naturalista Jean-Baptiste de Lamarck propôs
que eventos fisiológicos, tais como o uso ou desuso de
músculos-determinar se traços são passados ​​junto à prole.
Por exemplo, a hipótese sugerida que um indivíduo que
praticado e tornou-se adepto de uma atividade física e desenvolvido
pernas musculosas iria passar essa característica para a próxima geração.
O ponto de vista alternativo é que a variação genética
existe em uma população como uma questão de acaso, e natural
resultados da seleção no sucesso reprodutivo diferencial de
organismos que são mais adaptados aos seus ambientes. Essa
indivíduos que, por acaso, acontecerá a ter mutações benéficas
vai ser mais propensos a sobreviver e passar esses genes para sua prole.
Essas idéias opostas do século XIX e um
denominadas adaptação fisiológica e o outro denominado aleatório
mutação foram testados em estudos bacterianas na década de 1940 e
1950, duas das quais são descritas aqui.
Salvadore Luria e Max Delbrück estavam interessados ​​no
capacidade das bactérias se tornarem resistentes à infecção por um bacteriófago
chamado T1. Quando uma população de células de E. coli é exposta
a T1, uma pequena percentagem de bactérias encontram-se a ser resistente ao
Infecção T1 e passar essa característica para seus descendentes. Luria e Delbrück
estavam interessados ​​em saber se tal resistência, chamado TONR
(T uma resistência), é devido à ocorrência de mutações aleatórias
ou se se trata de uma adaptação fisiológica que ocorre a uma baixa
taxa dentro da população bacteriana.


According to the physiological adaptation hypothesis, the
rate of mutation should be a relatively constant value and depend
on exposure to the bacteriophage. Therefore, when comparing different
populations of bacteria, the number of tonr bacteria should
be an essentially constant proportion of the total population. In
contrast, the random mutation hypothesis depends on the timing
of mutation. If a tonr mutation occurs early within the proliferation
of a bacterial population, many tonr bacteria will be found
within that population because mutant bacteria will have time to
grow and multiply. However, if it occurs much later in population
growth, fewer tonr bacteria will be observed. In general, a random
mutation hypothesis predicts a much greater fluctuation in the
number of tonr bacteria among different populations.
To distinguish between the physiological adaptation and
random mutation hypotheses, Luria and Delbrück inoculated
one large flask and 20 individual tubes with E. coli cells and grew
them in the absence of T1 phage. The flask was grown to produce
a very large population of cells, while each individual culture was
grown to a smaller population of approximately 20 million cells.
They then plated the individual cultures onto media containing
T1 phage. Likewise, 10 subsamples, each consisting of 20 million
bacteria, were removed from the large flask and plated onto
media with T1 phage.
The results of the Luria and Delbrück experiment are
shown in Figure 16.6 . Within the smaller individual cultures, a
great fluctuation was observed in the number of tonr mutants.
This test, therefore, has become known as the fluctuation test.
Which hypothesis do these results support? The data are consistent
with a random mutation hypothesis in which the timing of a
mutation during the growth of a culture greatly affects the number
of mutant cells. For example, in tube 14, many tonr bacteria
were observed. Luria and Delbrück reasoned that a mutation
occurred randomly in one bacterium at an early stage of the population
growth, before the bacteria were exposed to T1 on plates.

De acordo com a hipótese de adaptação fisiológica, a
taxa de mutação deve ser um valor relativamente constante e depender
em exposição para o bacteriófago. Portanto, quando se comparam diferentes
populações de bactérias, o número de bactérias tom deve
ser uma proporção essencialmente constante da população total. Dentro
contraste, a hipótese de mutação aleatória depende do momento
de mutação. De um tom mutação ocorre cedo na proliferação
de uma população bacteriana, muitas bactérias TONR será encontrada
dentro dessa população porque as bactérias mutantes terá tempo para
crescer e se multiplicar. No entanto, se ele ocorre muito mais tarde na população
crescimento, menos bactérias TONR será observado. Em geral, um aleatória
hipótese mutação prediz uma muito maior variação no
número de bactérias TONR entre diferentes populações.
Para distinguir entre a adaptação fisiológica e
hipóteses mutação aleatória, Luria e Delbrück inoculado
um grande balão e 20 tubos individuais com células de E. coli e cresceu
-los, na ausência de fago T1. O balão foi cultivada para produzir
uma grande população de células, ao passo que cada cultura individual foi
crescido a uma população menor de aproximadamente 20 milhões de células.
Eles, então, banhado as culturas individuais em meios contendo
T1 fago. Do mesmo modo, 10 subamostras, cada um consistindo em 20 milhões
bactérias, foram removidos do frasco e plaqueadas em grande
meios de comunicação com T1 fago.
Os resultados da experiência são Luria e Delbrück
mostrado na Figura 16.6. Dentro das culturas individuais mais pequenas, uma
grande flutuação foi observada no número de mutantes TONR.
Este teste, portanto, tornou-se conhecido como o teste de flutuação.
Qual hipótese do apoio desses resultados? Os dados são consistentes
com uma hipótese de mutação aleatória em que o sincronismo de um
mutação durante o crescimento de uma cultura afecta grandemente o número
células de mutantes. Por exemplo, em tubo de 14, muitas bactérias TONR
Foram observadas. Luria e Delbrück fundamentado que uma mutação
Ocorreu aleatoriamente em uma bactéria numa fase precoce da população
crescimento, antes que as bactérias foram expostas a T1 em placas.


This mutant bacterium then divided to produce many daughter
cells that inherited the tonr trait. In other tubes, such as 1 and 3,
this spontaneous mutation did not occur, so none of the bacteria
had a tonr phenotype. By comparison, the cells plated from
the large flask tended toward a relatively constant and intermediate
number of tonr bacteria. Because the large flask had so many
cells, several independent tonr mutations were likely to have
occurred during different stages of its growth. In a single flask,
however, these independent events would be mixed together to
give an average value of tonr cells.
Several years later, Joshua and Esther Lederberg were also
interested in the relationship between mutation and the environmental
conditions that select for mutation. To distinguish between
the physiological adaptation and random mutation hypotheses,
they developed a technique known as replica plating in the 1950s.
As shown in Figure 16.7 , they plated a large number of bacteria
onto a master plate that did not contain any selective agent
(namely, the T1 phage). A sterile piece of velvet cloth was lightly
touched to this plate in order to pick up a few bacterial cells from
each colony. This replica was then transferred to two secondary
plates that contained an agent that selected for the growth of bacterial
cells with a particular genotype.
In the example shown in Figure 16.7, the secondary plates
contained T1 bacteriophages. On these plates, only those mutant
cells that are tonr could grow. On the secondary plates, a few
colonies were observed. Strikingly, they occupied the same location
on each plate. These results indicated that the mutations
conferring tonr occurred randomly while the cells were growing 
As researchers have learned more about mutation at the
molecular level, the view that mutations are a totally random
process has required some modification. Within the same individual,
some genes mutate at a much higher rate than other
genes. Why does this happen? Some genes are larger than others,
which provides a greater chance for mutation. Also, the relative
locations of genes within a chromosome may cause some genes
to be more susceptible to mutation than others. Even within a
single gene, hot spots are usually found—certain regions of a
gene that are more likely to mutate than other regions (refer back
to Chapter 7 , Figure 7.21).

Esta bactéria mutante, então, divididos para produzir muitos filha
células que herdaram a característica tom. Em outros tubos, tais como 1 e 3,
esta mutação espontânea não ocorre, de modo que nenhuma das bactérias
tem um fenótipo tom. Por comparação, as células plaqueadas a partir de
o balão grande tendência em direção a uma relativamente constante e intermediário
número de bactérias TONR. Porque o balão grande teve tantos
células, várias mutações TONR independentes eram susceptíveis de ter
ocorreu durante as diferentes fases do seu crescimento. Em um balão único,
No entanto, estes eventos independentes seriam misturados para
dar um valor médio de células TONR.
Vários anos depois, Joshua e Esther Lederberg também foram
interessado na relação entre a mutação ea ambiental
condições que selecionam para a mutação. Para distinguir entre
a adaptação fisiológica e hipóteses mutação aleatória,
eles desenvolveram uma técnica conhecida como réplica de placas na década de 1950.
Como mostrado na Figura 16.7, que chapeada um grande número de bactérias
sobre uma placa mestre, que não continha qualquer agente selectivo
(ou seja, o fago T1). Um pedaço estéril de pano de veludo foi levemente
tocou para esta placa, a fim de pegar algumas células bacterianas a partir de
cada colônia. Esta réplica foi então transferida para duas secundárias
placas que continham um agente que seleccionado para o crescimento de bactérias
células com um genótipo particular.
No exemplo mostrado na Figura 16.7, as placas secundárias
bacteriófagos T1 contidas. Nessas placas, somente aqueles mutante
células que são TONR poderia crescer. Nas placas secundárias, algumas
Foram observadas colónias. Surpreendentemente, eles ocuparam o mesmo local
em cada placa. Estes resultados indicaram que as mutações
conferindo TONR ocorreu aleatoriamente, enquanto as células estavam a crescer
Conforme os pesquisadores aprenderam mais sobre mutação no
nível molecular, a visão de que as mutações são um totalmente aleatório
processo tem alguma modificação necessária. Dentro do mesmo indivíduo,
alguns genes mutar a uma taxa muito mais elevada do que outros
genes. Por que isso acontece? Alguns genes são maiores do que os outros,
o que proporciona uma maior chance de mutação. Além disso, a relação
locais de genes dentro de um cromossoma pode causar alguns genes
para ser mais susceptíveis a mutações do que outros. Mesmo dentro de uma
único gene, os pontos quentes são normalmente encontrados-determinadas regiões de um
gene que são mais susceptíveis de sofrer mutações do que outras regiões (remeter
o Capítulo 7, Figura 7.21).